jurassic park

The giraffes looked so real.

This thread is quintessential ILX: A single topic goes on a divergence toward creative hilarity.

Anyways, I still believe that Jurassic Park is one of the most magnificent movies that I have ever seen.

"malcolm rex" lol

http://freakytrigger.co.uk/wordpress/wp-content/uploads/2008/05/a-sound-of-thunder-08.JPG

I saw JPIII in the theater and have no memory of it at all. YouTube suggests that the talking Raptor might have just been a dream sequence which would be pretty disappointing...

TS: Jurassic Park vs. Congo.

both pretty awesome movies.

the SNES JP game was pretty good

The Genesis one was a fun platformer too. I thought the Wolf 3d stuff in the snes one was kinda weaksauce

http://www.cpujunky.com/pugsley1218suxSNES/Jurassic%20Park%202.gif

^^^also good

oh god congo is seriously one of the most fun movies to watch drunk

you are too young to be drinking!!!!

wha

Malcolm Rex

― latebloomer, Friday, May 11, 2007 4:39 PM (1 year ago) Bookmark Suggest Ban Permalink

the scene where sam neill is sitting in a tree and imitates a BRONTOSAURUS CALL to get all these brontosaurii to crane their necks up above the forest canopy and stare at him

man

that is magic

I do love this film.

man what a great movie.
― ethan, Wednesday, 16 January 2002 01:00 (7 years ago)

^as true now as it was 16 Jan 2002 01:00

Hold on to your butts!

dinahsaww

when i was 12 i wrote a sequel to jurassic park for a creative writing class. it was basically Predator in the south american jungle with a group of escaped Velociraptors. still the best thing i've ever written. (the raptors win.)

haha my friend would do that for basically every writing assignment in 4th grade. Eventually he ended up at Jurassic Park 6.

I just bought a boxed set of I,II, and III and another disc of even more bonuses for a fiver in Sainsburys. Hours of Jurassic fun.

Silicon Graphics, whose public profile was increased substantially by this movie, sold for a sad-sack $20 million to another has-been this past week.

I just bought a boxed set of I,II, and III and another disc of even more bonuses for a fiver in Sainsburys. Hours of Jurassic fun.

― commons hack spat (Ned Trifle II)

well yes, 2 hours of Jurassic Fun then the 2 shite sequels :P

Jeff Goldblum. what a totally awesome dude.

Hold on to your butts! x 1000

http://www.made2mentor.com/Images/jurassicholdbutts.jpg

I forgot that Samuel Adams was in this movie!

Samuel Johnson, I mean

hold onto your butts, indeed

Samuel Jackson, you mean?

Jurassic Park wasa gyp compared to the book but still enjoyable. Not the horrible abomination that was The Lost World. perhaps if the movie had winked at the audience more...but nope, it was actual not smirking or holding any irony at all when the little black girl SOMERSAULTS and kicks over a dinosaur that WEIGHS SEVERAL TONS.

more like sockuel jacksock

https://www.youtube.com/watch?v=lx6X_VLtfIc

^^ still my favorite scene in the movie

http://io9.com/5431548/velociraptors-cousin-had-a-venomous-bite

http://www.livescience.com/animals/091221-venomous-dinosaurs.html?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+Livesciencecom+%28LiveScience.com+Science+Headline+Feed%29&utm_content=Google+Reader

Using snake-like fangs, saber-toothed dinosaur relatives of velociraptors likely subdued their prey with venom, scientists now suggest.

Paleontologists analyzed the skulls of Sinornithosaurus, whose name means "Chinese bird lizard." This narrow-snouted raptor was the fifth and most bird-like dinosaur species ever to be discovered, and lived roughly 125 million years ago in the warm, moist forests of northeastern China during the late Cretaceous.

"This is an animal about the size of a turkey," said researcher Larry Martin, curator of vertebrate paleontology at the University of Kansas Natural History Museum in Lawrence. "It was almost certainly feathered. It's a very close relative of the four-winged glider called Microraptor."

Their investigation revealed its upper teeth are grooved, long, and fang-like, and its upper jaw contained pockets that could have housed venom glands. These pockets are connected to the base of the teeth by narrow ducts.

"People are probably sorry they missed it, since it's so obvious," said researcher David Burnham, a vertebrate paleontologist at the University of Kansas Natural History Museum in Lawrence.

"When we were looking at Sinornithosaurus, we realized that its teeth were unusual, and then we began to look at the whole structure of the teeth and jaw, and at that point, we realized it was similar to modern-day snakes," Martin said.

How it worked

This pattern of features is specifically much like that found in "rear-fanged" venomous snakes. The fangs in these serpents do not inject venom, but instead channel poison along a groove on the outer surface of the teeth that pierce their prey's flesh.

"This thing is a venomous bird for all intents and purposes," Martin said.

If rear-fanged snakes serve as any sign, the venom Sinornithosaurus employed likely was not lethal. Rather, it may have caused rapid shock, enabling the saber-toothed raptor to subdue its victim, shrinking the odds of retaliation or escape from the prey or piracy from other predators.

"You wouldn't have seen it coming," Burnham said. "It would have swooped down behind you from a low-hanging tree branch and attacked from the back. It wanted to get its jaws around you. Once the teeth were embedded in your skin the venom could seep into the wound. The prey would rapidly go into shock, but it would still be living, and it might have seen itself being slowly devoured by this raptor."

The length of the dinosaur's fangs probably allowed it to penetrate the thick layer of feathers on the birds abundantly available as prey. Teeth at the tip of the snout may have then helped Sinornithosaurus pluck the feathers off its victims.

Recently scientists discovered venom in snakes and lizard was very ancient, dating back to roughly 200 million years ago. "It wouldn't surprise me at all if it dated back to their common ancestor with the dinosaurs," Burnham said.

Other raptors?

These findings are prompting the researchers to look more closely at other raptors.

"Preliminary results suggest that Microraptor may have been venomous too," Burnham said. When it comes to larger, more iconic raptors such as Deinonychus, "they were bigger animals, so they might have lost venom since they had other means of subduing prey, but then again, who's checked?"

There remains potential for many other discoveries in China. "This is just the tip of the iceberg," Burnham noted. "There are thousands of feet of sediment one can search that span an area from North Korea to Inner Mongolia, and it's proven hugely diverse, producing things one could have never imagined.

Martin, Burnham and their colleagues detailed their findings online December 21 in the Proceedings of the National Academy of Sciences.

http://bubleraptor.tumblr.com/

http://io9.com/5813380/who-wants-to-stay-at-a-jurassic-park-themed-love-hotel

watched this again at the cinema tonight. was actually a couple of moments when the audience audibly laughed at the exposition etc., best laugh was at the couple of close up shots of dr ian malcolm's greased torso as he lay injured.

this is probably my favorite spielberg. "i didn't say i was scared."

but the raptors were still scary right?

xp

yeah, raptors were still scary.

i actually hadn't noticed attenborough is doing a scottish accent at times in the film, until today, cinema was howling whenever he cracked some ridiculous groundskeeper willie phrase.

T-Rex attack sequence awesome, raptor stuff scary, much of the rest a risible if technically proficient mess.

https://www.youtube.com/watch?v=iBxgAmdPQWg

heheheherr harrr ehheh heh hehurrrr hehaarrrrrr

gross

i've already gotten ian malcolm, but they say that's not enough. they want alan grant.

grant? you'll never get him out of montana.

why not? ... why not?

because grant's like me. he's a digger. que lindo eres.

you mean 'amazing'

when i was a kid i thought he said the n-word instead of digger

yeah this might be spielberg's best film. kind of want to watch this right now.

anybody else hear that? that's, uh, that's an impact tremor, is what that is. i'm, uh, i'm fairly alarmed here.

sam neill in this reminds me of james mason as dashing expository scientists in jules verne movies, laura dern spends most of the movie laughing, jeff goldblum's character is an authorial mouthpiece so goldblum just fills it up with hilarious tics, the dinosaurs might show up early but the raptors are held off and built up even longer and bigger than jaws was, and there's a major sense of scientific wonder that's both little-kid and grown-up, as when grant splays himself across the triceratops and the cynical malcolm looks on and grins, or when sattler is so absorbed in a plant that amazes her she has to be physically turned to see something more amazing, or when -- and this is kinda sappy but it's spielberg -- grant tosses the raptor claw down from the tree because "we're out of a job" but also because having now seen actual dinosaurs he's achieved the ambition that put him in the job in the first place, which he had previously, heartbreakingly, had to accept was impossible. also the flea circus speech (if malcolm is crichton's puppet this scene is spielberg's) and the way the two kids grin at each other over their desserts just before the raptor scene.

also "well here we are... back... in the car again" obv.

man the opening scene where they lose the worker to the raptor and it's raining and the man's arm slowly slips out of the guy's grasp

when they lower the cow into the raptor pen and 5 seconds later tattered shreds come back up

"clever girl"

a cryogenics container cleverly made up to look like a can of barbasol shaving cream

conspiracy discussed over tapas in a small latin american town?

SHOOT HER dissolving into peaceful tropical river

henry, henry, why didn't you tell me? i insist on being here when they're born.

i think this was gennaro.

...i think this was too.

Never thought this would turn into the new JFK thread.

the raptors are really great in this. perfect movie monster villains.

i watched this stoned a couple of months ago. got seriously emotional during the first scene with the brachiosaurs.

Couple of years and they'll be planning a remake or prequel or something!

also watched the Lost World on cable recently...man, that movie blows. i mean it still has dinosaurs in it and any movie with dinosaurs in it can't *completely* suck, but still.

got seriously emotional during the first scene with the brachiosaurs.

have definitely cried @ "they're moving in herds... they do move in herds"

also watched the Lost World on cable recently...man, that movie blows. i mean it still has dinosaurs in it and any movie with dinosaurs in it can't *completely* suck, but still.

― cave duel (latebloomer), Saturday, July 16, 2011 12:08 AM (2 hours ago) Bookmark

if rumors are to be believed, koepp directed big chunks of that while spielberg was focused on amistad.

You guys who think this is the best Spielberg are crazypants. Most ruthlessly efficient, perhaps. Most Spielbregian of the latter Spielberg, maybe. But best is crazypants.

What is also crazypants is that he did this and "Schindler's List" at the same time. That's some A+ virtuoso compartmentalization.

It's not his best movie by any means. But even Jaws, a superior movie of the same type, doesn't have a living, breathing triceratops.

True. How Spielberg raised and trained such a beast we'll never know ...

he had a second island like john hammond in JP2

Site B-movie

i'd love to spent like a week w/ spielberg just to see how he gets all this fucking shit DONE. i mean the guy producers like 100 movies a year, directs 2, raises 85 children, does charity work, what the fuck.

i dunno man, jaws is jaws of course, and raiders is great, and i even think munich is kind of great except for the sex scene, but c'mon.

I really don't know why this is funny but it just is.

https://www.youtube.com/watch?v=-w-58hQ9dLk

https://www.youtube.com/watch?v=AjZuzC7IQfY

yeah this might be spielberg's best film

This is madness when there are three good Indiana Jones films to choose from.

https://www.youtube.com/watch?v=s0-554bEUL0&feature=related

http://i.imgur.com/ccqpa.png

https://www.youtube.com/watch?v=dFUlAQZB9Ng

^^^ my computer startup noise

"that's the worst thing i can confess."

So I'm totally unsure whether I should take my 8-year old daughter to see this, and yet oddly compelled to do that. What do you think?

take her

i was her age when i first saw it, now i post to ilx, u make the judgment

it came out when i was 8 and it was the most amazing thing in the universe. take her, take herrrr (muldoon voice)

on the way home u can look at her and say "clever girl" and pretend that she is ripping u to pieces

no joke though, the opening scene where they cant save the dude in costa rica, that sucked

anybody else hear that? that's, uh, that's an impact tremor, is what that is. i'm, uh, i'm fairly alarmed here.

― my Sonicare toothbrush (difficult listening hour), Saturday, 16 July 2011 03:59 (1 year ago) Bookmark Flag Post Permalink

somehow i feel like kids can handle 'dinosaur' violence more than other types of movie violence. like i would've been traumatized by 'jaws' as an 8-year-old but i think i'd've been fine with this movie (which didn't come out till i was 12 and jaded haha).

Part of me thinks she'll have a blast, but part of me wants to shelter her a bit longer from a film that will actually grown-up scare her.

Also, the T. Rex attack takes place an hour in, which is 30 minutes past the money-back guarantee point of my local kid-friendly theatre.

Man, when I was little I saw movies like Jaws, and Raiders and Poltergeist and all sorts of scary or intense as shit PG-rated stuff. Did anyone consider at the time whether these movies, or any movies, were appropriate for kids? I have no idea. I can't tell if we've become more sensitive to this stuff because it's a young science or if just screwing up kids and giving them nightmares for life was considered just another part of growing up.

you need to scare her as much as you can now, before she's jaded

xpost I've sort of rationalized it as, well, how can you be scared of dinosaurs? There are no real dinosaurs. But of course, I'm the one she'd be waking up in the middle of the night when she has (equally not real) dinosaur nightmares.

Haha, that's actually crossed my mind, in a weird sort of way!

I was 9 when this film was released. It is the best most magical film.

Kids loved it.

More importantly, I thought the 3D retrofit worked amazing well, really emphasizing all the vertical scale. Looking up at tall dinosaurs, looking down from fences and tall trees, etc. Super cool effect.

We saw it on friday, and this was all anyone could talk about afterwards:
http://images.fandango.com/MDCsite/images/featured/201110/jurassic-park-blu-ray-shirtless-ian-malcom.jpg

In 3D! Just like the real Goldblum!

http://www.glassgiant.com/romance/romance_novel.php?sid=72em04p7ogn93gc41mkfoh5os0×tart=1365975595&MAX_FILE_SIZE=3145728&title1=Jurassic+Park&title2=&subtitle1=Nature+Finds+a+Way&subtitle2=&author=Jeff+Goldblum&initials1=&initials2=&color=red&align=br&submit=Make+Romance+Novel

http://24.media.tumblr.com/73562ee3b504e9fb3617d301114706af/tumblr_mltajghQuY1qdmv0so1_500.gif

this was easily the most i've ever liked a 3d movie but it helped that it was jurassic park

cried like three times, as usual; compare to zero for lincoln. idk.

the raptors' psychopathic eagerness--like, they tend to literally lick their lips before jumping at someone--is a+ monster shit

http://3.bp.blogspot.com/-Ym3C8SHTI6o/Tzx9wTiI46I/AAAAAAAAALo/elfVtY5CjUc/s1600/jurassic+poo.png

Is the 3D any good?

idk how the "i can see the fleas; mummy can't you see the fleas?" scene is regarded generally, i mean they put some p impossible lines in laura dern's mouth ("but i didn't understand that power! and it's OUT NOW!") and john williams is being goopy i guess, but attenborough's speech always rly gets to me because i feel like it's spielberg talking (as opposed to goldblum's chaos monologues which are crichton). superficially hammond's there to represent the Hubris Of Business but all this time is spent on his totally honest drive to enrapture+delight+frighten and the movie understands him better than it does anyone else (altho it does a way better job than most movies with its scientists) because it has the same motives. think they'll have that on the tour?

i loved the 3D yeah. josh in chicago otm re "vertical scale". the raptor lunging at the air ducts was terrifying!

So much of this movie is about vertical space - looking up at tall things, looking down from tall things - that I think the 3D is actually better used than in much of the made in 3D stuff I've seen.

also the car chasing them down the wall / the tree; the t-rex's head coming in through the car's sunroof; tim's panic at the highest point of PERIMETER FENCE when the alarm starts going off; stuff like that. vertigo!

i've only seen three or four 3D movies and one of them was alice in wonderland but one of them was also avatar and this is still the most i've seen it do for a movie.

i would probably cry at the beginning scene as they slowly lose their grips on the man, soaked fabric inexorably slipping in a desperate embrace, "SHOOT HER! SHOOOOOOT HER!!", yeah

loved it

nedry is such a great heel

"dodson! dodson! we've got dodson here!!"

saw this when it came out, thought it was poorly put together and disappointing! violated the traditional form of the disaster movie in which things get worse and worse and worse -- instead, things got very bad at the beginning and then got better and better and better incrementally -- i am not against violating tradiational forms in general but in this case my response was "oh, i see why the traditional form is what it is, this is not very exciting." had no idea it had acquired defenders all these years later.

i do remember the "clever girl" moment as being good. and every line out of j goldblum's mouth as being kind of ridiculous

would no doubt feel the same way about star wars if it had come out when i was 23

if you're not down w jurassic park you have no soul

2 true. but i wonder if it's at all possible to have any kind of critical perspective on something that before the age of ten you had basically internalised every second of.

Y'all are young. Ever seen "Jaws?"

It's about a shark. Pretty scary.

can we talk about how, the first two times we see an approaching monster announced by a quivering fluid, it's because the monster is so big it makes the ground shake, but then, at the end, when we graduate to the first-tier monsters, the really scary ones, it isn't "impact tremors" they shake stuff with but fear:

http://cdn.clotureclub.com/wp-content/uploads/2013/04/Dtdipkb.gif

violated the traditional form of the disaster movie in which things get worse and worse and worse -- instead, things got very bad at the beginning and then got better and better and better incrementally

this is totally true and is one of the reasons i don't think of this as a disaster movie; it's more
http://images5.fanpop.com/image/photos/26300000/20000-Leagues-Under-the-Sea-james-mason-26396157-504-332.jpg

"adventure", i guess

http://bbsimg.ngfiles.com/1/15860000/ngbbs47e95bafeaf97.jpg

saw this today, brought back so many memories, buying a framed picture of a raptor (chosen from among several different ones) in a shoprite down on snyder across from the modell's sporting goods, hanging that framed picture in my room until we moved.

this is p hilarious: https://www.youtube.com/watch?v=3CMGxd9nhPw

https://www.youtube.com/watch?v=IHY1WcxZm2Q

i was so moved that i had to take notes on~my thoughts~

• you know gennaro's gonna be good from the first shot with his broad tie that's stuck in between the two folds of his double breasted jacket, greeting the first archaeologist in spanish and then switching to english, scrambling all over the place slipping in his tan bluchers.
• actual raptor cries in the background while alan explains how a velicoraptor would slit the kid's stomach open, the sound of the claw slowly going skriiiiiitch across the fabric.
• we know hammond's the consummate salesman, but i love the touch of personal touch by momentarily saying shedule and correcting himself. shows the customer that he's really accommodating himself for u. see also later with his merry-go-round/carousel mixup.
• scene with teh seatbelts in the helicopter, gets across so much without saying anything
• how desperate to appear professional nedry is when talking to dodgson, 18 minutes becomes at least 20 when he's actually trying to pull it off.
• DODGSON HERE, WE'VE GOT DODGSON. GOOGLE DODGSON AND FIND COSTA RICA.
• when everybody first sees the dinosaurs, the jeep driver is just resting his head on the wheel, already so accustomed to the sight, doesnt give a shit.
• running theme of how alan/ellie keep on scientifically analyzing everything they see while simultaneously being awestruck @ everything. also alan's detachment at just accpeting that carnivores are gonna be carnivores, even when one tried to eat him a few scenes before
• hammond's cane made out of vertebrae with an amber cap!
• bingo! di-no D-N-A
• lols @ gennaro saying 'autoerotica' in the film room
• hammond casually dropping that t-rex moves at 32-33 mph, and then when u watch the car chase...
• ellie's disgust @ food after watching raptor feeding
• not just the super rich, "everybody in the world deserves to see them!"
• hammond when u first see him not in the presence of people he has to impress being nervous, anxious, irritable
• nedry's sexy girl background, "find nedry! check the vending machines"
• ian tries to give alan some whiskey but he rejects, moments later alan fills u phis flask with rainwater and gives it to ian who accepts
• "your dad ever build you a tree house?" "no" "yeah me too"
• shot of stepping in the j-park brochure in the aftermath of gennaro's outhouse
• the tension between hammond's salesmanship/conman qualities and his desire to deliver genuinely awe-inspiring and exciting product, i am really digging DLH's take above
• love it when hammond is analyzing his failures during hte ice cream scene, we should make it less automated, but making it less automated was exactly what led to the death of the worker in the beginning who had to climb up on top of the raptor container to open the door
• ATCGATCGATCGATCGATCG projected on the raptor
• triceratops had to have had morning sickness, right? also liked how not finding west indian pods in the spoors showed that ellen's initial skepticisms were wrong (i.e. hammond picking out the wrong kinds of plants to populate his world because they were pretty didnt actually do any harm), but overall, alan + ellie + ian were not WRONG wrong, u know?
• what's up with the lysine contingency, okay so the dinosaurs are gonna die out if they don't get lysine, so what? was this picked up in the lost world?

hammond's explanation of the raptor hunting tactics nicely foreshadows "clever girl" sequence

u mean muldoon?

yeah, hammond explains it to the little kid ("he locks eyes with you ...") and that's just what happens to muldoon

u mean alan

oh right. duh!

when everybody first sees the dinosaurs, the jeep driver is just resting his head on the wheel, already so accustomed to the sight, doesnt give a shit.

running theme of how alan/ellie keep on scientifically analyzing everything they see while simultaneously being awestruck @ everything. also alan's detachment at just accpeting that carnivores are gonna be carnivores, even when one tried to eat him a few scenes before

i beyond love how at first ellie doesn't see the brachiosaur because she's too absorbed in a leaf. in another movie this might have been a LOL SCIENTISTS joke but in this movie it's a little thrill, because, look how amazed and confused that leaf is making her! imagine how she's gonna feel in a second.

Jeff Goldblum confirmed his casting as audience proxy when mine laughed heartily after he asks, "So are we gonna meet some dinosaurs?" or whatever on the 30-minute mark.

triceratops had to have had morning sickness, right? also liked how not finding west indian pods in the spoors showed that ellen's initial skepticisms were wrong (i.e. hammond picking out the wrong kinds of plants to populate his world because they were pretty didnt actually do any harm), but overall, alan + ellie + ian were not WRONG wrong, u know?

what's up with the lysine contingency, okay so the dinosaurs are gonna die out if they don't get lysine, so what? was this picked up in the lost world?

ha, these two are related: iirc in the book it's revealed that the dinosaurs are getting lysine from poorly planned foliage. in the movie yeah it's abandoned. can't remember if the lost world brings it up. but i like attenborough's delivery on PEOPLE. ARE. DYING. because one of the reasons he's being so intense about not letting people die is he wants to get the conversation away from the possibility of letting the dinosaurs die.

similarly, for a long time i thought that when hammond screams on the phone near the end it's because he doesn't want grant to shoot the raptors. but he's prob just scared.

hah okay that makes sense - i like the idea of the herbivores being the bottom feeders, getting lysine into their diets, then the carnivores eat the herbodinos, kinda like how we have to eat meat to get b12

i also really liked how it wasn't just the dynos that were driving the action, there were also falling cars + 10,000 volt fences coming back online

well i think he's scared for his grandchildren in that scene, he's just found out they're okay xp

hammond pricking his on-screen self's finger was also a great moment, hammond is such a carnie

also
*goat just stands there, does nothing* "t-rexes want to HUNT" *goat just lays down, bleats*

this is an intense wikia:

http://jurassicpark.wikia.com/wiki/Lysine_contingency

well i think he's scared for his grandchildren in that scene, he's just found out they're okay xp

― 乒乓, Monday, April 29, 2013 3:59 PM (2 minutes ago) Bookmark Flag Post Permalink

yeah this seemed obvious to me this time. i get better every day at understanding humans

SLJ excels with his paragraph of lysine-contingency exposition: just drills right through it so everyone can move on. made me more sympathetic to tarantino's casting him as the voice explaining nitrate film.

yeah SLJ was awesome in his world-weariness, although i don't think SLJ smokes in real life because who leaves a cigarette dangling from the exact center of their mouth

contrast between ringleader hammond with a tophat and a cane and motorizing-the-flea-circus, foggy glasses hammond really is the heart of the movie imo

I KNOW xp

hammondthing #722: his obvious annoyance when muldoon first shows up and starts going on and on about how terrifyingly dangerous the raptors are. when muldoon says that they attack the fences and ellie says "the fences are electrocuted, aren't they?" hammond turns to her with this hilarious Reassurance Face just as muldoon jacks up the ominousness of his tone a few tiers for "they remember."

also just realized that muldoon intentionally exaggerated the threat when he's walking over to the compound with ellie. love how quickly he switches into big game hunter mode, although u could argue he never really was out of it. looking back, i'm pretty sure they haven't actually encountered any raptors at that point. ellie's able to get to the bunker with ease, no threats. muldoon is only shown much later having sighted a raptor. muldoon's motivations made clear: he's been licking his teeth the whole movie, when he was describing the raptor's earlier, he wasn't warning, he was battle planning.

muldoon and ellie's twin extra high-waisted shorts.

lingering shot from directly behind the latter just before her reunion w grant

! one of my favorite shots

hammondthing #723: when he finds out that the tropical storm is not turning, mutters "i knew we should have built in orlando instead"

I saw this when i was 11 or 12? Fell in love with this movie, had the soundtrack, used to listen to it over and over again before going to sleep, hoping i would dream i was in such a lush and wonderful natural paradise. Also fell in love w Laura Dern, natch.

So many good one-liners in this movie!

This is one of the few films where all the beats are so brazenly laid out - this is how the raptors hunt! this is how far the T.Rex can run! It can follow motion, but raptors just get you! X will only happen if Y happens first! there's not reason to worry about Z unless X! - but you don't mind. All the pieces just fall in to place.

This being an adventure film (a la King Kong) is pretty OTM, and it's why I had no problem letting my (older) daughter see it.

also liked how not finding west indian pods in the spoors showed that ellen's initial skepticisms were wrong (i.e. hammond picking out the wrong kinds of plants to populate his world because they were pretty didnt actually do any harm)

iirc in the book she was right, the triceratops was swallowing gizzard stones to aid w/digestion and was ingesting the plant that way.

hah, i thought the regularity of it (every 6 weeks!) meant that the trike was laying eggs every 6 weeks

do remember ellie picking up a few stones while looking at the dynopoop

There is clearly a lot of her character cut out of the film. For example, when she just vanishes after her "I'm going to hang out here and study poop" line, and then doesn't appear until many moons later, with no introduction, alongside SLJ in the control room, well after shit has started to go wrong.

Saw this in 3D and its still soooo good

yeah i was kind of wondering what happened to her + dr. harding, i assume dr. harding made it to the docks, hopefully henry did too

I watched the 3d one last night. It was great! Here's my notes:

-"Shoot her!" is such an epic scene, and it is a classic line and the delivery is great. It's almost something you would hear in a Hammer horror.
-When the insurance guy says "the insurance company.." and slips and makes that silly sound.
-The scene where they are having lunch and arguing in a room full of projectors scrolling through science slides.2 The lighting is so great here!
-"An interactive cd-rom!" we have an OG nerd
-Dr. Grant slams the door in that kid's face while he's doing an Anakin parody
-"Hold ono your butts" catchphrase of the 90s
-is Muldoon actually James Bond is disguise?
-"Dinosaurs eat man, woman inherits the earth"
-The Zoo Tour TV-like "You might have dinosaurs on your dinosaur tour?"
-That water drops and hand-touching move Ian pulls on Ellie
-Ellie's style is sexy anime scientist
-The lawyer totally waiting to get killed by a dinosaur from the first time they get into the park, it's written all over his face in every scene.
-"Dino droppings ... droppings?" <Seinfeld cue>
-"That is one big pile of shit." <Seinfeld cue>
-that proto-quicktime file nedry pretends to talk to is SO COOL
-the look dr grant gives when he hears "future ex-mrs. malcom"
-"Look at this workstation!" SLJ, IT critic
-how all the passwords samuel l jackson says are typed as something else
-lawyer dude sees how scared he is in the rearview mirror
-"When you gotta go you gotta go" horror abstracted into comedy. the t-rex scene is a highly stylized b-movie extreme collage. all the kids dialogue is doubled. "He left us! He left us!"
-T-rex roar is ALL-TIME
-the 3d when Ian is running from the t-rex is incredible
-"Don't move" is cut off at the beginning so it sounds like "on't move"
-the funny sound when nedry falls down. his death is a great monster movie moment. the thunder and lightning are perfect!
-trees naturally look good in 3d, and this movie has lots of trees
-Laura Dern really selling the horror of the car chase, later becomes hardened action movie star in 2nd half.
-Dr. Grant's American accent slipping on the big tree but it adds to the sentimentality
-i like the quieter boring parts of this movie it gives a breathing room for the extreme parts and makes them seem even more impactful
-"the power of this place" the beatific religion of jurassic park. they aren't just knocked out by seeing dinosaurs, it's a spiritual experience. "life found a way" is a very profound moment, with the footprints mirrored at the beginning and ending of the scene where a kid tells a brachiosaur "god bless you!"
-"Hold onto your butts" slj reboots the movie and now it's a straight-up action movie with action heroes and mugging villains
-some parts of this, like the Gallamimus chase, were made for 3d. "Go...now!" this movie slipps into comic book dialogue at certain points.
-"Clever girl" scene ending w dinosaur chillin sunglasses.gif w a snake
-the 90s: when hackers were heros and not villains
-Hitchcockian moment when Dr Hammond screams "grant!" into phone and it shows an empty room w a gun then it cuts to gunshots in glass
-Laura Dern looking at the camera like a lioness during penultimate scene (dino sound timed to make it sort of seem like Ellie's growling)
-fuck yeah! @ "when dinosaurs ruled the earth"
-completely silent helicopter ride is chill.
-that bird is science!

That first scene where they are all amazed and see the dinosaurs for the first time made such a huge impact on me as a kid, but last night when that happened it seemed really funny to me for some reason. Maybe it's the weight of the whole OMFGTHISISAMAZINGness of it all is just kind of ridiculous. They are all weeping, on their knees, they can't stand up. It's like these dinosaurs are Jesus or something.

the thing about the interative cd-rom is i bet that thing would have skipped like a motherfucker due to bumps on the road

Maybe it's the weight of the whole OMFGTHISISAMAZINGness of it all is just kind of ridiculous. They are all weeping, on their knees, they can't stand up. It's like these dinosaurs are Jesus or something.

always thought there was a subtext to that as the "dawn of CGI in movies" as in "look what's possible now!" like at that moment it's really about itself as a movie as much as about the characters seeing dinosaurs. or less charitably, the characters are performing how we're supposed to feel when we watch CGI spectacles.

otm
http://i.imgur.com/DOQFYLs.gif

they're paleontologists! ellie can't even deal with the leaf.

-"Look at this workstation!" SLJ, IT critic

this line has kept me disciplined for years (in this single area)

like when do you think was the last point in alan grant's life he wanted something more than to see a dinosaur, age 7

still otm about the cgi-spectacle meta stuff tho yeah. part of the hammond-spielberg fusion.

yeah that subtext works seamlessly with the characters and plot.

also!

-the funny sound when nedry falls down.

so glad someone mentioned this i always think i am hallucinating it. it is a straight-up cartoon slide whistle.

haha i missed that sound now i gotta see it again

-That water drops and hand-touching move Ian pulls on Ellie

i have literally no pick-up moves but if i did this would be where i would try to start, i think.

imperfections?

microscopic

it's a total injustice done to ellie in the name of exposition to have her do the WHOOSH! over-my-head thing after all malcolm says is "unpredictability in complex systems"

for sure, especially given her later sexism and survival line

I'M ON CHANNEL FOUR

"access - peanubutter sammwich
access- password
access- penis
access- pajamas

DAMNW"

the perfect riposte to hammond's anachronistic chauvinism

was kinda weird how arnold gets a hacker-cred text based command interface, but later lex gets a full-fledged, tricked out 3D GUI to play around w/

well she's looking for an actual function in the interface ("turn on door locks") and he's trying to fix a problem i guess. so he had to bring up the terminal.

nothing he says rly makes sense tho. nedry turns the keystrokes off, but apparently we can still see him invoking "this next thing: white_rabbit_obj" altho we can't see what it did because the "keystrokes are off" so we have to "go through all the computer's lines of code one by one" and hold onto your butts

otm hacker detail tho: "call nedry's people. in cambridge."

SLJ's delivery on "about a million" is one of my favorite performances by him. Just that line.

"yup."

so we have to "go through all the computer's lines of code one by one" and hold onto your butts

― the white queen and her caustic judgments (difficult listening hour), Tuesday, April 30, 2013 4:51 PM (3 minutes ago) Bookmark Flag Post Permalink

thank u for reminding me of this i just lold at my desk

-Laura Dern really selling the horror of the car chase, later becomes hardened action movie star in 2nd half.

it somehow took me years to notice that she's just screaming SHIT! SHIT! SHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIT! in that scene and it's kind of the best part of the movie.

of course the visual gag of 'OBJECTS IN MIRROR MAY BE CLOSER THAN THEY APPEAR'

contrast between muldoon's supercool and collected shifting of the gears vs. nedry's hyperactive spinout earlier

yeah from "i'm fairly alarmed here" --> "must go faster" --> "SHIIIIT" -> mirror -> muldoon yelling "GETOFFTHESTICKGETOFFTHESTICK MOVE! MOVE!" --> punch line of entire aspect of movie ryan mentioned upthread "think they'll have THAT on the tour?" that might be the most perfect scene.

(yeah muldoon is more collected than caps imply. very urgent tho.)

nedry's hyperactive spinout earlier

when he saw/attempted fetch w the chirping dilophosaurus the little kid w his parents sitting behind me said "THAT DINOSAUR'S DANGEROUS!"

kid was otm

haha, such a cute lil thing, would have been my first choice for a pet. love the earlier gag of nedry spinning the arrow on the upended road sign in frustration, the arrow happily obliging

http://i.imgur.com/W2JYOyp.png

this makes the dilophosaurus a beautiful but deadly addition... to jurassic park

voiced by richard kiley. we spared no expense

this film led to unending discussions on my football team in high school about what would happen if you could train a velociraptor to play football.

I always thought Dern's pained, panicky stumble-run toward Grant when she's escaped the raptor and he has no idea what he's in for is one of the all-time great horror movie stumble-runs.

Around 2:40 here:

https://www.youtube.com/watch?v=PscRUlsvhtI

of course the visual gag of 'OBJECTS IN MIRROR MAY BE CLOSER THAN THEY APPEAR'

to this day, i think of this 7/10 times that i drive my car.

Dern horrors the fuck out of the 2nd half of this movie.

always thought there was a subtext to that as the "dawn of CGI in movies"

Last night this seemed like that was the whole point! Something i never noticed at the time. It's almost like a demo reel or something.

https://www.youtube.com/watch?v=XUChjs8jcyA

That T. Rex roar really is all time. My wife and I waited in line for over an hour the day this originally opened, and I remember that moment vividly. We both sat boot upright in our seats.

this movie uses laura dern's gorgeous rubber face better than anything outside of inland empire. maybe novocaine haha.

voiced by richard kiley. we spared no expense

love when he wearily trots out the "spared no expense" line again later after everything has gone tits-up

Re: the ice cream, no less! Which of course was sitting there melting into a pool of sweet irony.

i literally say 'must go faster' in the goldblum voice every time i am panicking in a vehicle

somehow this discussion has made me really want to see this movie that i've seen a million times and as recently as a year ago!

In 3D!

Laura dern's ass shoudl have been bared as part of her initiation in the film

https://www.youtube.com/watch?v=CnDH1va7iC0

xpost from worst animal friends

attn: dlh

http://i.imgur.com/OYPhXE5.png

'have you shagged Ian Malcolm yet?'

3000 gold pieces don't translate into dollars like they used to

http://www.ebay.co.uk/itm/390756055657

SHOOT HER. SHOOOT HEEERRRRRR

http://imgur.com/gallery/6aIziOH

love how clear the day-night-day cycle is there. thank john for a lovely weekend.

http://i.imgur.com/XCldnLA.jpg

money and old VHS tapes seem like the germiest things you could potentially surround a baby with.

I've been mashing up the theme from Jurassic Park and the credits for This Morning (UK TV) in my head lately.

I just started watching Lost World: Jurassic Park. It's already weird. Jeff Goldblum stares directly into the camera in the first two minutes.

The audio design is p. weird. There's kind of an overlappy Robert Altman vibe, but one of the voices is piped-in JW trills.

Lightingwise, everything is drab and shadowless – it's overcast for like the first twenty minutes. One thing I like about the original JP is the gradual laying-on of atmospherics. But this film, see, it starts gloomy and stays gloomy. Did SS learn nothing from Ghostbusters 2? Also, Vince Vaughn is bad at comic relief. And, Julianne Moore is not nearly as good as Amy Adams at playing chipper.

I don't know if LW is Spielberg's worst film (although it may very well be), but it certainly feels like the one that he cared the least about while he was making it. Say what you will about Always or Hook or whatever, he at least gave a shit about them.

I don't know if LW is Spielberg's worst film (although it may very well be), but it certainly feels like the one that he cared the least about while he was making it.

Indiana Jones 4 FTW (lose).

In this movie, there are two T. Rexes at two rain-soaked windows of a vehicle. "Hang on, this is gonna be bad," Goldblum says. And then the T. Rexes push a two-segmented RV off a cliff. Goldblum calls Moore 'honey,' and a scuttling man has to tie a rope around a stump, just like Newman did in the first JP.

There's some good shit in Indy 4, though the worst of it is probably the worst of his career.

Yeah, I didn't feel that the problem with Indy 4 was that he didn't care, but that the series was played out, replaced the 80s style effects of the originals with shitty CGI, starred an old and cranky Harrison Ford, co-starred the always-unpleasant Shia LaBoef (sp?), had Ford, Shia and Karen Allen doing a lot of hacky bickering in the middle of already-boring action sequences, had an idiotic anticlimax of an ending ("knowledge was their treasure"), and basically that Spielberg had no business making an Indiana Jones film in 2008. The film felt more like a confluence of problems, but Spielberg being asleep at the wheel was not one of them.

(more like)

(I mean, more like. Fuck it.)

thwarted

Yes, I don't think I'd accuse Spielberg of being asleep at the wheel for really any of his films since the two in '97.

Lost World is so bad

the book is better, is how bad lost world is

The end of the Lost World completely redeems the first half of the movie imo. The ending is a sudden spark of electricity that brings Frankenstein back to life.

As a kid I liked the 'don't go into the interior' idea and bringing in the bad guys motivated by profit

But because it isn't as closely focussed on 'hammond's great idea for a theme park gone wrong' it can't comment on itself as a film whilst also being a family adventure classic in the way that the original can

Except it does comment on itself as a film by referencing king kong at the end, but that feels forced

Is it possible to tell a 130 minute story without theme or moral? Because I don't... uh, I just can't figure out what this movie's about.

Dinos and chaos

the music is hilarious -- it sounds like a damn cecil b. demille biblical epic!

New photos from JP4. No dino pics yet though.

http://www.avclub.com/article/weve-got-some-exclusive-jurassic-world-photos-you-205704

http://s.mlkshk.com/r/ZDKD

I don't understand that picture with the infant and the money. The fuck is going on there

Man, this is a good thread for loving details. Really does show where Spielberg is a cut above other 'entertainer' directors - he's really thinking about all this little shit that will make the scene better, make the movie better. The Lost World is such a mess by comparison, and never for a second escapes its sequel-itis to become any kind of movie in its own right.

http://dangerousminds.net/comments/steven_spielberg_animal_killer_inhumane_prick

access main program

access main security

access main program grid

Samuel L33t Jackson

I hate this hacker crap!

- how many lines of code are there?

- bout two million.

- two million.

- yep.

python -i "main program.py"

python -i "main security.py"

python -i "main program grid.py"

hang onto yer butts

uh, HOLD

swing around from yer butts

Official trailer, not just that two-second tease of Chris Pratt, is out early.

https://www.youtube.com/watch?v=RFinNxS5KN4

Kind of sad that actual dinosaurs are apparently no longer scary or sublime enough to carry a movie, but presumably that point's being folded into the content here. I imagine the geneticists under constant pressure from the suits to come up with new attractions in this world where seeing a genetically-revived dinosaur has become as rote and by-the-numbers as screening the Hollywood-revived reboot of a popular franchise.

Pratt seems miscast

hope this ends in final film.

http://cdn.mos.totalfilm.com/images/a/abandoned-jurassic-park-concept-art-reveals-human-dinosaur-hybrids-117266-00-470-75.jpg

Pratt seems miscast

yep

He looks completely gormless. Hope there's a scene in this where he has to be the one to explain chaos theory.

pratt sounds like he's in a snl sketch

it depends....
on what kind of dinosaur they cooked up in that lab

http://wep.com/wp-content/themes/wep/gallery/Denver/full/17.jpg

The shark being fed to a dinosaur is a pretty good joke.

Wait, so the premise is that not only have they bred more copies of dinosaurs that ate a bunch of people in the previous three movies, but a new hybrid mutant killer smart dinosaur, just because? What could go wrong. When does this take place, in the far distant future when people have forgotten what happened the last few times? Fool me once ...

This looks like a glistening teal and orange cgi-turd. The plot is probably fine, and emotions, and music, and stuff, but god, I hate the look of modern movies.

was thinking CP was like a game warden or something

JP3 is underrated

JP3 is underrated

― StillAdvance

Yep. Good action, some fun characters, totally unpretentious.

Also short and zippy.

The last scene, CP and the raptors are on the same side? Or maybe they're staging a race to decide the fate of the humans on the island

"it’s up to Raptor-specialist Owen — played by Chris Pratt — and his team of super-Raptors must hunt down the rogue dinosaur."

The plot is probably fine

yeah no.

A butterfly flaps its wings and you get super-raptors.

Pratt's raptor team just seems like a neutered version of the gun-wielding dino-mercs from the John Sayles script. Up there with with Kubrick's Napoleon in the unrealised masterpiece stakes

really doubling down on the "raptors are more than just proto-chickens" stretch

Going the Terminator route, turning the unstoppable bad dinosaurs into good guys. Pratt and his merry band of smart raptors, out to take out the T-Rex-1000.

It sounds/looks like they're trying, at least

It might be that the velociraptors have some sort of machinery or implant or drug or pheromones or etc etc that brings them under human control

By 'trying' I mean, some of the plot ideas look ridiculous but at least it's not just 'For some reason some people have to go back to the island'. Also we've never seen these vast crowds of people attendant at the park before, the Mosasaurus in the marina looks like maybe up to a point the film might be able to say something about how Orca whales get treated. Maybe. The point is I'll be obliged to take small relatives to the cinema to watch this anyway so I might as well get in the mood.

pray for whale allegory

But we already have:

http://4.bp.blogspot.com/__oqV_kUSrws/TCzUp9gazwI/AAAAAAAABvw/cyTTiYjxxy8/s1600/7.JPG

This does look cool, as far as having an idealized version of the park fully working with crowds in attendance and all of that. Has potential for some cool disaster movie style scenes and stuff.

Glad to hear that the CGI we see in the trailer is apparently unfinished

Yeah, those dinosaurs were totally fake. And Pratt looked utterly ridiculous, give him a polish, too.

He should have had at least some feathers, for one thing.

http://www.wired.com/2015/02/new-jurassic-world-trailer-hides-improved-cgi-plain-sight/

a dissolve: push in on unearthed mosquito inside rough amber jewel --> pull out from half-buried curve of raptor skeleton being brushed delicately to the surface. que lindo eres. a movie abt people w enthusiasms. people with personal beautiful things. so you two dig up, uh, dig up dinosaurs? hammond's beautiful thing is the delighted audience. is malcom's chaos? is he the only satisfied one??

Beautiful chaos

Jurassic Park passes the Bechdel test because all the dinos are female and the 2 raptors in the kitchen communicate with each other. Discuss

Saw this a week ago on tumblr and been thinking about it ever since

They're talking about the boy they're going to eat. BECHDEL SUBMISSION REJECTED

http://i.imgur.com/VZRBfPw.jpg

What if they were only talking about eating Lex. What if they never even cared about eating Tim, not even a little

Why would anyone want to kill lex. Lex knows unix. Lex is a vegetarian. They were trying to kill tim.

Although, that jelly is NOT vegetarian. brb going to imdb Goofs page

You're probably right :\

On both accounts

looks like a real winner

https://www.youtube.com/watch?v=4EY4qZO4vC4

there's no dinosaurs in that wtf

now eventually you do plan to have, uh, dinosaurs, in your, in your dinosaur movie

a lawyer on the toilet wouldn't go amiss either - maybe his son

lol dlh

Her haircut was the most interesting thing about that scene.

http://i.imgur.com/MlkCmna.jpg

New screens look stunning

http://poorlydrawnlines.com/wp-content/uploads/2015/04/ghosts-of-the-dinosaurs.png

http://i.imgur.com/iMd1Dte.gif

I"m very excited for this movie

Hmm.

This was more or less two hours of "REMEMBER THE FIRST MOVIE?"

purassic jark

nice

xpost to the tune of silverchair's "pure massacre"

i watched the original film again yesterday, for the first time in 20+ years. it holds up! the FX in particular. very smartly done. i was glad that spielberg's in-your-face lighting (which dominated his work for a long time) largely disappears after the opening sequence. the characters are cardboard-thin, though dern and goldblum redeem their parts (the latter in particular). and it doesn't really matter, since the suspense sequences are so terrific. i think it loses a bit of force in the final act when it finally becomes a horror movie. but still. maybe SS's best film after jaws?

and that triceratops animatronic is incredible!

yeah, i watched it again myself recently. the visual fx are still tremendous - i wish movies today were so sparing with cg in favour of practical effects. the most dated thing about it is lex's excitement over an 'interactive cd-rom' like it's the most futuristic technology imaginable in a place where actual fucking dinosaurs are walking the earth.

lex's excitement over an 'interactive cd-rom'

too much time on ilx

haha

Excited to watch this terrible film tonight

The new one, I mean

Where was that recent essay that highlighted why CGI has become so ineffective? Anyway, I think in JP there's something like only 3 minutes of CGI, and if the new Wired Industrial Light and Magic profile is anything to go by, it looks like they were simultaneously pushing CGI and practical effects as a solution and decided in the end to use both. Phil Tippett, iirc, says the movie ultimately put him out of a job, since it finally swung the pendulum from real to computer.

JP is one of those FX miracle movies (along with LOTR) where the FX then are both better and more realistic than FX after decades more development.

LOTR was the beginning of the end w.r.t. movie F/X.

http://www.wired.com/2015/05/inside-ilm/

Just as work was wrapping up at ILM, another Spielberg production came through the doors, this one involving dinosaurs. As much as and had advanced the cause of CG effects, would become a watershed moment—the demarcation between the days of antiquity and the byte-sized future.

WILLIAMS: Dennis Muren took us across the street for lunch and said that there was this huge job coming in from Spielberg—something with dinosaurs.

PHIL TIPPETT (FOUNDER, TIPPETT STUDIO): After Empire, I’d started Tippett Studio. Jurassic Park was a co-venture between Tippett and ILM.

JIM MORRIS (FORMER ILM PRESIDENT): Phil was gonna do the dinosaurs with stop-motion, and we were gonna composite them into the plates with the actors.

WILLIAMS: We said, “Why don’t we just fucking build the whole thing in CG?” The authorities here told me not to bother trying. But we knew digital was capable of this shit.

DIPPÉ: We didn’t have the go-ahead. Spaz and Stefen and I were fearless fools.

FANGMEIER: We went to the Oakland Zoo and filmed elephants and rhinos just to see how that kind of skin folds.

WILLIAMS: I was riding my bike and I ran into a guy from Tippett’s department. He says, “What are you working on?” I say, “I’m building the T. rex.” And he goes, “What the fuck are you talking about? We’re doing that!” He almost got physical with me.

TIPPETT: I’d done a lot of studying with dinosaurs—I’d made a stop-motion dinosaur film—so I had totally boned up on the latest paleontological ideas.

DIPPÉ: The CG dinosaur was accidentally shown to Kathleen Kennedy [one of Jurassic Park’s producers].

WILLIAMS: I finished a CG demo on Sunday night, and the next day Muren and Kathleen Kennedy came walking in and the T. rex walk cycle was playing on a big monitor. She stops and goes, “What’s this?” I say, “I’m just messing around, just working on stuff.”

DIPPÉ: After Kathleen saw the test, the decision was made to show it to Steven. Dennis brought it down to LA and projected it for Steven at Amblin.

GEORGE: They had the T. rex chasing the raptors.

LUCAS: The test blew everybody away. People cried.

SPIELBERG: The fluidity of the running cycles was such that there was no comparison—even with go-motion. I just said, “Well, stop-motion as a process is extinct.”

TREVORROW: I had a friend who worked at the Grand Lake Theater in Oakland, and the night before Jurassic Park came out we sat in the middle of this empty, massive movie palace and had a special screening all for ourselves. I went in as a somewhat jaded 15-year-old who thought he knew how everything worked, and I came out as a kid marveling at the adventure that we were all taken on.

I was dumbfounded when I learned (probably 15 years after the fact) that some of the velociraptors in the first one were people in costumes.

tbf lotr did a lot of impressive stuff with miniatures and other practical effects in addition to shitloads of cg

https://www.youtube.com/watch?v=jAzQr3Ml0UI

planned my whole weekend around seeing this in a giant suburban movie theater because I didn't want to see it in a tiny old sb theater. I hope it's worth it.

wow, that sure explains why the (non-)cg in the first movie looks so much better.

http://me2-solutions.com/wp-content/uploads/2013/05/nakajima.jpg

This movie is dope

waiting for difficult listening hours opinion on this before i make a decision

It's totally shameless

All kinds dinosaurs in the dinosaur movie it's dope

Good not great. Subplot involving D'onofrio the dumbest most nonsensical thing ever.

But then a dinosaur eats someone and it's like *euphoria*

I wanted every character to be eaten

Though to be fair that's true of pretty much every movie I watch.

I wanted every character to be eaten

otm

this was as good as it had to be. kinda hated the ending.

First wave of this thread >>>> First Jurassic Park movie

bummer about the broken jpegs though.

They shoulda named the new Dino the Megaawesomesaurus

I gotta admit this was a much more solid entertainment than I expected based on the terrible trailer.

Really felt like the endangered civilians were almost an afterthought.

"almost"

yeah the obligatory "oh hey here they are" shots every 30 minutes

Second biggest opening of all time. And apparently biggest global opening of all time. People love reboots. The Star Wars people must be really excited. Also, this kinda proves that Age of Ultron was a bit of a disappointment. Perhaps people are getting tired of superheroes? The Fantastic Four people must be a bit worried.

Reboots vs Superheroes...

Some thoughts:

*After sitting through "Tomorrowland," anything would have been awesome.

*This was far from terrible, but if someone told me it was written by an automated computer program, I'd believe it.

*Liked Howard and Pratt a good deal. I'm totally on board with the latter as action hero; he's come a long way since Marine #3 in "Zero Dark Thirty."

*D'Onofrio, on the other hand, had no reason to be in this movie.They could have at least had him fight a dinosaur.

*At least two or maybe three legit laughs, out of place though they were.

*Wow, when did Judy Greer start getting cast as a mom? (Speaking of "Tomorrowland")? Also, she and Howard were super well cast as sisters, despite virtually no screen time. I was totally expecting Laura Dern to pop up as grandma, though, since they could equally plausibly (at least as far as looks; she's way too young) pass for her kids.

*Weird that they set up the park as apparently aimed mostly at little children, as if adults wouldn't be totally blown away visiting a tropical island that is currently the only home (as far as we know!) to formerly extinct dinosaurs.

*There were, of course, a million callbacks to the first movie, some of which (like this movie as a whole) would have worked better had the second and third movies never been made.

*Even more than the first movie, however, there were overt nods to "Aliens," "Predator," "Jaws" and "Romancing the Stone." Dude (whose first movie I haaaaaaaated; once again, looks like anyone can make a passable blockbuster) did his nerd research.

*My daughter was scared, and after the final battle many people in the theatre cheered. Mission accomplished, sequel.

The Fantastic Four people must be a bit worried.

― Frederik B, Sunday, June 14, 2015

Dude, they're opening in August. They already know it's a dud, plus Marvel has been actively working to ensure its failure. I'd be very careful about using it to predict the demise of the superhero genre.

can we spoil this yet

she was a bad aunt but later she was a good aunt

Best callback IMO: ghost of Jeff Goldblum hovering over Jake Johnson's desk in the form of a dust jacket photo on the back cover of Dr. Ian Malcolm's book.

Also: that moment when T. Rex makes ~meaningful eye contact~ with his l'il velocibuddy and you can tell he ~totally wants to high-five~ but he can't because T. Rex arms.

Does she learn how to balance work and aunthood?

movie made me feel bad that I don't know all of my nieces' and nephews' ages

also made me feel bad about my job which is to make genetically modified dinosaur weapons

I want to ride a bb triceratops

pretty cool when the pterodactyl (or whatever it was nerd) picked up the bb triceratops by its saddle

mb it was a pteranodon

just cover yourself & say pterosaur but remember that it isn't a dinosaur

feel like it was a Dimorphodon and that part made me sad poor bb triceratops

guess none of the dinosaurs in jurassic world are anything so pure as a pteranodon. the missing parts of their genetic code have been filled in with frog and lizard genetic code in a lab by an insane man.

still waiting for someone whose opinion i trust on this topic to post itt

pteranodon do a number on the assistant

well kinda

misread ur comment! ^^

I just meant that pterosaurs are not dinosaurs xp

gfy dayo I'm like an expert on jurassic park and obv you should go see this

i only trust dlh's take on this movie

lol i was waiting for dayo's

i haven't even seen mad max

it's true that i am the world's foremost expert on jurassic park tho

you guys need to go together then

the investors whom we represent are deeply concerned

just coordinate your cosplay beforehand

i heard BD wong makes a return in this movie i guess i'll suck it up and go see it

yes, he does. he is the insane man in the laboratory.

DODGSON HERE, WE'VE GOT DODGSON. GOOGLE DODGSON AND FIND A SHAVING CAN

Stuff with Wong and D'Onofrio the ultimate "aren't dinosaurs on the rampage enough for you?!" plot clutter.

D'onofrio totally worth it to have a character literally say "when will these people learn?"

are there people in this movie

Fraid so

made over half a billion dollars globally this weekend

sleep well, lemmings

Do kids count as lemmings? Because they are largely who drive kid movies, plus the adults required to take them.

That said, that's a lot of money! I guess people really wanted another dinosaur movie, or something that wasn't Marvel-related.

https://www.facebook.com/BFF/videos/712353425557789/

saw this yesterday, it was v poor of quality but what movie isn't

Gertrud

Gertrud

Everything in this film that involved humans not being eaten or chased by dinosaurs was basically terrible. Everything with dinosaurs was awesome.

This film really hated its female characters, didn't it?

We basically established in the Armond thread that the film is basically an anti-gay marriage screed.

I think the film hated all its characters, to be honest.

seeing awful people get ATE by DINOSAURS is a wonderful thing and this film delivered on that count

there were no other counts i went to it for

mosasaur ex machina!

In keeping with tradition!

i mean, you have a private island off the coast of costa rica that you have to ferry to, where you pay admission prices that should presumably be much higher than disney world's to see fucking actual dinosaurs, basically an island gathering of 1%ers... they could have done something with that. but instead it was a dumbass monster movie about teh perfect dinosaur :/

is the 'teenage boy obsessed with teenage girls' character in this movie meant to be relatable to the target demographic. or is that just the laziest way to write a teenage boy character?

i think he was just supposed to be a real cool dude

One of the probs with hinging the film on the premise that plain ol' dinosaurs are not scary/exciting is that this might as well been set in a generic safari park. Which it essentially is. Still, lions and monkeys and giraffes and whatnot, I can see why people might take them for granted/not fear them. But you'd still think that giant lizards 10 times the size of elephants would engender at least a tad more respect than the plebes in this movie give them. At the very least, you wouldn't want to get stepped on.

Even the most enervated teens tend to perk up a bit when faced with an actual lion in the flesh, so I didn't really buy that bit either.

Also lol @ the petting zoo which was roughly the equivalent of letting kids ride around on rhinos. It was totally cute though.

I was surprised that the ending was some sort of evolved version of the crazy John Sayles script. I could complain about plot issues, but with a project in development for so long it's surprising that the movie makes any sense at all.

OK I'll complain about them anyway.
- why does the godzilla pen have a godzilla-sized plothole on it?
- why is the old park in the movie at all?
- why do the kids want to go with pratt after all they've seen him do is back up a car?
- it's obvious that most of the jake johnson scenes ended up in the deleted scenes folder. there was a romance?
- why does the nice lady have to get it hardcore dammmnnn? seems like it was intended for a villain.

Gertrud

― the increasing costive borborygmi (Dr Morbius)

very inert of quality

I couldn't figure out how the big new monster dinosaur hid from everyone in its pen. Didn't they do a scan and not find a thermal image or something? And this was before it took out its tracker, too. Maybe I missed a Wong beat where he explain they spliced in some newt that couldn't be detected on monitors or something.

He said it had some DNA from a tropical frog that could regulate its own body temperature

Lindsey Graham?

Gertrud

― the increasing costive borborygmi (Dr Morbius)

very inert of quality

― The burrito of ennui (Alfred, Lord Sotosyn), Monday, June 15, 2015 6:18 PM (3 hours ago) Bookmark Flag Post Permalink

carl th. dreyer's jurassic world

- why do the kids want to go with pratt after all they've seen him do is back up a car?

Because he's, like, way cooler than the woman who literally just killed the dinosaur that was savaging him.

Cross-posting from the death of cinema thread:

http://grantland.com/hollywood-prospectus/jurassic-world-box-office-franchise-movies-hollywood/

As much as I would like to sit in judgment of all this, the seat isn’t particularly comfortable — especially since Jurassic World itself anticipates and drolly comments on this new economy; it is literally, and knowingly, a cautionary tale about the perils of heedless brand extension, which may not make it the movie of the year but certainly makes it the movie of the moment. (Or at least an especially savvy exercise in preempting criticism with irony.) The film both grins and winces at the current excesses, compromises, and uncertainties of entertainment — jabbing lightly at everything from product placement to dependence on foreign financing — and a wincing grin feels about right.

don't like all blockbusters have that kind of winking self-referential irony though? that hardly makes this film novel or even timely.

wincing grin approach is tired and stupid and has been for 30+ years

I'll go for that.

yeah, if anything it's a little refreshing when a big hollywood film acts as if no other films ever existed

as a tactic for deflecting criticism it's transparently obvious and self-serving, kinda sad that anyone would consider it clever or unusual at this late date

xp

First movie had the whole "You're gonna package it" rant taking place inside a gift shop filled with JP merch.

yeah and the film's logo was the same as the theme park's logo. if anything this sort of self-conscious is (ahem) in the series' DNA.

https://dl.dropboxusercontent.com/u/32863603/Screenshot%202015-06-16%2022.11.19.png

xp damnit

all I could find re wincing grin:

http://stockfresh.com/files/s/scheriton/m/70/2006783_stock-photo-man-wincing-in-pain-protecting-private-parts.jpg

iirc in the novel version of the lost world a character gets kicked right in the nuts by a tyrannosaur

http://24.media.tumblr.com/tumblr_m5yqb5l2Wg1rpl29so1_400.gif

the first movie is extremely selfconscious and invites all kinds of comparisons of the park to the movie as enormous corporate-backed enterprise helmed by boyish dreamer whose earnest passion for creating spectacle masks a dangerous control-freak hubris, but this doesn't have a lot to do with wincing grins or self-exculpation or irony (in that sense). it's just content.

i.e. Richard Attenborough eating melting ice cream

in fact the self-reference represents greater confidence not lesser. pride not sheepishness. the movie knows it is actually better than the park. not just because it doesn't eat the tourists--the spectacle itself is better. the dinosaurs don't even show up on the tour, but they sure show up in the movie. ilm's awe-extracting technology is better than ingen's. a while after he asks if there will at some point be dinosaurs, malcolm asks "think they'll have THAT on the tour?" i doubt that this movie thinks it is better than its park. its park looks pretty cool.

the hubris of Laura Dern sticking her arms into a heap of triceratops droppings, convinced it'd improve her skin

The movie has Goldblum's ads, the park doesn't.

abs, u mean

abs too

v. annoyed at how badly run the theme park was, the boys rolled off in that bubble before their seatbelts were even fastened. and those bubbles didn't have a way to be automatically recalled back? wtf kind of ride relies on the honor system, assholes would be rolling around out there for hours while the line backed up to the gate.

also disney's already invented wristbands that track your movements all over the park, why is Terrifying Dinosaur Island dragging their heels on this technology? katie mcgrath could've tracked those asshole kids down hours earlier and saved herself from being killed in such a hilariously gratuitous fashion.

I was impressed by the cell phone coverage.

in fact the self-reference represents greater confidence not lesser. pride not sheepishness. t

i agree with this, but just noting that the self-consciousness is a basic part of the franchise, not some kind of innovation.

This movie was all kinds of ridiculous yet very fun.

If a movie about dinosaurs wasn't ridiculous... I don't even know.

tree of life yo

actually, that's a potent illustration of your point

Jessica Chastain vs Bryce (Dallas) Howard fite!

Yes, The Tree of Life was "about dinosaurs."

the Pittosaurus

http://basementrejects.com/wp-content/uploads/2014/02/land-of-the-lost-season-1-3-dopey-dinosaur-holly-marshall-pet-kathy-coleman.jpg

Jessica Chastain vs Bryce (Dallas) Howard fite!

― Acid Hose (Capitaine Jay Vee), Wednesday, June 17, 2015 10:06 AM (1 hour ago) Bookmark Flag Post Permalink

they look a lot alike, and the first few times i saw the trailer for the new one i presumed it was Jessica Chastain. they should play sisters in a film.

Apparantly, there's a rumour that Jessica Chastain is Ron Howard's illegitimate daughter. It was parodied in Arrested Development season 4.

i doubt that this movie thinks it is better than its park. its park looks pretty cool.

this film is weirdly in the thrall of the park. the big climactic theme breaking out for a shot at some souvenir grottos and an artifical lake felt v strange

you ppl are pop-proctologists nonpareil, God save you.

morbs making a self-parodic post during a discussion of a self-parodic film franchise is next level, i applaud u

xp
https://childtasticbooks.files.wordpress.com/2012/07/pp.jpg

I'd prefer you never address me or refer to me on these boards again, amateurist.

you can't always get what you want.

I mean, I'd prefer a pastrami rueben right now, but all i have is microwave lasagna.

though i appreciate the politeness of your request.

it was edited. i shan't refer to you ever again.

oh shan't you

https://www.youtube.com/watch?v=ZqgWuMcHc3g

Jurrrmaican?

Jurrmaican me SB

u ppl!

There's a decent chance I may get dragged to see this tonight.

The only part I liked was when the dinosaur interrupted the film's six or seventh quasi-philosophical speech about science and evolution, and even that was done better in that Samuel L. Jackson shark movie.

ha, i know exactly what moment you're talking about, although i believe technically that is known as "that L.L. Cool J shark movie"

i.e. the one with this credits tune

https://www.youtube.com/watch?v=WkKb9OvXXvk

This movie was so much better than Age of Ultron, suck it Joss Whedon!

high bar

Took the kids to this over the weekend. They loved it, I tolerated it. We all agreed the grand finale dinosaur face-off was pretty great.

And I know lots has been written about the problems with BDH's character, but really, how is anyone still writing the "icy career woman who discovers her maternal instincts"?

https://www.youtube.com/watch?v=e9JSGQwAqcA

Man, this is a terrible movie. I want to rewatch Jurassic Park now, but I'm a little worried that it contains the same problems. Like, was Spielberg's humanising touch also just having characters declaiming themes and relationships to each other: you're a power-mad scientist! no, you're a ice lady! no, you're fucked up by our parents divorce! Or did he do it better? Am I just spoiled by improvements in story telling technology? I mean, I'm not looking for Winter Sleep here, I'll settle for The Winter Soldier.

Apparently "I have a boyfriend", the best line in the film, was ad-libbed.

I did feel a wash of relief afterwards, when I realised that I had no real idea what the deal with D'Onofrio's character and Wong's character was beyond "set up sequel", but also that I just didn't care, a state I reach too infrequently.

why does the nice lady have to get it hardcore dammmnnn? seems like it was intended for a villain.

Didn't have kids, wasn't good at her job.

mososaur ex machina

See this would work much better if it was unexpected - I was waiting for it since the 'more teeth' line.

This was fun but super, super dumb. No one's arc made any sense. My favorite character was the dude who took time out amidst the dinosaur attack to rescue a pair of frozen margaritas. That rang true to me.

That's actual Jimmy Buffet, I think.

I thought you were fucking with me at first, and then I Googled it, and now I kinda still think you might be fucking with me. Wow.

No one's arc made any sense.

This. Most laughable of all was the scene where the younger kid was suddenly upset about his parents's possible impending divorce, a thread which is immediately dropped by the very next time we see these characters again. Were the filmmakers searching for some tacked-on pathos and resorted to, "what would Spielberg do?" before concluding, "of course! Divorce!"

The movie is practically a masterclass in tacked-on motivation/personality quirks. That same kid was all super-geniusy about science and dinosaurs, but did that ever pay off? Like even once? I guess he did help his brother repair a 20-year-old vehicle offscreen over the course of roughly five minutes.

Arc of the giant watersaurus was pretty consistent.

One of the few! Most of the dinosaur "characters" were inconsistent in their behavior and motivation and were overly-anthropomorphized. They at least tried to establish some ground rules with the raptors. But they might as well have dispensed with that altogether, given how relatively well-behaved an attack dog the t-rex turned out to be.

everything i read about this movie makes it sound worse and worse

In the end, it was ludicrous but enjoyable, and close examination is about as pointless as trying to unpack an episode of Scooby Doo.

That same kid was all super-geniusy about science and dinosaurs, but did that ever pay off?

Better than having a gymnastics kid who kicks a raptor from a high bar.

https://dawnofthedave.files.wordpress.com/2008/08/gymkata.jpg

https://dawnofthedave.files.wordpress.com/2008/08/gymkata.jpg

"looking for human flesh to rip my teeth to"

L L COOL J: CANNIBAL

tried to watch a screener of this last night, was pretty awful.

the watersaurus' dorsal fin collapse was a nice touch

has this been posted yet
https://www.youtube.com/watch?v=qnKVDZH_8ik

this film couldn't have been more ridiculous if it had a certain Wang Chung song playing during the credits

Just saw Jurassic World. It was enjoyable enough but the script was horrible.

"What do we do now?"
"Probably stick together....for survival."

Really lame ending.

Thought it was weird that the kids said they wanted to stick w Chris Pratt over their aunt when they only just met into him a minute ago, where she saved him from a pterodactyl attack right in front of them.

Better than JP3 but not JP2, which had Jeff Goldblum and a T-Rex loose in LA. Still a not bad way to kill a few hours.

My favorite character was the dude who took time out amidst the dinosaur attack to rescue a pair of frozen margaritas.

LOL i caught this too, pretty sure it was an intentional easter egg reference to the place where Nedry meets up w Dodgson in the first movie.

Everyone pretty otm about the lousy writing in this movie. How do we know one kid is a precocious brainiac? Why because he bursts into a scene shouting excitedly the names of chemical compounds found in all life, of course! I hate this fake nerd stuff.

Not that his book smarts comes into play at all for the rest of the movie. In fact his older brother, the one set up at first to be a detached millenial too into his phone and girls to care, is the one with the know how to fix a car.

Also rmde at Claire's sister shocked to the point of tears that she isn't taking off from her job MONITORING KILLER DINOSAURS to babysit her obviously autonomous kids all day.

Jimmy Buffett ... Running Tourist (uncredited)

This is basically just a big-budget Canon movie (simultaneously entertaining and the dumbest thing on earth).

Sorry, 'Cannon'.

Contemporary Hollywood is essentially a big-budget Cannon Films.

Cannon's whole thing was that they were all budget flicks, and the cheapness drove much of the final products. But yeah the tradition of exploitation and action film serialization is still with us.

At least in those movies you didn't have Chuck Norris make some kind of self aware statement about how action movies used to be amazing WINK WINK AUDIENCE YOU R SMART.

I was a Golan-Globus fan myself. Saw "Masters of the Universe" when it came out and was scared to death bc they had someone accurately cosplay Skeletor standing in front of the theater.

The kids in this movie were DOA in terms of story and performance from the moment they showed up, and it got painful to watch them suck up screen-time, particularly since it was obvious that they would face no compelling or suspenseful threats.

Say what you will about Spielberg--at least he's good at getting compelling acting out of young people.

Climactic battle aside, a bore. I'm surprised Bryce Dallas Howard wasn't given an "I just broke a nail!" line.

Yeah I thought this was quite rubbish.

"Look at this workspace!"

"Dinosaurs eat man, woman inherits the Earth."

"Are these characters auto... erotica?"

"Clever girl."

Nedry's squeaky laugh is tops. He sounds like a balloon being let out at times. ADR or live?

ah, henry, henry, henry, why didn't you tell me. i insist. on being here. when they're born.

("oh, god.")

i like nedry's dramatic mouse click.

rewatched this recently and while at this point every single line is burned into my brain i'm finally willing to admit it has some serious third-act problems. once you're past the big T-Rex scenes the movie starts jumping between characters and situations with no sense of geography or time passing, just marching through plot mechanics as all of a sudden the movie becomes about turning the power back on, somewhere "at the other end of the compound." roll out a map for us or something! the kitchen scene is still amazing, and i do love "clever girl" and some the kid bonding stuff, but almost everything else is kinda silly and feels beneath the level of a movie where dinosaurs have come back... limping around to turn the power back on, fretting over the computer system to turn on the doors... that's lazy. grant and ellie stop having good lines, also - just weird stuff no one was willing to tell crichton they were cutting, like the shit about the frog DNA. they halfway cut the bit about why the triceratops gets sick every six weeks seems, meaning it's set up but not paid off - weird.

BUT it's still terrific viewing almost all the way through because spielberg just goes the extra mile. so many shots and setups and lines that get that little extra pinch of love. the dust coming off grant and ellie in their trailer when they're meeting with hammond. the jiggling jello. makes it all the weirder that there are screwups as huge and distracting as the T-Rex habitat changing back and forth from level ground to a four-story cliff. but BOY does he put in the work to make you like these characters at the start so that when they see dinosaurs for the first time, you're right there with them and feeling how amazed they would be. movie magic right there.

no sense of geography or time passing

it's true we never get a sense of where's where on the island but no sense of time passing seems v wrong to me-- look at the striations in this composite cardamon posted upthread of every second of the movie. that's the lovely weekend malcolm thanks hammond for.

grant and ellie stop having good lines, also

ellie gets "sexism in survival situations"; grant gets "after careful consideration i have decided not to endorse your park". and it's not a line but his scene sitting in the tree, tossing the raptor claw away while the kids sleep, is lovely.

almost everything else is kinda silly and feels beneath the level of a movie where dinosaurs have come back

the ooh and ah is for the first half; then comes the running and screaming. the actual monster movie inside the elaborate metaphor for monster movies.

they halfway cut the bit about why the triceratops gets sick every six weeks seems, meaning it's set up but not paid off

this and "the lysine contingency" (ludlum title obv) are like bare scaffolding yeah.

fretting over the computer system to turn on the doors

this is a tech-hubris joke i guess but it's too late and superfluous to land.

the jiggling jello.

i said this upthread somewhere but it is SO AMAZING that the jello is the third and ultimate quivering fluid heralding a monster -- but unlike the others which quiver because the monster is merely really big, the jello at the end of terrified lex's spoon quivers because the monster is really scary. a different kind of impact tremor.

movie magic right there.

thing's a master class.

i guess re that image, it's just that last daylight section yr talking abt. but i still like it. feels hungover.

OTM re: the jello.

regarding the passing of time, I think what I was specifically thinking of was the sequence where arnold leaves to turn the power back on. other key cast members are setting themselves up in a bunker (is this under the building they were in? where was that relative to the visitors' center with the jello and the kitchen? or someplace else?). cut away to grant and the kids doing something. cut back and ellie is proclaiming that arnold's been gone too long and she's going to take action. it just feels sort of detached from real time and reality - how long was he gone exactly? feels like some short cutaways were chopped for running-time reasons - - - them in the bunker, drumming fingers, sweat dripping from malcolm's fevered brow, something. idk, maybe just me.

i also feel like the jump from the climax to the comedown is really sudden - totally awesome badass thing with the T-Rex fighting the raptors, then our heroes scurry out the door and there's a jeep already waiting, the credits are practically coming up... just seems abrupt and low-stakes all of a sudden, but i guess the movie's been in thrill-ride mode for a good stretch at that point so it does have to end. again these are kind of micro-critiques only possible because the craft and detail are so totally on-point elsewhere.

regarding the computers and the doors and so on: my beef is not so much the ebertian one, where it's a shame to bring back dinosaurs and nail the ooh and ahh, just to do a monster movie with them. i accept the monster movie - just seems like if you have fucking dinosaurs, there have to be lots of ways to raise the tension and scare you that do not come down to "oh won't the system boot up faster?" everyone remembers the T-Rex attack and the kitchen scene, and rightly so - in each of these the prospect of being attacked by dinosaurs (one unspeakably overpowering, one unspeakably cunning) is right there front and center.

fretting over the computer system to turn on the doors

I noticed a minor problem with this sequence on last rewatch, which is that Tim is just standing there next to Lex while Ellie is holding the door against the raptor and not able to reach her gun. She should have asked him to get it for her!

this score is only temporary. it all has very dramatic music, of course. boom, boom, boom-- a whole march or something. hasn't been written yet.

https://www.youtube.com/watch?v=QSbQzWj1Bd0

a weird subplot that i never noticed is the total fascination of all the characters to the Mr. DNA sequence.

https://www.youtube.com/watch?v=qUaFYzFFbBU

look how much they love it! if you showed them who framed roger rabbit they'd lose their minds

difficult listening hour
Posted: 7 November 2017 at 04:00:12
this score is only temporary. it all has very dramatic music, of course. boom, boom, boom-- a whole march or something. hasn't been written yet.

https://youtu.be/D-f9bpMpddA

That whole sequence is so smart

Just a really good way to explain the “science” to the audience as if to a child and yeah the adult scientists start off cynical and end up enraptured

https://www.youtube.com/watch?v=D-f9bpMpddA

Tbf, maybe they think Mr. DNA is real, just like the dinosaurs.

he's been with the world

The new one is fucking terrible and deserves Razzie nominations.

The previous one was kinda mediocre but was at least entertaining.

This one was a plot "twist" that in The Room fashion, is forgotten about a minute later.

This one's description scans like Alien Covenant: bad-idea landing on mysterious planet, housebound gothic horror denouement.

hawt

https://www.youtube.com/watch?v=grCRBa0n72c

i'm not sure what's more baffling: getting all the way through shooting that before deciding not to include it, or deciding that it was in some way less essential to the film than the personal assistant death scene, vincent d'onofrio free-associating about a wolf cub, or almost anything else in that trainwreck of a film.

That was very Romancing the Stone. Would have been super awesome if they smeared dino poop on themselves and were immediately attacked.

I liked the new one it was very stupid!

In Jurassic World the CGI dinosaurs were more convincing and less distracting than her nosejob

I just started watching parks and recreation, is that girl’s boyfriend who lives in the hole - is he the main character in this? lololololol

in case you haven't seen it
https://www.youtube.com/watch?v=X4mVIJ5eTBY

Doo keeep uuup

see the first Jurassic World was a trainwreck but it at least had moments that were fun.

this new one is b-movie terribleness which would be cool if the movie didn't think its pathos was deep and real, maaaan.

the plot twist is hilarious. it would be a "deus ex machina" if it had anything to do with the general plot of the movie and wasn't forgotten 2 seconds later.

i won't spoil here tho

I feel like y’all not into roger corman

hmm... plot twist. I'm gonna guess that it turns out that our heroes actually died in the last movie and they're clones of themselves, and this was the real purpose of Jurassic Park and its genetic labs all along

what if the dinosaurs were the friends we made along the way

lol yr not completely far off.....either of you

i love Corman movies. but they are usually small budget and have good music. also it's not like i ever paid $15 to see one new in a movie theater, i catch them on Saturday afternoon tv.

fwiw ill probably see this at a drive in.

I'm mostly disappointed to learn that five movies in and we have still yet to see someone throw a saddle on a dinosaur and ride it like a horse.

There were kids doing that with baby triceratops in the last one

Did they have lassos and hats?

seems like they are setting up Pratt as the dino whisperer. if they don't give him that moment it will be a lost opportunity.

It's going to be like nu Planet of the Apes, he is going to lead the Dinosaur Revolution against his oppressors. And it will be very dark.

As long as it features people riding dinosaurs and assaulting cops in a major setpiece a la the Golden Gate Bridge sequence in Rise of the Planet of the Apes, I'm down.

exclusive production designs for jurassic war leaked

https://cdn.movieweb.com/img.news.tops/NE9PDtCKPv73ci_1_b/Dino-Riders-Movie-Mattel.jpg

knew what that img was gonna be; thumbs up.

ok ok so the twist is... humans were originally cloned FROM dinosaurs. by aliens i guess. cloners, from planet kamino. or at least, chris pratt has dino dna, explaining his bond with the raptors and his clunky, walnut-brained "chemistry" with bryce dino howard.

omg that's it isn't it

cgi attenborugh: "you... were my greatest creation"

This was batshit stupid and I enjoyed it.
Want a Pinky & The Brain film starring Toby Jones and ...?

Stephen Merchant?

tim blake nelson

I want a Chicken Boo movie starring Mr. DNA

At this stage I’d be disappointed if these films weren’t dumb and bad - I was saying after the first Jurassic world that it would be a betrayal if the trilogy didn’t end with genetically engineered dinopeople, talking raptors, the full gremlins 2 basically - so I can’t say this one didn’t meet my minimum requirements, but it’s dumb and bad and boring for too much of its runtime. There were some cool bits once they got to the mansion tho

When they were sailing away from the island I thought to myself “this fuckin film is a ballhair away from showing a single tear rolling down a velociraptor’s cheek” and then half an hour later that ballhair had been well and truly eaten

don’t u dare sully the gleefully inventive gremlins 2 by association with this production-line sludge

a few of my friends told me they were sobbing throughout the film and I'm like, cool that's what this franchise has always needed, huggable dinosaurs

more pathos, baby. more pathos.

also there's another "dinosaurs as super soldiers" moment where you'll think to yourself "isn't it just easier to fire a million bullets at someone"

bg otm Gremlins 2 is some top notch funnel cake

Gremlins 2 r00lz. Hulk Hogan bebeh

Duh I love gremlins 2! I want jw3 to be a version of that (a bad version, because these films are bad)

Lol Neanderthal it’s funny that everyone talks about Spielberg’s schmaltz but he was never as desperate as this, the dumb soap opera of “blue” is so much harder to love than a sick triceratops

also there's another "dinosaurs as super soldiers" moment where you'll think to yourself "isn't it just easier to fire a million bullets at someone"

Hey guys! Tired of cooking? Let a raptor catch and cook your dinner!

okay, here’s my pitch: corporation starts cloning dinosaurs solely to use them as a source of meat for human consumption after a virus causes the world’s pig population to die off, threatening mass starvation

one thing leads to another, dinos get loose, start eating the meat factory workers, yadda yadda

it would be called jurassic pork obv