2015 NBA 'OFFS

Message Bookmarked
Bookmark Removed

http://i.imgur.com/8ezLhqC.jpg

Poll Results

OptionVotes
warriors 11
hawks 4
bucks 2
celtics 2
nets 2
spurs 1
cavs 1
mavericks 1
chicago 1
blazers 0
grizzlies 0
pelicans 0
raptors 0
wizards 0


lag∞n, Thursday, 16 April 2015 04:17 (ten years ago)

round one

warriors (1) vs pelicans (8)
rockets (2) vs mavericks (7)
clippers (3) vs spurs (6)
grizzlies (5) vs blazers (4)

hawks (1) vs nets (8)
cavs (2) vs celtics (7)
chicago (3) vs bucks (6)
raptors (4) vs wizards (5)

Clay, Thursday, 16 April 2015 04:20 (ten years ago)

dubs in 5
rockets in 6
spurs in 6
grizzlies in 5

hawks in 4
cavs in 5
bulls in 5
raptors in 7

Clay, Thursday, 16 April 2015 04:22 (ten years ago)

warriors 4
mavs 6
clippers 7
griz 6

hawks 3
celtics 4
bulls 5
raptors 6

lag∞n, Thursday, 16 April 2015 04:25 (ten years ago)

dubs in 4
rockets in 5
spurs in 6
grizz in 6

hawks in 4
cavs in 5
bulls in 4
wiz in 6

balls, Thursday, 16 April 2015 04:26 (ten years ago)

praying that okc and the pelicans end up tied for 8th seed and that shot is the difference between durant staying in okc and going to DC, this is my dream

― Clay, Friday, February 6, 2015 7:49 PM (2 months ago) Bookmark Flag Post Permalink

the power of prayer btw

Clay, Thursday, 16 April 2015 04:27 (ten years ago)

hallelujah

lag∞n, Thursday, 16 April 2015 04:29 (ten years ago)

that was a sweet shot btw

lag∞n, Thursday, 16 April 2015 04:29 (ten years ago)

Yah clay otm

#wegonnabechampionship (Spottie), Thursday, 16 April 2015 04:34 (ten years ago)

only clay knew how special that shot would end up being

slothroprhymes, Thursday, 16 April 2015 04:35 (ten years ago)

I don't think brow took a single other 3 all year!

slothroprhymes, Thursday, 16 April 2015 04:35 (ten years ago)

i'm picking the warriors to win it all... rolling with their historical regular season dominance

J0rdan S., Thursday, 16 April 2015 04:38 (ten years ago)

in an alternate universe grizz & blazers could be a beautiful PNW series, vancouver vs portland

Clay, Thursday, 16 April 2015 04:38 (ten years ago)

if we're counting the grizz as favorites in that series i don't see a single first round upset in the west, though i could def see the mavs putting something together

same in the east though i don't have an opinion on raptors vs wizards. that feels like a pure 50/50 series. like some people i'm intrigued by what the bucks can do vs the bulls but i don't think they can score enough to actually take that.

J0rdan S., Thursday, 16 April 2015 04:39 (ten years ago)

dubs in 5
mavs in 7
spurs in 6
grizz in 6

hawks in 4
cavs in 5*
bulls in 5
raptors in 5

slothroprhymes, Thursday, 16 April 2015 04:49 (ten years ago)

lookin back on the preseason thread, goon had the warriors winning it all

J0rdan S., Thursday, 16 April 2015 04:49 (ten years ago)

*indicates realistic pick

celtics in 7 = homer pick

slothroprhymes, Thursday, 16 April 2015 04:50 (ten years ago)

i picked wiz purely on hyperbaric pierce and wanting to see john wall in round two, one of my fave players to watch

balls, Thursday, 16 April 2015 04:53 (ten years ago)

warriors in 5
mavs in 6
spurs in 4
grizz in 6

hawks in 5 (could see the nets winning the first and then tanking)
cavs in 6
fulls in 5
raps in 6

Premise ridiculous. Who have two potato? (forksclovetofu), Thursday, 16 April 2015 04:53 (ten years ago)

are the wiz or raptors good at all? what's the deal

J0rdan S., Thursday, 16 April 2015 04:54 (ten years ago)

the deal is they are not good

balls, Thursday, 16 April 2015 04:55 (ten years ago)

like i was trying to work out in my head out to get demarcus traded to wiz to re team w/ wall and i couldn't see how they do it. short of an ahem big free agent signing kinda stuck at 4-5-6 seed cuz they won't end up in the lottery w/ wall and beal.

balls, Thursday, 16 April 2015 05:00 (ten years ago)

wiz/rap is the series i have no fucking clue about tbh

Premise ridiculous. Who have two potato? (forksclovetofu), Thursday, 16 April 2015 05:01 (ten years ago)

totally even

#wegonnabechampionship (Spottie), Thursday, 16 April 2015 05:02 (ten years ago)

wiz/raptors is a series i'm very happy is on the hawks side of the bracket

balls, Thursday, 16 April 2015 05:03 (ten years ago)

raps can score a lot and the wiz don't defend well, honestly the raps don't do much BUT score but the wiz can't score enough to keep pace really I don't think

slothroprhymes, Thursday, 16 April 2015 05:27 (ten years ago)

the wiz seem in a bad funk that could lead to really depressing series -- like sweep or 4-1 -- on their end if a few breaks go in the other direction

J0rdan S., Thursday, 16 April 2015 06:45 (ten years ago)

hope you're back to regular posting for the playoffs, j0rdan

Clay, Thursday, 16 April 2015 06:52 (ten years ago)

Westbrook was far less fulfilled with his newly-minted scoring crown.

“Shit,” Westbrook said when asked what it meant. “It doesn’t mean nothing. Good job. Hooray. I’m at home, watching other teams play. It doesn’t mean nothing.”

Clay, Thursday, 16 April 2015 07:57 (ten years ago)

the purge begins https://twitter.com/wojyahoonba/status/588677161923543041

slothroprhymes, Thursday, 16 April 2015 12:50 (ten years ago)

wiz/raps has felt so depressingly inevitable all year, it's totally the 2015 version of those awful hawks/magic series that would go straight to NBATV

k3vin k., Thursday, 16 April 2015 12:56 (ten years ago)

nets unis in 1st post are so hideous

johnny crunch, Thursday, 16 April 2015 13:00 (ten years ago)

can't believe the mavs ended up with Houston in the seeding it's a tax day miracle.

head clowning instructor (art), Thursday, 16 April 2015 13:04 (ten years ago)

lookin back on the preseason thread, goon had the warriors winning it all

― J0rdan S., Thursday, April 16, 2015 12:49 AM (8 hours ago) Bookmark Flag Post Permalink

B-)

lag∞n, Thursday, 16 April 2015 13:21 (ten years ago)

hey matt how much did melvin hunt cost you last night?

k3vin k., Thursday, 16 April 2015 13:31 (ten years ago)

in an alternate universe, wes matthews is healthy and the blazers have a decent shot at a deep run. as it stands, if the blazers survive the grizz it will be because aldridge turns unstoppable.

Giant Purple Wakerobin (Aimless), Thursday, 16 April 2015 16:22 (ten years ago)

am i allowed to skip the hawks/nets series?

Heez, Thursday, 16 April 2015 16:47 (ten years ago)

no, sry

lag∞n, Thursday, 16 April 2015 16:48 (ten years ago)

dang

Heez, Thursday, 16 April 2015 17:07 (ten years ago)

hox

ciderpress, Thursday, 16 April 2015 17:24 (ten years ago)

warriors in 5
rockets in 6
spurs in 5
grizz in 7

hawks in 5
cavs in 4
bulls in 5
wizards in 7

warriors over spurs
cavs over hawks
warriors over cavs in 5

k3vin k., Thursday, 16 April 2015 18:05 (ten years ago)

dubs over clips
hawks over cavs
dubs over hawks

lag∞n, Thursday, 16 April 2015 18:07 (ten years ago)

you really see the clippers beating the spurs? you could make a lot of money with that opinion

k3vin k., Thursday, 16 April 2015 18:28 (ten years ago)

idk i think they have a better shot than ppl are giving them

lag∞n, Thursday, 16 April 2015 18:28 (ten years ago)

their only chance is to play their starters 40+ minutes a game

k3vin k., Thursday, 16 April 2015 18:29 (ten years ago)

BUCKS OVER BUCKS

Allen (etaeoe), Thursday, 16 April 2015 18:30 (ten years ago)

https://www.youtube.com/watch?v=r5w21_Vphbg

Premise ridiculous. Who have two potato? (forksclovetofu), Thursday, 16 April 2015 18:31 (ten years ago)

their only chance is to play their starters 40+ minutes a game

― k3vin k., Thursday, April 16, 2015 2:29 PM (1 minute ago) Bookmark Flag Post Permalink

ya just assumed thats what theyll do

lag∞n, Thursday, 16 April 2015 18:31 (ten years ago)

HAWKS
CAVALIERS
BULLS
RAPTORS

HAWKS
BULLS

BULLS

WARRIORS
ROCKETS
SPURS
GRIZZLIES

WARRIORS
SPURS

SPURS

SPURS

Allen (etaeoe), Thursday, 16 April 2015 18:33 (ten years ago)

bucks over bulls is the only weird outta nowhere upset I could remotely see happening. I just have no faith in the bulls anymore idk.

Clay, Thursday, 16 April 2015 18:34 (ten years ago)

I watched 100+ games this season and I don’t know shit.

Allen (etaeoe), Thursday, 16 April 2015 18:36 (ten years ago)

their only chance is to play their starters 40+ minutes a game

― k3vin k., Thursday, April 16, 2015 2:29 PM (1 minute ago) Bookmark Flag Post Permalink

ya just assumed thats what theyll do

― lag∞n, Thursday, April 16, 2015 11:31 AM (2 minutes ago) Bookmark Flag Post Permalink

yeah same, rotate in jamal and maybe Hawes and thats it

#wegonnabechampionship (Spottie), Thursday, 16 April 2015 18:39 (ten years ago)

thinking we might see more of jamal to discourage the spurs from switching kawhi/green onto cp3, p interesting matchup, shd be a ton of points scored

lag∞n, Thursday, 16 April 2015 18:54 (ten years ago)

bucks over bulls is the only weird outta nowhere upset I could remotely see happening. I just have no faith in the bulls anymore idk.

― Clay, Thursday, April 16, 2015 11:34 AM (4 minutes ago) Bookmark Flag Post Permalink

bucks have not been great since the trades 11-18 since asb

#wegonnabechampionship (Spottie), Thursday, 16 April 2015 19:10 (ten years ago)

they have a knack for pulling games outta their asses at the end, especially if they can keep things low scoring with their defense

slothroprhymes, Thursday, 16 April 2015 19:26 (ten years ago)

hm yeah guess i haven't been paying attention. prob just want something interesting to happen. xp

Clay, Thursday, 16 April 2015 19:26 (ten years ago)

thats really their only weird upset chance against a healthy bulls though.

also idk why people think the rockets are so much a lock to get out of the first given their current handicaps

slothroprhymes, Thursday, 16 April 2015 19:28 (ten years ago)

yeah bucks struggled down the stretch. bulls out of the east is interesting.

balls, Thursday, 16 April 2015 19:32 (ten years ago)

mavs suck at offensive rebounds and houston is strong at defensive rebounds iirc

balls, Thursday, 16 April 2015 19:33 (ten years ago)

thats true but they're missing two notable defenders and there are ways around dwight (if he's even all the way back? keeps being in and out)

slothroprhymes, Thursday, 16 April 2015 19:39 (ten years ago)

bucks over bulls is the only weird outta nowhere upset I could remotely see happening. I just have no faith in the bulls anymore idk.

― Clay, Thursday, April 16, 2015 11:34 AM (4 minutes ago) Bookmark Flag Post Permalink

bucks have not been great since the trades 11-18 since asb

MCW has been looking less awful lately tho

Matt Armstrong, Thursday, 16 April 2015 19:48 (ten years ago)

Hey guys, remember when Roy Hibbert was good?

Matt Armstrong, Thursday, 16 April 2015 19:49 (ten years ago)

hey matt how much did melvin hunt cost you last night?

Presuming Gallo has the same production, about 10 grand.

Matt Armstrong, Thursday, 16 April 2015 19:50 (ten years ago)

Gallo's first half was strong enough that I just needed something like 10-4-2 (20 fantasy points) for first. Not the worst beat I had this year tho.

Matt Armstrong, Thursday, 16 April 2015 20:00 (ten years ago)

ten grand, jeez

polyphonic, Thursday, 16 April 2015 20:04 (ten years ago)

Hey guys, remember when Roy Hibbert was good?

― Matt Armstrong, Thursday, April 16, 2015 3:49 PM (40 minutes ago) Bookmark Flag Post Permalink

i definitely remember when he was the gobert/sanders of years past, yeah

k3vin k., Thursday, 16 April 2015 20:31 (ten years ago)

haha

#wegonnabechampionship (Spottie), Thursday, 16 April 2015 20:39 (ten years ago)

Sometimes players get worse yeah

Matt Armstrong, Thursday, 16 April 2015 20:42 (ten years ago)

Btw that was a really impressive performance by Gallo, he scored on draymond one on one like it was nbd

Matt Armstrong, Thursday, 16 April 2015 20:42 (ten years ago)

hibberts collapse last year was monumental. he was so shook for so long

#wegonnabechampionship (Spottie), Thursday, 16 April 2015 20:42 (ten years ago)

Hibbert is an odd duck, a total overachiever who is also a headcase is a rare combo

Matt Armstrong, Thursday, 16 April 2015 20:45 (ten years ago)

feel like a lot of what was attributed to hibbert was just great pacers team D

lag∞n, Thursday, 16 April 2015 20:46 (ten years ago)

He should've stuck with Parks & Recs.

A-Hanisi Coates (Leee), Thursday, 16 April 2015 20:47 (ten years ago)

feel like a lot of what was attributed to hibbert was just great pacers team D

Yeah I think that's possibly true. He's VERY slow and they did a great job funneling people to him. But what he did do in that situation was still good.

Hibbert is a D+/C- NBA athlete who somehow figured out a way to be really good for a while.

Matt Armstrong, Thursday, 16 April 2015 20:53 (ten years ago)

i remember for a while he was hitting what seemed like a ton of really weird impossible shots too, then he flipped a switch to not being able to make a simple layup or 3 foot hook

#wegonnabechampionship (Spottie), Thursday, 16 April 2015 20:57 (ten years ago)

He definitely got the yips and we won't know why until Paul George writes an autobio or something

Matt Armstrong, Thursday, 16 April 2015 20:59 (ten years ago)

he's still the master of going straight up on d tho

#wegonnabechampionship (Spottie), Thursday, 16 April 2015 21:00 (ten years ago)

He's still a good defender, with all the new revenue that contract isn't so bad

Matt Armstrong, Thursday, 16 April 2015 21:03 (ten years ago)

hibbert def seemed like a plus player to me even though his offense was weirdly bad given his size

J0rdan S., Thursday, 16 April 2015 21:33 (ten years ago)

i say seemed cuz i won't pretend to have watched more than 5 minutes of the pacers this year

J0rdan S., Thursday, 16 April 2015 21:33 (ten years ago)

haha otm, that 2ot game was the first time I've really watched them this year and we don't have compupost to keep us updated on them anymore

#wegonnabechampionship (Spottie), Thursday, 16 April 2015 21:34 (ten years ago)

we won't know why until Paul George writes an autobio or something

wasn't the rumor that hibbert's wife cheated on him...with PG :/

slothroprhymes, Thursday, 16 April 2015 21:39 (ten years ago)

i mean thats a pretty surefire way to utterly destroy the mental constitution of a teammate, KG practically broke carmelo anthony's brain in half with honeynutgate

slothroprhymes, Thursday, 16 April 2015 21:40 (ten years ago)

i remember hearing that rodman caught vinnie johnson fucking his wife and it turned him into the rodman we know today*

* circa 1996

balls, Thursday, 16 April 2015 21:45 (ten years ago)

http://sports.yahoo.com/news/sources--thunder-to-evaluate-scott-brook-s-future-as-coach-052154505.html

this is my triumph

Clay, Thursday, 16 April 2015 21:45 (ten years ago)

It's pretty crazy how good mirotic was without shooting well, he might be the best player on the Bulls in 2 years.

i remember hearing that rodman caught vinnie johnson fucking his wife and it turned him into the rodman we know today*

* circa 1996

He was contemplating suicide in Detroit and understandably has never really fully elaborated why.

Matt Armstrong, Thursday, 16 April 2015 21:52 (ten years ago)

Letting his freak flag fly was good for us and him and America

Matt Armstrong, Thursday, 16 April 2015 21:52 (ten years ago)

o definitely

balls, Thursday, 16 April 2015 22:24 (ten years ago)

not to mention north korea

k3vin k., Thursday, 16 April 2015 22:45 (ten years ago)

I won't front I loved crazy 90s Dennis Rodman

juice college (agent hibachi), Friday, 17 April 2015 00:19 (ten years ago)

"OKC eliminated" and "Westbrook scoring champ" as back to back notifications within five minutes from the NBA app was p incredible

I'm weirdly already a little sad that we prob won't have Scott brooks to kick around next year, we might have to pile on Monty w if he survives

juice college (agent hibachi), Friday, 17 April 2015 00:22 (ten years ago)

Brooks and his amazing intelligent eyewear will land a job elsewhere, but OKC will still have a wretched front office.

Giant Purple Wakerobin (Aimless), Friday, 17 April 2015 00:26 (ten years ago)

I won't front I loved crazy 90s Dennis Rodman
--juice college (agent hibachi)

we all did man we all did

slothroprhymes, Friday, 17 April 2015 00:28 (ten years ago)

Not me! #youngrepublican

A-Hanisi Coates (Leee), Friday, 17 April 2015 00:31 (ten years ago)

wait was he a republican or are you or were you at that time

slothroprhymes, Friday, 17 April 2015 00:34 (ten years ago)

I stopped being a Spurs fan when they traded Rodman and will not return until the flopping Frenchman is gone

Matt Armstrong, Friday, 17 April 2015 00:36 (ten years ago)

I was (though not really)!

A-Hanisi Coates (Leee), Friday, 17 April 2015 00:38 (ten years ago)

o man speaking of hey man remember the 90s - http://grantland.com/1990s-orlando-magic-oral-history/

balls, Friday, 17 April 2015 02:42 (ten years ago)

I stopped being a Spurs fan when they traded Rodman and will not return until the flopping Frenchman is gone
― Matt Armstrong, Thursday, April 16, 2015 7:36 PM (2 hours ago) Bookmark Flag Post Permalink

no rush

brosario nawson (m bison), Friday, 17 April 2015 02:54 (ten years ago)

you have debased yourself, m bise. Debased yourself with Bruce Bowen, the flopping Francoadulterer. I remain pure.

Matt Armstrong, Friday, 17 April 2015 03:15 (ten years ago)

you wager literal thousands of dollars on professional sporting events

brosario nawson (m bison), Friday, 17 April 2015 04:10 (ten years ago)

nah, 100 a day

Matt Armstrong, Friday, 17 April 2015 05:41 (ten years ago)

hopefully some day tho, go with 10% of the bankroll for now

Matt Armstrong, Friday, 17 April 2015 05:42 (ten years ago)

is this years cavs team weaker than last years heat?

micah, Friday, 17 April 2015 13:20 (ten years ago)

weaker as in "less of a playoffs threat"

micah, Friday, 17 April 2015 13:20 (ten years ago)

ya

lag∞n, Friday, 17 April 2015 13:39 (ten years ago)

uh, no. the cavs do not start mario chalmers, for one.

slothroprhymes, Friday, 17 April 2015 13:48 (ten years ago)

a very comprehensive argument for sure but just one question are u referring to the mario chalmers they won back2back rings with

lag∞n, Friday, 17 April 2015 14:08 (ten years ago)

chalmers was to the heat success as the NASA logo painted on the side of the shuttle was to space travel

head clowning instructor (art), Friday, 17 April 2015 14:12 (ten years ago)

chalmers was to the heat success as the NASA logo painted on the side of the shuttle was to space travel

lag∞n, Friday, 17 April 2015 14:14 (ten years ago)

anyway big picture folks basketball is a team sport

lag∞n, Friday, 17 April 2015 14:15 (ten years ago)

whoever said the argument was comprehensive?

in all seriousness i think the cavs starting five in the past few months is a bit stronger than the heat's last year although if wade's knees had not been about to inevitably collapse at that time, that might not be true, both the heat's bench last year and the cavs bench this year have some issues to say the least

slothroprhymes, Friday, 17 April 2015 14:25 (ten years ago)

there seems to be some time dysmorphia in that analysis

lag∞n, Friday, 17 April 2015 14:29 (ten years ago)

sigh

i spose the cavs starting 5 has the issue of kevin love's misuse/potential yips/back pain to deal with

slothroprhymes, Friday, 17 April 2015 14:30 (ten years ago)

also cavs team this year has much less playoffs exp than last yrs heat and spoelstra was/is a better coach than blatt

head clowning instructor (art), Friday, 17 April 2015 14:33 (ten years ago)

chalmers singlehandedly won the heat a game in the finals vs okc

J0rdan S., Friday, 17 April 2015 14:35 (ten years ago)

the heat last year were a well oiled machine showing signs of running on fumes, the cavs won a bunch of regular season games on talent alone, anyone here think their weaknesses cant be exploited by a well prepared team, think that a team thats not even sure whos in charge its coach or its best player is going to make the right adjustments, that kyrie facing playoff defenses for the first time isnt gonna revert back to a lot of his bad habits

i mean obvs they have a shot at the finals cause the east is so weak theres only one other good teams but they cld easily be a first round out in the west

lag∞n, Friday, 17 April 2015 14:35 (ten years ago)

this cavs team seems pretty equal to last year's heat to me in that i could definitely see them breezing thru the east before getting carved up by the spurs in 5 games

J0rdan S., Friday, 17 April 2015 14:36 (ten years ago)

usual caveats apply but imo if they face the hawks it will prob a good series

lag∞n, Friday, 17 April 2015 14:38 (ten years ago)

"no team without uncle drew is better than any team with uncle drew" - uncle drew

yr uncle drew, Friday, 17 April 2015 14:40 (ten years ago)

shd also be noted the general consensus at this time last year was that the heat were much stronger than they ended up being

lag∞n, Friday, 17 April 2015 14:40 (ten years ago)

i do think all of those things are true to a certain extent about the cavs and i dont think they have the east finals locked up bc they will face the hawks or maybe bulls and those are crazy tough outs.

i also think they were true about the 2013-14 heat minus the coaching issue bc spo was/is great, but then again in those playoffs they faced the bobcats, nets and an imploding pacers team that still took two games from them!

slothroprhymes, Friday, 17 April 2015 14:42 (ten years ago)

except teams coached by Pop. which is why SPURS

yr uncle drew, Friday, 17 April 2015 14:42 (ten years ago)

i don't think there's really any precedent for a team with the cavs' defensive rating winning it all. even since everything clicked for them they've been only slightly above average on defense whereas history indicates you need to be at least pretty close to elite.

J0rdan S., Friday, 17 April 2015 14:42 (ten years ago)

cavs need another year in the oven at a slightly different temperature

Premise ridiculous. Who have two potato? (forksclovetofu), Friday, 17 April 2015 14:43 (ten years ago)

i also think they were true about the 2013-14 heat minus the coaching issue bc spo was/is great, but then again in those playoffs they faced the bobcats, nets and an imploding pacers team that still took two games from them!

― slothroprhymes, Friday, April 17, 2015 10:42 AM (9 seconds ago) Bookmark Flag Post Permalink

its true they didnt face anyone of consequence but they also breezed through the east, that pacers series was abt as lopsided as a 6 game series can be, pacers also had recovered quite a bit by that point fwiw

lag∞n, Friday, 17 April 2015 14:45 (ten years ago)

i don't think there's really any precedent for a team with the cavs' defensive rating winning it all. even since everything clicked for them they've been only slightly above average on defense whereas history indicates you need to be at least pretty close to elite.

― J0rdan S.

this. as much as i want to believe, the game cannot be only about buckets

yr uncle drew, Friday, 17 April 2015 14:45 (ten years ago)

yeah feel like ive heard stats ppl saying being in the top third of the league is the absolute minimum historically, and its not like the cavs are alltime great offensively

lag∞n, Friday, 17 April 2015 14:47 (ten years ago)

curious to see how brons old man game hold up in the offs, cld get ugly if he tries/needs to force it

lag∞n, Friday, 17 April 2015 14:49 (ten years ago)

like anecdotally, once you start thinking about them individually ... kyrie, jr, love are all minus defenders. bron has slipped on that end if even by choice. mozgov is p good but he's not tyson chandler. i just don't see how they're gonna outscore equally prolific offensive teams like golden state or the spurs, assuming cleveland gets there.

J0rdan S., Friday, 17 April 2015 14:50 (ten years ago)

they cld be v subject to hawks slicing and dicing too :)

lag∞n, Friday, 17 April 2015 14:52 (ten years ago)

well of course if they even get to the finals theyre toast

slothroprhymes, Friday, 17 April 2015 14:54 (ten years ago)

o... m... g... lol

lag∞n, Friday, 17 April 2015 14:56 (ten years ago)

what the fuck

call all destroyer, Friday, 17 April 2015 14:57 (ten years ago)

http://www.uni-watch.com/wp-content/uploads/Screen-shot-2015-03-19-at-12.36.06-PM.png

lag∞n, Friday, 17 April 2015 14:57 (ten years ago)

BALLLLMER

lag∞n, Friday, 17 April 2015 14:58 (ten years ago)

the black one looks like something you'd find in a closet at the Y that hasn't been opened in 30 years.

call all destroyer, Friday, 17 April 2015 14:58 (ten years ago)

despite that guy's reporting i find it really hard to believe that they're gonna go with that

because...........

J0rdan S., Friday, 17 April 2015 14:58 (ten years ago)

i hope not!

lag∞n, Friday, 17 April 2015 14:59 (ten years ago)

http://www.uni-watch.com/2015/04/17/uni-watch-exclusive-new-nba-and-wnba-leaks

lag∞n, Friday, 17 April 2015 14:59 (ten years ago)

logo branding copy is secretly some of the lamest shit of all time

"Using the colloquial LA will resonate in a profound way with a younger demographic. Not only does this rule differentiate and elevate the clippers from other Los Angeles sports franchises, it empowers the LAC design element with a verbal communication standard"

gtfoh

J0rdan S., Friday, 17 April 2015 15:02 (ten years ago)

what the actual fuck is that black clips outfit lol

slothroprhymes, Friday, 17 April 2015 15:02 (ten years ago)

you really have to be so so so far up the ass of business to read that sentence and be like "yeah def"

J0rdan S., Friday, 17 April 2015 15:03 (ten years ago)

if i ever pitched a logo to a sports team my caption would be like "this looks cool"

J0rdan S., Friday, 17 April 2015 15:03 (ten years ago)

always interested in empowering design design elements with verbal communication standards, thanks clips for finally catering to my demo

head clowning instructor (art), Friday, 17 April 2015 15:03 (ten years ago)

their whole job is to be up the ass of business which is why the outcomes are so bad the decision makers have no design expertise

lag∞n, Friday, 17 April 2015 15:04 (ten years ago)

like that company is no doubt fully capable of coming up with something good but this is what they arrived at after endless meetings with ppl who work for a company owned by one of the key players in

http://i.imgur.com/NhPb97t.png

lag∞n, Friday, 17 April 2015 15:05 (ten years ago)

the decision makers have no design expertise

― lag∞n, Friday, April 17, 2015 11:04 AM (3 minutes ago) Bookmark Flag Post Permalink

or taste obvs

lag∞n, Friday, 17 April 2015 15:07 (ten years ago)

but the whole process is so removed from taste it prob wldnt matter if they did

lag∞n, Friday, 17 April 2015 15:08 (ten years ago)

I want a Paul Allen/Steve Ballmer series so bad.

Allen (etaeoe), Friday, 17 April 2015 15:10 (ten years ago)

constant cuts to bill gates in the stands checking his phone

lag∞n, Friday, 17 April 2015 15:13 (ten years ago)

http://www.nytimes.com/2015/04/17/sports/basketball/its-nba-playoff-time-pay-no-attention-to-those-losing-records.html
Fun stats: In NBA history, only 11 teams with losing records have made the playoffs. All of them have lost in the first round. All of them have come from the Eastern Conference.

Premise ridiculous. Who have two potato? (forksclovetofu), Friday, 17 April 2015 15:13 (ten years ago)

"since 2000" "In NBA history"

Premise ridiculous. Who have two potato? (forksclovetofu), Friday, 17 April 2015 15:14 (ten years ago)

http://i.imgur.com/oHiMmHm.png

lag∞n, Friday, 17 April 2015 15:24 (ten years ago)

if only there were some verbal communication standard to generate interest

call all destroyer, Friday, 17 April 2015 15:27 (ten years ago)

tru

lag∞n, Friday, 17 April 2015 15:28 (ten years ago)

the NBA's main twitter is making shops of potential champ rings for all the teams, so adorable

slothroprhymes, Friday, 17 April 2015 15:42 (ten years ago)

y not us
https://pbs.twimg.com/media/CCzKkMJUIAAnTgD.jpg

slothroprhymes, Friday, 17 April 2015 15:43 (ten years ago)

Candace Buckner ‏@CandaceDBuckner 30m30 minutes ago
Does new scheme mean Roy Hibbert will be benched, Vogel said: "Possibly."
"Roy's role will be diminished."
There it is again.

crazy

J0rdan S., Friday, 17 April 2015 15:54 (ten years ago)

wow

lag∞n, Friday, 17 April 2015 15:57 (ten years ago)

:/

call all destroyer, Friday, 17 April 2015 15:59 (ten years ago)

they're basically telling him to opt out

J0rdan S., Friday, 17 April 2015 16:00 (ten years ago)

celtics shd pick him and love up :]

lag∞n, Friday, 17 April 2015 16:01 (ten years ago)

I dunno man feel like his depression might not immediately disappear even on a new team but celts def need rim protection

slothroprhymes, Friday, 17 April 2015 16:19 (ten years ago)

buy low man, brad seems p good at putting guys int he right spot basketball and personally wise too

lag∞n, Friday, 17 April 2015 16:21 (ten years ago)

im not sure how low you're gonna be able to buy on roy hibbert

J0rdan S., Friday, 17 April 2015 16:24 (ten years ago)

don't the celtics wanna play faster and spread the court anyway?

J0rdan S., Friday, 17 April 2015 16:24 (ten years ago)

feel like brad n danny r not ideological

lag∞n, Friday, 17 April 2015 16:25 (ten years ago)

logo branding copy is secretly some of the lamest shit of all time

"Using the colloquial LA will resonate in a profound way with a younger demographic. Not only does this rule differentiate and elevate the clippers from other Los Angeles sports franchises, it empowers the LAC design element with a verbal communication standard"

gtfoh

― J0rdan S., Friday, April 17, 2015 8:02 AM (2 hours ago) Bookmark Flag Post Permalink

I live in this world and I do my honest to god best to be as blunt and straight forward as possible in our presentations. Fluff is the worst. Luckily I work for people that would laugh at me if I tried to pull some nonsense like that.

#wegonnabechampionship (Spottie), Friday, 17 April 2015 17:26 (ten years ago)

Sounds like a proactive and synergistic place to work, Spottie.

A-Hanisi Coates (Leee), Friday, 17 April 2015 17:38 (ten years ago)

PS if Lebron had gone to the GSWs, they'd have been even more mortal locks for the finals, but he took the coward's way out instead.

A-Hanisi Coates (Leee), Friday, 17 April 2015 17:39 (ten years ago)

wldve been the best team ever

lag∞n, Friday, 17 April 2015 17:40 (ten years ago)

i wish you guys would use the fashion thread to talk about design stuff -_-

k3vin k., Friday, 17 April 2015 17:42 (ten years ago)

um design is not fashion hello

lag∞n, Friday, 17 April 2015 17:43 (ten years ago)

someone tell me that clippers jersey is not real

it cannot be real

Clay, Friday, 17 April 2015 17:49 (ten years ago)

well its a leak so it cld just be a proposal/work in progress etc

lag∞n, Friday, 17 April 2015 17:50 (ten years ago)

clippers logo was driving me nuts and i finally realized what it's reminding me of
http://sho3box.files.wordpress.com/2013/01/ocp_logo.gif

Premise ridiculous. Who have two potato? (forksclovetofu), Friday, 17 April 2015 17:51 (ten years ago)

i wish you guys would use the fashion thread to talk about design stuff -_-

probably my fave thing about ilh other than the great posters is the digressive nature, and I will endlessly encourage it sorry kev.

Clay, Friday, 17 April 2015 17:51 (ten years ago)

forks, that leads us naturally to this nonsense.

A-Hanisi Coates (Leee), Friday, 17 April 2015 18:01 (ten years ago)

sterling was the smoke beast all along, i see, i see

Premise ridiculous. Who have two potato? (forksclovetofu), Friday, 17 April 2015 18:04 (ten years ago)

my friend found 3.2:1 odds for the cavs title chances. i'm looking at where the lines are now and i don't really love any of them

k3vin k., Friday, 17 April 2015 18:15 (ten years ago)

bovada sez both them and golden state have 11/5 odds

slothroprhymes, Friday, 17 April 2015 18:19 (ten years ago)

I guess now's a good time to mention that back in July when I was hootin' and hollerin' about LeBron coming back, I happened to be in Vegas and I put a huge wager on the Cavs winning the NBA Finals at 25:1. I really hope they don't let me down.

Mr. Snrub, Friday, 17 April 2015 18:20 (ten years ago)

(i dont know shit about gambling thats just the first sports book that came up in google)

slothroprhymes, Friday, 17 April 2015 18:20 (ten years ago)

I guess now's a good time to mention that back in July when I was hootin' and hollerin' about LeBron coming back, I happened to be in Vegas and I put a huge wager on the Cavs winning the NBA Finals at 25:1. I really hope they don't let me down.

― Mr. Snrub, Friday, April 17, 2015 2:20 PM (1 minute ago) Bookmark Flag Post Permalink

this is not a good time! wait til they win lol (def great odds tho in retrospect)

lag∞n, Friday, 17 April 2015 18:22 (ten years ago)

define "huge"

Premise ridiculous. Who have two potato? (forksclovetofu), Friday, 17 April 2015 18:24 (ten years ago)

$500

Mr. Snrub, Friday, 17 April 2015 18:25 (ten years ago)

Nate Silver ‏@NateSilver538 21s21 seconds ago
NBA Championship odds: @Warriors 48%, @Cavs 21%, @Spurs 12%, @LAClippers 8%, @ATLHawks 5%: http://53eig.ht/1GUkSQF

lag∞n, Friday, 17 April 2015 18:27 (ten years ago)

I hate the way a lot of 538 articles contain stats and observations about those stats with no regard for immediate context. Never get a sense that these people are talking about something they've actually watched.

tsrobodo, Friday, 17 April 2015 18:42 (ten years ago)

good luck, snrub

johnny crunch, Friday, 17 April 2015 18:44 (ten years ago)

yeah i mean thats kinda the whole point of their approach xp bring yr own context lol

lag∞n, Friday, 17 April 2015 18:50 (ten years ago)

I would definitely hedge your bet at some point snrub, at least in the finals

Matt Armstrong, Friday, 17 April 2015 19:14 (ten years ago)

xp
Nah there's always context and the stats and observations are largely informed by what they choose to ignore/include.

Using single-season stats as a basis for these predictions when a lot of rosters change drastically half way through doesn't seem sensible to me.

The Nets may have been the worst team to make the playoffs looking at the season as a whole but that fact that they've recently improved with Lopez healthy and finished the season 13-6 isn't reflected in that.

tsrobodo, Friday, 17 April 2015 19:34 (ten years ago)

Biggest news out of NBA owners meeting: Back-to-backs and four games in five days will be reduced; league will extend season by a week.

Clay, Friday, 17 April 2015 19:35 (ten years ago)

holy moley

Jonathan Givony
‏@DraftExpress

New salary cap projections sent out to NBA teams: 2015-16: 67.1 million, tax 81.6, 2016-17: 89 million, tax 108. 2017-18: 108, 127 tax

Matt Armstrong, Friday, 17 April 2015 20:56 (ten years ago)

jeeeeeeesus

Clay, Friday, 17 April 2015 20:56 (ten years ago)

players gonna get paaaaaid

#wegonnabechampionship (Spottie), Friday, 17 April 2015 21:01 (ten years ago)

wow

balls, Friday, 17 April 2015 21:04 (ten years ago)

gonna be real hard to sign a RFA this offseason without getting matched

Matt Armstrong, Friday, 17 April 2015 21:45 (ten years ago)

sry snrub ur team wont make it past round 1

am0n, Friday, 17 April 2015 21:51 (ten years ago)

idk brian windhorst says lebron is 24-3 in the first round over the past six seasons and that could spell bad news for the celtics

balls, Friday, 17 April 2015 22:00 (ten years ago)

boston radio guys were killing windhorst for that

call all destroyer, Friday, 17 April 2015 22:02 (ten years ago)

yea lol i dont think any of the ilh celtics partisans expect anything beyond a win or two & i would personally be elated by that

slothroprhymes, Friday, 17 April 2015 22:02 (ten years ago)

im just really trying not to get high on hope & be disappointed

slothroprhymes, Friday, 17 April 2015 22:03 (ten years ago)

a game 6 in boston would just be tremendous

call all destroyer, Friday, 17 April 2015 23:03 (ten years ago)

game four in boston celtics sweep bron retires at half court hands his headband to kelly o

lag∞n, Friday, 17 April 2015 23:04 (ten years ago)

big if true

Clay, Friday, 17 April 2015 23:12 (ten years ago)

game four in boston celtics sweep bron retires at half court hands his headband to kelly o

http://i.imgur.com/zBvL1IE.jpg

A-Hanisi Coates (Leee), Friday, 17 April 2015 23:16 (ten years ago)

OTOH:

http://i.imgur.com/bMAbxeU.jpg

A-Hanisi Coates (Leee), Friday, 17 April 2015 23:17 (ten years ago)

lmao nice

lag∞n, Friday, 17 April 2015 23:29 (ten years ago)

haha

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 00:00 (ten years ago)

Automatic thread bump. This poll is closing tomorrow.

System, Saturday, 18 April 2015 00:01 (ten years ago)

The Warriors are going to have a dogfight getting out of the west, but if they can get past the WCF, they should be able to knock off the east champion, be it the Hawks, Cavs or Bulls. I picked them to go the whole way, but realistically the Spurs are going to be tough to dethrone and it was hard to pick against them.

Giant Purple Wakerobin (Aimless), Saturday, 18 April 2015 00:19 (ten years ago)

Yo I never did my predix gotta get them down

warriors (1) vs pelicans (8)- gsw sweep
rockets (2) vs mavericks (7)- Houston in 7
clippers (3) vs spurs (6)- Spurs in 6
grizzlies (5) vs blazers (4)- Blazers in 6

hawks (1) vs nets (8)- sweep
cavs (2) vs celtics (7)- cavs in 6
chicago (3) vs bucks (6)- bulls in 7 ps rose gets injured in this one
raptors (4) vs wizards (5)- wizards in 7? I dunno who cares

Warriors over Houston in 5
Spurs over blaZers in 6
Warriors over Spurs in 7

Hawks beat wizards in 5
Cavs beat Bulls in 5
Cavs over Hawks in 7

Finals- warriors in 6 and the wins are blowouts

juice college (agent hibachi), Saturday, 18 April 2015 01:05 (ten years ago)

Honestly I'm really feeling the Spurs to win it but I'm going to stick my call a while back that gsw could do it

And Kerr blazing straight to the chip in his first year would be almost as awesome as pop finally getting a back to back bc we have one more way to kick hand down man down

Also leeee will need to photoshop a sixth finger onto that gif of Kerr with his rings in the snow

juice college (agent hibachi), Saturday, 18 April 2015 01:07 (ten years ago)

what's yr reasoning on picking the blazers? nobody's picking the blazers! they're super beat up and i have a feeling memphis is going to completely shut down lillard.

Clay, Saturday, 18 April 2015 01:10 (ten years ago)

Tony Allen and Mike Conley might not play, though?

brimstead, Saturday, 18 April 2015 01:13 (ten years ago)

I had my postseason fantasy draft last night and wound up with three pelicans. is that good

polyphonic, Saturday, 18 April 2015 01:14 (ten years ago)

last i saw allen and conley are likely for game 1

Clay, Saturday, 18 April 2015 01:15 (ten years ago)

afflalo is questionable and batum & mccollum are likely i believe

Clay, Saturday, 18 April 2015 01:16 (ten years ago)

what's yr reasoning on picking the blazers? nobody's picking the blazers! they're super beat up and i have a feeling memphis is going to completely shut down lillard.

― Clay, Friday, April 17, 2015 9:10 PM (6 minutes ago) Bookmark Flag Post Permalink

Grizz r beat up and I believe in the power of Aldridge and the omen

Also the curse of Jeff green

juice college (agent hibachi), Saturday, 18 April 2015 01:17 (ten years ago)

I dunno I'm just feeling at least one upset in the west, I feel like Portland is gonna snap out of their funk long enough to make it a series at least

juice college (agent hibachi), Saturday, 18 April 2015 01:18 (ten years ago)

Ha is it technically an upset when Portland has the higher seed tho

juice college (agent hibachi), Saturday, 18 April 2015 01:19 (ten years ago)

portland should be the sixth seed and playing the clippers and they need to fix that this summer, it's dumb

Clay, Saturday, 18 April 2015 01:24 (ten years ago)

so i just drove 8 hours north to propose to my girlfriend and today i drove eight hours home but im still gonna get up at 5:30 am to watch the first game of THE 2015 NBA PLAYOFFS

micah, Saturday, 18 April 2015 11:50 (ten years ago)

and by the first game i mean gsw @ nop

micah, Saturday, 18 April 2015 11:51 (ten years ago)

I stole ur format agent hibachi

warriors (1) vs pelicans (8)- gsw sweep
rockets (2) vs mavericks (7)- houston in 5
clippers (3) vs spurs (6)- spurs in 6
grizzlies (5) vs blazers (4)- grizz in 6

hawks (1) vs nets (8)- sweep
cavs (2) vs celtics (7)- sweep
chicago (3) vs bucks (6)- bucks
raptors (4) vs wizards (5)- raps

, Saturday, 18 April 2015 14:59 (ten years ago)

Didn't really wanna make picks just wanted to say that that clippers uni looks like a Tron uniform

, Saturday, 18 April 2015 15:07 (ten years ago)

smush parker citizen of the world http://mongolia.gogo.mn/r/145277

lag∞n, Saturday, 18 April 2015 15:07 (ten years ago)

http://i.imgur.com/Wh9p7OH.jpg

, Saturday, 18 April 2015 15:10 (ten years ago)

Congrats Micah!

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 15:52 (ten years ago)

man this wiz-raps game is prob gonna break viewership records for TSN in Canada while also hitting record lows for ESPN in the US

slothroprhymes, Saturday, 18 April 2015 16:29 (ten years ago)

Congrats Micah!

Heez, Saturday, 18 April 2015 16:31 (ten years ago)

ya bro! grats

lag∞n, Saturday, 18 April 2015 16:36 (ten years ago)

Don't like that block call on gortat at all

Matt Armstrong, Saturday, 18 April 2015 16:51 (ten years ago)

Congrats micah

, Saturday, 18 April 2015 16:57 (ten years ago)

Micah didn't say if she said yes!

Matt Armstrong, Saturday, 18 April 2015 16:58 (ten years ago)

I stole ur format agent hibachi

― 龜, Saturday, April 18, 2015 10:59 AM (2 hours ago) Bookmark Flag Post Permalink

Lol I swiped it from clay i ain't gonna type in a bunch of seeds on ipad

juice college (agent hibachi), Saturday, 18 April 2015 17:31 (ten years ago)

Playoff Pierce

Matt Armstrong, Saturday, 18 April 2015 17:32 (ten years ago)

Congrats Micah...?

juice college (agent hibachi), Saturday, 18 April 2015 17:32 (ten years ago)

Masai got all pottymouth again

juice college (agent hibachi), Saturday, 18 April 2015 17:32 (ten years ago)

James Johnson must be completely uncoachable

Matt Armstrong, Saturday, 18 April 2015 17:38 (ten years ago)

paul pierce stayyyyy killing the atlantic division :] :]

slothroprhymes, Saturday, 18 April 2015 17:41 (ten years ago)

got no pref in this series, it prob goes raptors' way but great to see truth unfreezing

slothroprhymes, Saturday, 18 April 2015 17:42 (ten years ago)

Terrence Ross is one of the most defensively talented awful defenders I've ever seen

Matt Armstrong, Saturday, 18 April 2015 17:44 (ten years ago)

Paul Pierce playoff injury dramatics?

Matt Armstrong, Saturday, 18 April 2015 17:57 (ten years ago)

God I love Pierce

Matt Armstrong, Saturday, 18 April 2015 18:04 (ten years ago)

I like how the fans inside are all v polite and Canadian about their cheering and the mob outside is a bunch of rabid nuts

Clay, Saturday, 18 April 2015 18:38 (ten years ago)

louuuuuuuuuuuuuuuuuu

slothroprhymes, Saturday, 18 April 2015 18:42 (ten years ago)

are the wiz taking a paid dive here or what

Clay, Saturday, 18 April 2015 18:45 (ten years ago)

These wizards "plays"

Matt Armstrong, Saturday, 18 April 2015 18:47 (ten years ago)

how many elbow jumpers off screens can one team run :-----------[

J0rdan S., Saturday, 18 April 2015 18:50 (ten years ago)

john wall is easily the best player on either team but wittman has him throwing it to beal on every play smh

J0rdan S., Saturday, 18 April 2015 18:51 (ten years ago)

Ooh that John wall drive so pretty

juice college (agent hibachi), Saturday, 18 April 2015 18:51 (ten years ago)

john wall is easily the best player on either team but wittman has him throwing it to beal on every play smh

― J0rdan S., Saturday, April 18, 2015 2:51 PM (33 seconds ago) Bookmark Flag Post Permalink

Ya the play calling on both sides of this is really uninspired

Also a year later I still can't believe Drew gooden crunch time minutes is an option for the wiz

juice college (agent hibachi), Saturday, 18 April 2015 18:52 (ten years ago)

gortat 8 inches from the rim and 360 spins to pass to drew gooden ok

J0rdan S., Saturday, 18 April 2015 18:54 (ten years ago)

classic misdirection

head clowning instructor (art), Saturday, 18 April 2015 18:55 (ten years ago)

They are using beal like he's harden or curry and he most definitely is not

Matt Armstrong, Saturday, 18 April 2015 18:56 (ten years ago)

wittman is so fired if they lose this series and they prob will

slothroprhymes, Saturday, 18 April 2015 18:57 (ten years ago)

The coaching on the other side isn't so hot either

Matt Armstrong, Saturday, 18 April 2015 18:57 (ten years ago)

Haha steve javie lookin like the matrix architect in the replay center

juice college (agent hibachi), Saturday, 18 April 2015 18:58 (ten years ago)

Wowww

Matt Armstrong, Saturday, 18 April 2015 18:59 (ten years ago)

he has the scotty problem of not knowing what plays to draw up for a pretty dope starting 5, relies way too much on inefficient jump shots/post ups by nene or gotta and then the bench is what it is (there are way worse tbf) and unlike brooks he is not even inspiring a loyal following in his players afaik

slothroprhymes, Saturday, 18 April 2015 18:59 (ten years ago)

82-82 lmao

J0rdan S., Saturday, 18 April 2015 19:00 (ten years ago)

lol at vasquez shimmy

Clay, Saturday, 18 April 2015 19:00 (ten years ago)

*gortat

vasquez dance needs to go in blolz asap

slothroprhymes, Saturday, 18 April 2015 19:00 (ten years ago)

Grievis always fearless

Matt Armstrong, Saturday, 18 April 2015 19:01 (ten years ago)

it's so dumb because the Wizards have such an obvious end of game set. wall-gortat PNR with beal, pierce and another wing spreading the floor it really is not rocket science

J0rdan S., Saturday, 18 April 2015 19:01 (ten years ago)

wittman is such trash, like I shit on a lot of nba coaches but wittman might be in a class alone

Clay, Saturday, 18 April 2015 19:02 (ten years ago)

The wiz don't really have a great starting 5 tbh

Matt Armstrong, Saturday, 18 April 2015 19:03 (ten years ago)

LONG 2s EVERYBODY ahahahahahahaha

slothroprhymes, Saturday, 18 April 2015 19:03 (ten years ago)

Beal kind of a quiet bust

Matt Armstrong, Saturday, 18 April 2015 19:03 (ten years ago)

can you believe it, john wall with the pull up 14 footer with a hand in his face, who saw that coming

Clay, Saturday, 18 April 2015 19:03 (ten years ago)

if the Wizards had an 8 second shot clock I swear they'd run the exact same offense

Clay, Saturday, 18 April 2015 19:05 (ten years ago)

Beal is younger than Frank Kaminsky

J0rdan S., Saturday, 18 April 2015 19:05 (ten years ago)

yea if you're gonna play dr. save-the-wiz I do not think the diagnosis centers around beal's relatively mild struggles (injury history def concerning though)

slothroprhymes, Saturday, 18 April 2015 19:07 (ten years ago)

Playoff Pierce

Clay, Saturday, 18 April 2015 19:09 (ten years ago)

Excited to watch a real basketball game after this shit

polyphonic, Saturday, 18 April 2015 19:09 (ten years ago)

yeah feel like they should pass it to pierce

J0rdan S., Saturday, 18 April 2015 19:11 (ten years ago)

will either team hit 90 with the OT bumper even

Clay, Saturday, 18 April 2015 19:11 (ten years ago)

if the wizards just get wall moving towards the basket there's nothing the raptors can do to stop it

J0rdan S., Saturday, 18 April 2015 19:12 (ten years ago)

Beal is just so basic offensively and doesn't seem to be getting better.

Matt Armstrong, Saturday, 18 April 2015 19:13 (ten years ago)

man he's been horrifying today

J0rdan S., Saturday, 18 April 2015 19:15 (ten years ago)

given his age i still find it hard to believe he won't be pretty good soon

J0rdan S., Saturday, 18 April 2015 19:16 (ten years ago)

has a coach ever been fired after game 1 of a series because casey my god

Clay, Saturday, 18 April 2015 19:20 (ten years ago)

I'm probably underrating beal because of all the nights this season when I'd play him against the sixers or wolves and he'd put up like 12-2-2

Matt Armstrong, Saturday, 18 April 2015 19:22 (ten years ago)

his development has def stagnated but given his age he doesn't have far to travel to become a real good player

J0rdan S., Saturday, 18 April 2015 19:23 (ten years ago)

i think wittman has been way worse in this game than casey, who's roster is really kinda jacked up. the Wizards have way more talent.

J0rdan S., Saturday, 18 April 2015 19:24 (ten years ago)

It's not like beal is a defcon 1 shitstorm like Mclemore for sure

Matt Armstrong, Saturday, 18 April 2015 19:25 (ten years ago)

oh for sure but scoring 2 in ot and losing after a 16 or so point lead with about 6 to go in the fourth is really unforgivable. though Lowry fouling out is prob what sunk them. xp

Clay, Saturday, 18 April 2015 19:26 (ten years ago)

im not sure a lineup of lou williams, grieves vazquez, demar derozan, patrick patterson and amir johnson should be playing much better than this lol

J0rdan S., Saturday, 18 April 2015 19:27 (ten years ago)

I do question why James Johnson is out of the rotation but he has character issues.

Matt Armstrong, Saturday, 18 April 2015 19:31 (ten years ago)

fucking HELL of course mjax is calling warriors pelis and not the three other ESPN games today lollllllll

slothroprhymes, Saturday, 18 April 2015 19:32 (ten years ago)

Pierce at the 4 is definitely something which they should use James Johnson against imo

Matt Armstrong, Saturday, 18 April 2015 19:37 (ten years ago)

stepphh---_---

Clay, Saturday, 18 April 2015 19:37 (ten years ago)

thanks yall

micah, Saturday, 18 April 2015 19:38 (ten years ago)

the Supreme Court needs to intervene with Mark Jackson working gsw games

Clay, Saturday, 18 April 2015 19:48 (ten years ago)

https://vine.co/v/ezttEPM33jn

lol randy wittman in a nutshell

Clay, Saturday, 18 April 2015 19:57 (ten years ago)

omfg steph

Matt Armstrong, Saturday, 18 April 2015 20:30 (ten years ago)

he's a genius

Clay, Saturday, 18 April 2015 20:31 (ten years ago)

haha they were just soundtracking some of his highlights on the halftime show w shook ones pt 2 by mobb deep & that is so apt

slothroprhymes, Saturday, 18 April 2015 20:40 (ten years ago)

haha they were just soundtracking some of his highlights on the halftime show w shook ones pt 2 by mobb deep & that is so apt

― slothroprhymes, Saturday, April 18, 2015 4:40 PM (28 minutes ago) Bookmark Flag Post Permalink

A week or two ago when the Spurs were going into full maniac mode I remembered the playoffs commercial w/ shook ones and got pumped

juice college (agent hibachi), Saturday, 18 April 2015 21:11 (ten years ago)

Currys mom my lord, gets better every year, unreal

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 21:17 (ten years ago)

sorry

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 21:17 (ten years ago)

interior defense has been atrocious for the pelis. warriors don't even really need the 3 ball this game

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 21:20 (ten years ago)

and they've missed like 6 layups too

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 21:20 (ten years ago)

yea they were not prepared, everyone but brow is just standing around awkwardly on D

slothroprhymes, Saturday, 18 April 2015 21:24 (ten years ago)

asik looks drugged

slothroprhymes, Saturday, 18 April 2015 21:24 (ten years ago)

van gundy loves norris cole so much its so weird

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 21:29 (ten years ago)

competitive grit!!!

aw man brow missed dunks bum me out

slothroprhymes, Saturday, 18 April 2015 21:30 (ten years ago)

warriors defense kicked into gear as soon as game got within 11, pelis look much more helpless now

head clowning instructor (art), Saturday, 18 April 2015 21:33 (ten years ago)

Welp splash brothers put the kibosh on that I guess

juice college (agent hibachi), Saturday, 18 April 2015 21:34 (ten years ago)

wish abc/ESPN would cio with the "get lucky" intro outro music, summer of 2013 was a long ago horror show

Clay, Saturday, 18 April 2015 21:34 (ten years ago)

that song will never die, it hits too many #demographics

slothroprhymes, Saturday, 18 April 2015 21:39 (ten years ago)

jvg is peak challopping everything everyone says rn, it rules

Clay, Saturday, 18 April 2015 21:43 (ten years ago)

wow that brow rebound

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 21:50 (ten years ago)

this is way closer than I thought the first game would be especially given the 27 pt lead in Q3

slothroprhymes, Saturday, 18 April 2015 21:51 (ten years ago)

shiiiiit brow that oop

head clowning instructor (art), Saturday, 18 April 2015 21:51 (ten years ago)

hack a iggy

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 21:52 (ten years ago)

feel like we're gonna experience record breaking usage of hack-a-deandre/iguodala/dwight/any rockets player tbh this playoffs

slothroprhymes, Saturday, 18 April 2015 21:52 (ten years ago)

warriors starting slouching and the bench played v poorly

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 21:52 (ten years ago)

like as awesome as spurs-clips will be in most ways pop will go so hard on hack-a-jordan if the games get close & the games will be 3+ hrs

slothroprhymes, Saturday, 18 April 2015 21:53 (ten years ago)

hack a dj gonna get ugly in that series for sure

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 21:55 (ten years ago)

also why does the ESPN graphic for the dubs also feature birds chirping like the pelicans are the bird team iirc

slothroprhymes, Saturday, 18 April 2015 21:55 (ten years ago)

i hope the mavs foul dwight every time he touches hte ball in the fourth tonight

head clowning instructor (art), Saturday, 18 April 2015 21:56 (ten years ago)

well, that I'm fine with bc fuck dwight.

slothroprhymes, Saturday, 18 April 2015 21:58 (ten years ago)

what can the league even do about hack a, where are the thinkpieces

Clay, Saturday, 18 April 2015 21:59 (ten years ago)

alt option do as mjax suggested and run a ft clinic for your big men

head clowning instructor (art), Saturday, 18 April 2015 22:00 (ten years ago)

brow went to work in the 4th

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 22:00 (ten years ago)

man warriors bricking fts all day, madness

head clowning instructor (art), Saturday, 18 April 2015 22:02 (ten years ago)

weird game

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 22:05 (ten years ago)

ugh these reviews

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 22:07 (ten years ago)

I'm prob more excited for bulls-bucks than I objectively should be but idk feel like playoff giannis is like a glimpse of a fascinating future. also d-rose

slothroprhymes, Saturday, 18 April 2015 22:23 (ten years ago)

I'm also still not over the idea that MCW is on a playoff team but hey in terms of undeserving playoffs players better him than waiters

slothroprhymes, Saturday, 18 April 2015 22:24 (ten years ago)

bucks and bulls is the only eastern series I'm interested in, tho will dutifully watch some cavs and c's as is my rightful ilh duty

Clay, Saturday, 18 April 2015 22:37 (ten years ago)

Didn't realize the game was today.

A-Hanisi Coates (Leee), Saturday, 18 April 2015 22:37 (ten years ago)

don't think i watched one celtics game this year

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 22:38 (ten years ago)

LEEEE

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 22:38 (ten years ago)

I also missed the Acid Mothers Temple show last night.

A-Hanisi Coates (Leee), Saturday, 18 April 2015 22:41 (ten years ago)

Eric Gordon shot 41% from the field and 45% on threes this year. 38% on twos.

Matt Armstrong, Saturday, 18 April 2015 22:52 (ten years ago)

don't think i watched one celtics game this year
--#wegonnabechampionship (Spottie)

they only had 3 or 4 nationally televised games and that's if I'm being charitable and counting NBA TV is national, can't blame you for not actively seeking them out especially pre-isaiah

slothroprhymes, Saturday, 18 April 2015 22:53 (ten years ago)

i hate gordon's shot form but can't argue with the results

#wegonnabechampionship (Spottie), Saturday, 18 April 2015 22:53 (ten years ago)

*as national

slothroprhymes, Saturday, 18 April 2015 22:55 (ten years ago)

I guess Gordon never got the hops back

Matt Armstrong, Saturday, 18 April 2015 22:56 (ten years ago)

I remember Bill Simmons saying Eric Gordon had the most beautiful shooting stroke in the NBA and realizing that he's a weird idiot

Matt Armstrong, Saturday, 18 April 2015 22:57 (ten years ago)

was that when gordon was a clipper? early this season on one of his hoops podcasts he was bemoaning gordon's decline

slothroprhymes, Saturday, 18 April 2015 23:05 (ten years ago)

yeah it was pure clippers homerism

Matt Armstrong, Saturday, 18 April 2015 23:07 (ten years ago)

Gordon really hasn't declined that much, he was always wildly overrated. Getting CP3 for that guy, smh

Matt Armstrong, Saturday, 18 April 2015 23:08 (ten years ago)

Hey MCW, let him shoot it

Matt Armstrong, Saturday, 18 April 2015 23:15 (ten years ago)

Automatic thread bump. This poll's results are now in.

System, Sunday, 19 April 2015 00:01 (ten years ago)

who voted nets

micah, Sunday, 19 April 2015 00:05 (ten years ago)

mason plumlee is prob an ilh lurker or something

head clowning instructor (art), Sunday, 19 April 2015 00:54 (ten years ago)

Mayo/Bayless might be one of my least favorite backcourt combos any playoff team can throw out, and I still think Bayless is a reasonably good rotation guy

juice college (agent hibachi), Sunday, 19 April 2015 01:08 (ten years ago)

If any net is an ilxor it's brook

Matt Armstrong, Sunday, 19 April 2015 01:16 (ten years ago)

ew that intro is no good cmon nba

like jayz is part owner of a playoff team.. you can do better

head clowning instructor (art), Sunday, 19 April 2015 01:40 (ten years ago)

If any net is an ilxor it's brook

― Matt Armstrong, Saturday, April 18, 2015 6:16 PM (25 minutes ago) Bookmark Flag Post Permalink

lopez? i get the sense that the lopez bros are pretty much bacon/zombie/comic-con types

like there is no way in the world robin lopez doesn't get distracted by notifications from the chive app on his phone

Clay, Sunday, 19 April 2015 01:44 (ten years ago)

woof dallas looking not so great early game

tho rondo did force harden to foul in the first 20s of th game so that's a good omen i think

head clowning instructor (art), Sunday, 19 April 2015 01:47 (ten years ago)

- "clay did you just spend some time fruitlessly googling 'robin lopez' 'cards against humanity'?"

- "don't ask me stuff like that."

Clay, Sunday, 19 April 2015 01:49 (ten years ago)

playoff dwight

Clay, Sunday, 19 April 2015 01:51 (ten years ago)

4 blocks in 5 mins

head clowning instructor (art), Sunday, 19 April 2015 01:53 (ten years ago)

remember troy daniels

J0rdan S., Sunday, 19 April 2015 02:01 (ten years ago)

aaaarrrrggghhhh

slothroprhymes, Sunday, 19 April 2015 02:16 (ten years ago)

plz flip the switch rondo

slothroprhymes, Sunday, 19 April 2015 02:16 (ten years ago)

(plz put him back in rick just give him a chance :[ )

slothroprhymes, Sunday, 19 April 2015 02:17 (ten years ago)

omg harris what was that pass

head clowning instructor (art), Sunday, 19 April 2015 02:17 (ten years ago)

You are: Josh Smith
You have: The ball
You defender is: Smothering you

Do you (A) shoot or (B) shoot

Clay, Sunday, 19 April 2015 02:23 (ten years ago)

hes really a victim of circumstance

head clowning instructor (art), Sunday, 19 April 2015 02:26 (ten years ago)

he wouldnt shoot so much under pressure if there were any other option

head clowning instructor (art), Sunday, 19 April 2015 02:26 (ten years ago)

joey crawford is having himself some fun tonight

Clay, Sunday, 19 April 2015 02:28 (ten years ago)

oh fuck parsons going back to the locker room

head clowning instructor (art), Sunday, 19 April 2015 02:34 (ten years ago)

rip dallas

head clowning instructor (art), Sunday, 19 April 2015 02:34 (ten years ago)

:[

slothroprhymes, Sunday, 19 April 2015 02:36 (ten years ago)

dallas has eaten since dwight went to the bench

k3vin k., Sunday, 19 April 2015 02:37 (ten years ago)

rondo is starting to realize that there are cameras on him and those cameras are national TV and it is the playoffs tho

slothroprhymes, Sunday, 19 April 2015 02:38 (ten years ago)

he's had a good quarter let's see if it's sustainable this time

head clowning instructor (art), Sunday, 19 April 2015 02:41 (ten years ago)

that's a pretty dang weak flagrant imo

Clay, Sunday, 19 April 2015 02:43 (ten years ago)

ilu jr dont ever change

head clowning instructor (art), Sunday, 19 April 2015 02:44 (ten years ago)

woops josh smith*

head clowning instructor (art), Sunday, 19 April 2015 02:44 (ten years ago)

posting under the influence.

head clowning instructor (art), Sunday, 19 April 2015 02:45 (ten years ago)

checking in w the nba for the first time today whats good

lag∞n, Sunday, 19 April 2015 02:48 (ten years ago)

things that suck about living in boston: at the bar with friend watching the games & the TV closest to us gets changed to some garbage hockey game no one is actually watching just bc bars here assume everyone loves shitass hockey

slothroprhymes, Sunday, 19 April 2015 02:49 (ten years ago)

tbf they are often right but like the trash 2015 bruins are uh not in the playoffs

slothroprhymes, Sunday, 19 April 2015 02:49 (ten years ago)

steph curry was good today, randy wittman is going to get fired in the middle of this series despite winning today, i liked brow's hair a lot, dwight looked pretty good for five minutes, dallas might have a shot at this series after all xps

Clay, Sunday, 19 April 2015 02:51 (ten years ago)

doug collins' outfit :/

k3vin k., Sunday, 19 April 2015 02:53 (ten years ago)

check this mavs game goon

head clowning instructor (art), Sunday, 19 April 2015 02:55 (ten years ago)

im watching now just got home

lag∞n, Sunday, 19 April 2015 02:56 (ten years ago)

did not see todays brow hair but generally the fade fro thats popular in the nba but nor irl (ne region) idk it looks like a mushroom

lag∞n, Sunday, 19 April 2015 02:58 (ten years ago)

nor=not

lag∞n, Sunday, 19 April 2015 02:59 (ten years ago)

rondo on harden tho possibility problematic for houst?

lag∞n, Sunday, 19 April 2015 03:00 (ten years ago)

it is really weird to me that the playoffs are cobranded with ... Pitch Perfect 2

Clay, Sunday, 19 April 2015 03:05 (ten years ago)

rockets need to stop switching smalls onto dirk

k3vin k., Sunday, 19 April 2015 03:06 (ten years ago)

dwights the key

lag∞n, Sunday, 19 April 2015 03:07 (ten years ago)

dirrrkkkkkkk

head clowning instructor (art), Sunday, 19 April 2015 03:10 (ten years ago)

he's still holding a grudge for harden pulling a foul off him on a transition fb from the 2nd quarter

head clowning instructor (art), Sunday, 19 April 2015 03:11 (ten years ago)

omg rondo is missing every floater just barely

lag∞n, Sunday, 19 April 2015 03:19 (ten years ago)

dallas just shooting bad

lag∞n, Sunday, 19 April 2015 03:20 (ten years ago)

rondo's first half was so great. dallas making lots of mistakes

head clowning instructor (art), Sunday, 19 April 2015 03:21 (ten years ago)

ellis can't hit anything tonight

head clowning instructor (art), Sunday, 19 April 2015 03:21 (ten years ago)

lol amare break them down

lag∞n, Sunday, 19 April 2015 03:22 (ten years ago)

dallas just pulled the quarter out of their ass in the last min

lag∞n, Sunday, 19 April 2015 03:32 (ten years ago)

mavs have had so many shots just like rim out in addition to the legit misses/airballs

slothroprhymes, Sunday, 19 April 2015 03:32 (ten years ago)

p ugly game at times for sure

head clowning instructor (art), Sunday, 19 April 2015 03:33 (ten years ago)

lmao dwight post airball

lag∞n, Sunday, 19 April 2015 03:41 (ten years ago)

dwight is #bad

slothroprhymes, Sunday, 19 April 2015 03:45 (ten years ago)

(speaking relatively of course like in terms of who he used to be but still)

slothroprhymes, Sunday, 19 April 2015 03:46 (ten years ago)

man the rockets have hit like 3 bullshit 3s this quarter

k3vin k., Sunday, 19 April 2015 03:49 (ten years ago)

he has zero offense that isn't the dunk

head clowning instructor (art), Sunday, 19 April 2015 03:49 (ten years ago)

ya everything going their way/not mavs way xp

lag∞n, Sunday, 19 April 2015 03:52 (ten years ago)

hahaha ok hacka-off!!!

k3vin k., Sunday, 19 April 2015 03:56 (ten years ago)

gonna have to find a way to end the hacka this offseason

lag∞n, Sunday, 19 April 2015 03:56 (ten years ago)

IT BEGINS

head clowning instructor (art), Sunday, 19 April 2015 03:57 (ten years ago)

useless stat alert: rose is one of only 5 players to average 25 points and 5 assists in game 1s

k3vin k., Sunday, 19 April 2015 04:25 (ten years ago)

guess on the others would be jordan, lebron, lebron....? wade?

k3vin k., Sunday, 19 April 2015 04:26 (ten years ago)

one of those lebrons is bird

k3vin k., Sunday, 19 April 2015 04:27 (ten years ago)

kinda boring games today :/

Clay, Sunday, 19 April 2015 04:45 (ten years ago)

well yea it's all prep for the real grand opening of celtics cavs

slothroprhymes, Sunday, 19 April 2015 05:18 (ten years ago)

:D we're prob gonna die in game 1 but w/e I don't care

my folks who legit only have network TV are really psyched that they can watch the new yung celtics

slothroprhymes, Sunday, 19 April 2015 05:41 (ten years ago)

u should teach them to tream

Clay, Sunday, 19 April 2015 05:50 (ten years ago)

jalen rose does not say many intelligent things but he recently pointed out something that reinforces my mavs in 7 pick: the 2nd highest usage rate on the rockets currently belongs to...josh smith

slothroprhymes, Sunday, 19 April 2015 15:37 (ten years ago)

lol he's tied with shved technically but shved playing in 9 games is obv not statistically significant. howard and brewer rank just behind smoove

slothroprhymes, Sunday, 19 April 2015 15:39 (ten years ago)

i've watched the rockets a lot this year and i still can't really figure out how they do it

k3vin k., Sunday, 19 April 2015 18:04 (ten years ago)

You are: Josh Smith
You have: The ball
You defender is: Smothering you

Do you (A) shoot or (B) shoot

― Clay, Saturday, April 18, 2015 10:23 PM (Yesterday) Bookmark Flag Post Permalink

This killed me it's like josh smith is trapped in a broken version of king's quest

(Types in "pass the rock")
You can't do that here.
(Smashes keyboard in frustration, takes long two)

juice college (agent hibachi), Sunday, 19 April 2015 18:05 (ten years ago)

I don't be stalling I be installing
Baby baby baby baby baby baby baby
This is awesome this is awesome

Matt Armstrong, Sunday, 19 April 2015 18:31 (ten years ago)

here we goooooo

damnit tho why does mjax have to be calling my team's game :[

slothroprhymes, Sunday, 19 April 2015 19:02 (ten years ago)

Mjax >>>> reggie

#wegonnabechampionship (Spottie), Sunday, 19 April 2015 19:04 (ten years ago)

zeller offensive game v nice rn

slothroprhymes, Sunday, 19 April 2015 19:12 (ten years ago)

lol we already in a JR chuckathon as the main cavs offensive weapon

slothroprhymes, Sunday, 19 April 2015 19:13 (ten years ago)

I'm absolutely terrified of this Celtics team, tbh.

Mr. Snrub, Sunday, 19 April 2015 19:20 (ten years ago)

*Looks with interest at lebtons back pad*

, Sunday, 19 April 2015 19:23 (ten years ago)

Lol jelly o and Tristan both just scoring on each other

juice college (agent hibachi), Sunday, 19 April 2015 19:24 (ten years ago)

battle of the defensive turnstile scoring big men!

slothroprhymes, Sunday, 19 April 2015 19:28 (ten years ago)

Brons hairline looks like a bad photoshop

, Sunday, 19 April 2015 19:37 (ten years ago)

dunno how i just noticed this but matthew delavadova is the most k3vin k3ller lookin player in the nba

J0rdan S., Sunday, 19 April 2015 19:52 (ten years ago)

evan turner is as bad as austin rivers i think

J0rdan S., Sunday, 19 April 2015 20:05 (ten years ago)

Wow a team is actually going for the 2 for 1 *k3v k is able to die at peace with the world and with no regrets*

, Sunday, 19 April 2015 20:06 (ten years ago)

xp he's playing weak in this game but, uh, no.

slothroprhymes, Sunday, 19 April 2015 20:08 (ten years ago)

although if you'd said in this game I would not rly contest the point tho, his turnovers are so ugh

slothroprhymes, Sunday, 19 April 2015 20:09 (ten years ago)

I've identified the mjax verbal tic that drives me craziest: he asserts something then says "the reason why is because..."

Just say "I like that shot because..."

I know speaking extemporaneously on tv is insanely hard but this one stabs me right in the heart

juice college (agent hibachi), Sunday, 19 April 2015 20:09 (ten years ago)

Assertive turner died in game 82' he's looked really shook

juice college (agent hibachi), Sunday, 19 April 2015 20:10 (ten years ago)

lol o man if love and JR fouling out or close to it tips this game...

slothroprhymes, Sunday, 19 April 2015 20:29 (ten years ago)

was there ever anything written somewhere abt why bron ditched the headband? i'm still finding it hard to look at him without it.

Clay, Sunday, 19 April 2015 20:44 (ten years ago)

lebron getting stoned at the rim by tyler zeller this can't be life

J0rdan S., Sunday, 19 April 2015 20:50 (ten years ago)

mark jackson awkwardly attempting to spin a sue bird comparison from insult to compliment is some classic mjax

Clay, Sunday, 19 April 2015 20:51 (ten years ago)

lol celtics scoring 14 points in a row v the cavs bench, blatt sitting on his hands

lag∞n, Sunday, 19 April 2015 20:54 (ten years ago)

evan turner is -20 today

J0rdan S., Sunday, 19 April 2015 20:56 (ten years ago)

why is bron even in this game, this team is going to play about 25 playoff games & you're up ~ 20 in the fourth q of rd 1 game 1, pull your guys

Clay, Sunday, 19 April 2015 21:01 (ten years ago)

evan turner has been hysterically bad today

J0rdan S., Sunday, 19 April 2015 21:03 (ten years ago)

bron looks bad today

J0rdan S., Sunday, 19 April 2015 21:03 (ten years ago)

kyrie decidedly does not look bad today

slothroprhymes, Sunday, 19 April 2015 21:10 (ten years ago)

oh good some hack-a, love this stuff

Clay, Sunday, 19 April 2015 21:12 (ten years ago)

yaaaaaaay free throwz

slothroprhymes, Sunday, 19 April 2015 21:15 (ten years ago)

hack-a is kinda suspenseful imo

J0rdan S., Sunday, 19 April 2015 21:17 (ten years ago)

kevin love should prob not let jared sullinger truck him in a 13 point game

J0rdan S., Sunday, 19 April 2015 21:18 (ten years ago)

hack-a isn't the absolute worst it's just if it starts happening in every remotely close playoff game this spring nobody is going to be cool w/ it

Clay, Sunday, 19 April 2015 21:19 (ten years ago)

brother brad, pop and carlisle will all use it unabashedly for sure

slothroprhymes, Sunday, 19 April 2015 21:21 (ten years ago)

stotts, budd, kerr also likely

Clay, Sunday, 19 April 2015 21:24 (ten years ago)

I support it.

Jeff, Sunday, 19 April 2015 21:24 (ten years ago)

kevin love should prob not let jared sullinger truck him in a 13 point game

Sully trucks people bigger and better on defense than love

Matt Armstrong, Sunday, 19 April 2015 21:36 (ten years ago)

I gotta admit the non-Thabo numbers for the Hawks are pretty bad but I still believe in Bazemore for now

Matt Armstrong, Sunday, 19 April 2015 21:37 (ten years ago)

lebron getting stoned at the rim by tyler zeller this can't be life

One of the top rim protectors in the league, believe it or not

Matt Armstrong, Sunday, 19 April 2015 21:37 (ten years ago)

cavs defense/bench is bad

lag∞n, Sunday, 19 April 2015 21:43 (ten years ago)

xp shhhh don't tell anybody it gets in the way of the celtics backed into the playoffs narrative

slothroprhymes, Sunday, 19 April 2015 21:43 (ten years ago)

Isaiah Thomas had a very selfish double double

Matt Armstrong, Sunday, 19 April 2015 21:43 (ten years ago)

well he is a selfish player

lag∞n, Sunday, 19 April 2015 21:44 (ten years ago)

Demarre Carroll gonna get paid

Matt Armstrong, Sunday, 19 April 2015 21:45 (ten years ago)

hawks be hawkin

slothroprhymes, Sunday, 19 April 2015 21:45 (ten years ago)

I think the nets will win a game

Matt Armstrong, Sunday, 19 April 2015 21:46 (ten years ago)

lol I swear if you're saying that bc you're betting a grand on idk bojan bogdanovic's line (if you're betting I'm assuming it's on a euroballer)

slothroprhymes, Sunday, 19 April 2015 21:50 (ten years ago)

hawks have been wildly inconsistent since the asb and the nets have been pretty solid since, i could see them taking one or two. nets also much more experienced.

Clay, Sunday, 19 April 2015 21:53 (ten years ago)

lol @ these hawks fans booing joe johnson as if any of them attended a single game joe johnson played during his tenure

Clay, Sunday, 19 April 2015 21:54 (ten years ago)

I am going to stack this series because I think that a lot of guys are underpriced and there will be at least one close game. Only on 4 game slates tho.

Bogdanovic is more of a feel thing with hollins. Also like brown.

Matt Armstrong, Sunday, 19 April 2015 21:54 (ten years ago)

I actually stacked Hawks-Nets a couple weeks ago and if Joe had just hit that game tying three...

Matt Armstrong, Sunday, 19 April 2015 21:56 (ten years ago)

mostly watching this game to hear sir foster

slothroprhymes, Sunday, 19 April 2015 22:01 (ten years ago)

Antic being a useful NBA player is fascinating

Matt Armstrong, Sunday, 19 April 2015 22:02 (ten years ago)

deron looks like he gettin fat, brook lopez is making super dumb fouls, man this team is bad

slothroprhymes, Sunday, 19 April 2015 22:03 (ten years ago)

Apparently the only thing Antic is "good" at is setting screens but it's so good and important that he's a + player for them

Matt Armstrong, Sunday, 19 April 2015 22:03 (ten years ago)

Deron has been fat since middle school

Matt Armstrong, Sunday, 19 April 2015 22:03 (ten years ago)

Not the most accurate Bropez scouting report from cwebb

Matt Armstrong, Sunday, 19 April 2015 22:06 (ten years ago)

SCHROEDER

slothroprhymes, Sunday, 19 April 2015 22:07 (ten years ago)

o man hollins sounds so depressed

slothroprhymes, Sunday, 19 April 2015 22:11 (ten years ago)

okay i am so taking a nap instead of watching this

Clay, Sunday, 19 April 2015 22:12 (ten years ago)

Sully trucks people bigger and better on defense than love

― Matt Armstrong, Sunday, April 19, 2015 5:36 PM (37 minutes ago) Bookmark

yeah but those people don't have bad backs

J0rdan S., Sunday, 19 April 2015 22:14 (ten years ago)

NBA athlete ads built around guys recovering from injury can't be worth it beyond building a relationship with them right? Like who gets hyped up about Gatorade because Jabari is drinking it in between leg presses and stretching exercises?

Matt Armstrong, Sunday, 19 April 2015 22:17 (ten years ago)

Sully trucks people bigger and better on defense than love

― Matt Armstrong, Sunday, April 19, 2015 5:36 PM (37 minutes ago) Bookmark

yeah but those people don't have bad backs

Oh I see what you meant

Matt Armstrong, Sunday, 19 April 2015 22:17 (ten years ago)

Reminder that the nets sold the pick that became Kyle Korver to pay for a Xerox

Matt Armstrong, Sunday, 19 April 2015 22:19 (ten years ago)

Cwebb thinks kirilenko was on the mavs, what the hell man

Matt Armstrong, Sunday, 19 April 2015 22:23 (ten years ago)

kirilenko can be on the mavs if he wants cmon

lag∞n, Sunday, 19 April 2015 22:37 (ten years ago)

The defining moment of the Warriors-Mavs upset is baron Davis dunking on kirilenko

Matt Armstrong, Sunday, 19 April 2015 23:00 (ten years ago)

That imaginary mavs team sounds fucking sick

Matt Armstrong, Sunday, 19 April 2015 23:01 (ten years ago)

Hawks soft as baby shit inside

Matt Armstrong, Sunday, 19 April 2015 23:02 (ten years ago)

I wonder if millsap maybe shouldn't be playing

Matt Armstrong, Sunday, 19 April 2015 23:06 (ten years ago)

matt did you delete your twitter?

k3vin k., Sunday, 19 April 2015 23:17 (ten years ago)

Wait, Schroeder shot 43% from 3?

Matt Armstrong, Sunday, 19 April 2015 23:18 (ten years ago)

matt did you delete your twitter?

Deactivated yeah, will be back someday

Matt Armstrong, Sunday, 19 April 2015 23:18 (ten years ago)

Was going through some personal stuff and wanted to retreat to ilx for a while

Matt Armstrong, Sunday, 19 April 2015 23:19 (ten years ago)

Bogdanovic killing the nets ouch

Matt Armstrong, Sunday, 19 April 2015 23:23 (ten years ago)

aw hope you're doing ok man

k3vin k., Sunday, 19 April 2015 23:23 (ten years ago)

Yeah things are looking up for sure thanks.

Matt Armstrong, Sunday, 19 April 2015 23:27 (ten years ago)

Bogdanovic killing the nets ouch
--Matt Armstrong

can't kill what's already dead

slothroprhymes, Sunday, 19 April 2015 23:29 (ten years ago)

matt does bovada have series odds? all i can find are game odds

k3vin k., Sunday, 19 April 2015 23:30 (ten years ago)

found it, bottom of the page

k3vin k., Sunday, 19 April 2015 23:32 (ten years ago)

brooklyn misses back2back wide open corner threes down 6

lag∞n, Sunday, 19 April 2015 23:57 (ten years ago)

and then hit a contested one

lag∞n, Sunday, 19 April 2015 23:58 (ten years ago)

some interesting player prop bets there - "will nicolas batum record a triple double?"

slothroprhymes, Sunday, 19 April 2015 23:59 (ten years ago)

dont bet on sports u guys the house is batter than u (daily fantasy seems okay since ur playing against other ppl not professionals with professional resources)

lag∞n, Monday, 20 April 2015 00:00 (ten years ago)

Deron is so decrepit at this point, they're better off letting joe handle and he keeps getting torched by teague

juice college (agent hibachi), Monday, 20 April 2015 00:00 (ten years ago)

xp I aint bettin on nothing can't afford that but it is intriguing to examine, have def considered maybe doing the draft kings/fan duel thing

slothroprhymes, Monday, 20 April 2015 00:02 (ten years ago)

Deron is so decrepit at this point, they're better off letting joe handle and he keeps getting torched by teague

Compared to early in the season deron is remarkably spry

Matt Armstrong, Monday, 20 April 2015 00:04 (ten years ago)

Oh my lord he was a walking corpse early in the season I remember, he was a good argument against guaranteed contracts, if he were a running back he'd be that big name everyone picks in the top ten of a fantasy draft for one year too long who just gets unceremoniously cut the next year

juice college (agent hibachi), Monday, 20 April 2015 00:06 (ten years ago)

Aka Chris Johnson

juice college (agent hibachi), Monday, 20 April 2015 00:06 (ten years ago)

"will nicolas batum record a triple double?"

no

Clay, Monday, 20 April 2015 00:11 (ten years ago)

assertive assisting jeff

slothroprhymes, Monday, 20 April 2015 00:17 (ten years ago)

portland and boston gonna get swept, rip ilh, long live the warriors

Clay, Monday, 20 April 2015 01:07 (ten years ago)

portland maybe shouldn't have done the afflalo deal I guess...

Matt Armstrong, Monday, 20 April 2015 01:16 (ten years ago)

xp shhhhhhhh

both of those teams can get at least one at home I think

slothroprhymes, Monday, 20 April 2015 01:17 (ten years ago)

ah excellent the return of bbq chicken

Clay, Monday, 20 April 2015 01:19 (ten years ago)

these are obv the worst possible matchups for both our teams tho

slothroprhymes, Monday, 20 April 2015 01:20 (ten years ago)

shaq is such a loveable goof luv shaq

Clay, Monday, 20 April 2015 01:21 (ten years ago)

portland maybe shouldn't have done the afflalo deal I guess...

― Matt Armstrong, Sunday, April 19, 2015 6:16 PM (5 minutes ago) Bookmark Flag Post Permalink

eh hindsight, was a really smart deal at the time

Clay, Monday, 20 April 2015 01:22 (ten years ago)

probably shoulda drafted jordan & durant too

Clay, Monday, 20 April 2015 01:23 (ten years ago)

good idea

lag∞n, Monday, 20 April 2015 01:26 (ten years ago)

this is getting real sloppy, gawd only like 3 of these playoff games have been good thus far (dubs-pelicans, bulls-bucks & cavs-celtics)

slothroprhymes, Monday, 20 April 2015 01:36 (ten years ago)

Oh Vince Carter.

Jeff, Monday, 20 April 2015 02:31 (ten years ago)

xp how the mighty have fallen

micah, Monday, 20 April 2015 02:34 (ten years ago)

rusty start for the spurs, clippers riding some home court vibes rn

brosario nawson (m bison), Monday, 20 April 2015 02:54 (ten years ago)

ugh that's such a block

k3vin k., Monday, 20 April 2015 03:01 (ten years ago)

fuck cp3

brosario nawson (m bison), Monday, 20 April 2015 03:03 (ten years ago)

fuck all these offnesive fouls god i hate the clippers fuck this horrible team of miscreants

brosario nawson (m bison), Monday, 20 April 2015 03:07 (ten years ago)

otm

slothroprhymes, Monday, 20 April 2015 03:11 (ten years ago)

wow, i really don't know about doc going with the hockey shift. the clippers bench is liable to give up any lead they're given

k3vin k., Monday, 20 April 2015 03:14 (ten years ago)

austin will undo the whole thing

slothroprhymes, Monday, 20 April 2015 03:15 (ten years ago)

turkoglu is in this game and reggie is making horrible fat jokes and we are down 10, i think i forgot to pray today and god is punishing me

brosario nawson (m bison), Monday, 20 April 2015 03:15 (ten years ago)

ray liotta pissed inna middle of a traffic jam and stares down some poor dive barkeep for some vodka and just laughs at him goddamn i want to get into a fight right now

brosario nawson (m bison), Monday, 20 April 2015 03:18 (ten years ago)

haha yesss patty hits a three and baby levels manu for an offnesive foul, tide is turning

brosario nawson (m bison), Monday, 20 April 2015 03:21 (ten years ago)

boris and baby on each other is like #bodypositivityNBA for me

brosario nawson (m bison), Monday, 20 April 2015 03:22 (ten years ago)

wow, i really don't know about doc going with the hockey shift. the clippers bench is liable to give up any lead they're given

― k3vin k., Sunday, April 19, 2015 11:14 PM (8 minutes ago) Bookmark Flag Post Permalink

ya wtf is he doing

lag∞n, Monday, 20 April 2015 03:23 (ten years ago)

sparkling opening number by the clippers bench

J0rdan S., Monday, 20 April 2015 03:24 (ten years ago)

wow who could have seen this coming, the clippers bench has squandered the entire lead in about 3 minutes

k3vin k., Monday, 20 April 2015 03:24 (ten years ago)

its gorgeous, im eating seconds right now, im gonna have to brush my teeth again

brosario nawson (m bison), Monday, 20 April 2015 03:25 (ten years ago)

cp3 just stuck his leg out to foul tp and probably injured him (more)

brosario nawson (m bison), Monday, 20 April 2015 03:44 (ten years ago)

doc is openly trying to get fired

k3vin k., Monday, 20 April 2015 03:46 (ten years ago)

god, pull tony he looks too banged up to be effective. at least with patty you get 3s and cory joseph is predictable

brosario nawson (m bison), Monday, 20 April 2015 03:47 (ten years ago)

hack! hack! hack! hack! hack! hack! hack!

J0rdan S., Monday, 20 April 2015 03:50 (ten years ago)

spurs should really be pushing the pace a little more

k3vin k., Monday, 20 April 2015 03:50 (ten years ago)

spurs should be doing a lot of things better

brosario nawson (m bison), Monday, 20 April 2015 03:51 (ten years ago)

lolll harlan: "he looked to the heavens and he was rewarded" upon deandre finally making a second free throw

slothroprhymes, Monday, 20 April 2015 03:52 (ten years ago)

they should want to maximize possessions with paul out. fouling jordan is step 1, but can't walk the ball up after

k3vin k., Monday, 20 April 2015 03:52 (ten years ago)

HOLY SHIT BLAKE

k3vin k., Monday, 20 April 2015 04:34 (ten years ago)

wow that's so lame they called that a jump ball on kawhi

k3vin k., Monday, 20 April 2015 04:34 (ten years ago)

rly hope the spurs got some adjustments in game 2

brosario nawson (m bison), Monday, 20 April 2015 04:35 (ten years ago)

wow i hate la so much stfu with this mvp bullshit

brosario nawson (m bison), Monday, 20 April 2015 04:35 (ten years ago)

chris paul, man

k3vin k., Monday, 20 April 2015 04:38 (ten years ago)

m-v-p m-v-p

lag∞n, Monday, 20 April 2015 04:38 (ten years ago)

dead2me

brosario nawson (m bison), Monday, 20 April 2015 04:42 (ten years ago)

lol

lag∞n, Monday, 20 April 2015 04:45 (ten years ago)

like im not even gonna ban u im just going to ignore u when i see u at work and donate money to causes you hate

brosario nawson (m bison), Monday, 20 April 2015 04:47 (ten years ago)

Blake is unreal sometimes

#wegonnabechampionship (Spottie), Monday, 20 April 2015 04:47 (ten years ago)

Moral of the story obv for doc is to not play anyone on the bench except Jamal and maybe 5 minutes of big baby

#wegonnabechampionship (Spottie), Monday, 20 April 2015 04:48 (ten years ago)

Jamal so pure tonight. All net every time

#wegonnabechampionship (Spottie), Monday, 20 April 2015 04:52 (ten years ago)

whoa timmy D with the followup

k3vin k., Monday, 20 April 2015 04:53 (ten years ago)

https://vine.co/v/eaB0YE7YjTd

lag∞n, Monday, 20 April 2015 04:53 (ten years ago)

how many playoff games can you win with 7 players?

J0rdan S., Monday, 20 April 2015 04:56 (ten years ago)

Enough

#wegonnabechampionship (Spottie), Monday, 20 April 2015 04:57 (ten years ago)

i hope the correct answer is less than 4

brosario nawson (m bison), Monday, 20 April 2015 04:57 (ten years ago)

crawford trying draw a foul on the 3, hate that leg kicky shit he does

also cp3 has been unreal, blake gonna get all the love for his dunks, but shiiiiit

brosario nawson (m bison), Monday, 20 April 2015 04:58 (ten years ago)

Yah cp looking very good

#wegonnabechampionship (Spottie), Monday, 20 April 2015 04:59 (ten years ago)

cp3 just totally controlling tempo, picking spots for his shot, dishing tough passes, i just gotta pray to hoops jesus that he folds in the 4th

brosario nawson (m bison), Monday, 20 April 2015 05:00 (ten years ago)

i really want the spurs to come back bcuz after dark playoff harlan is a legal high

J0rdan S., Monday, 20 April 2015 05:00 (ten years ago)

spurs blitzing with 3s now, regressing to the mean

brosario nawson (m bison), Monday, 20 April 2015 05:02 (ten years ago)

when are ppl gonna foul blake hard, he's p strong

brosario nawson (m bison), Monday, 20 April 2015 05:03 (ten years ago)

how many playoff games can you win with 7 players?

― J0rdan S., Monday, April 20, 2015 12:56 AM (7 minutes ago)

when your starting units are as good as the clippers' are, it can work i think

k3vin k., Monday, 20 April 2015 05:05 (ten years ago)

when are ppl gonna foul blake hard, he's p strong

― brosario nawson (m bison), Monday, April 20, 2015 1:03 AM (2 minutes ago)

blake probably gets fouled as hard as anyone in the league

k3vin k., Monday, 20 April 2015 05:06 (ten years ago)

i meant ppl should foul him with knives

brosario nawson (m bison), Monday, 20 April 2015 05:07 (ten years ago)

he exaggerates it

#wegonnabechampionship (Spottie), Monday, 20 April 2015 05:07 (ten years ago)

how many playoff games can you win with 7 players?

― J0rdan S., Monday, April 20, 2015 12:56 AM (7 minutes ago)

when your starting units are as good as the clippers' are, it can work i think

i think i agree

J0rdan S., Monday, 20 April 2015 05:08 (ten years ago)

im sorry, i made a promise to myself that i wouldnt wish death upon opposing players and i couldnt even make it past 1 game

brosario nawson (m bison), Monday, 20 April 2015 05:08 (ten years ago)

when your starting units are as good as the clippers' are, it can work i think

― k3vin k., Sunday, April 19, 2015 10:05 PM (2 minutes ago) Bookmark Flag Post Permalink

yeah the margin of error is tight tho everyone has to play well can't have anyone slump.

#wegonnabechampionship (Spottie), Monday, 20 April 2015 05:09 (ten years ago)

they're gonna be in trouble in any game where deandre gets into foul trouble

J0rdan S., Monday, 20 April 2015 05:10 (ten years ago)

if doc hadn't put in his entire bench unit at once this would be like a 25 point lead

J0rdan S., Monday, 20 April 2015 05:11 (ten years ago)

that was a three minute stretch haha

#wegonnabechampionship (Spottie), Monday, 20 April 2015 05:12 (ten years ago)

that bench man idk. jamal really gonna have to play out of his mind every game

#wegonnabechampionship (Spottie), Monday, 20 April 2015 05:13 (ten years ago)

it looks like doc figured out that staggering was a whole lot better than that hockey shift he tried

k3vin k., Monday, 20 April 2015 05:18 (ten years ago)

yeah that worked way better

#wegonnabechampionship (Spottie), Monday, 20 April 2015 05:19 (ten years ago)

honestly this feels like a set up for the spurs to win by 22 in game 2

J0rdan S., Monday, 20 April 2015 05:20 (ten years ago)

ESPN Stats & Info ‏@ESPNStatsInfo 46s47 seconds ago
Clippers: 15-1 since March 17

lag∞n, Monday, 20 April 2015 05:24 (ten years ago)

damn I see that I passed out just before shit went completely pear shaped for the spurs

slothroprhymes, Monday, 20 April 2015 12:35 (ten years ago)

honestly based on what I did see (most of 3 quarters) it's not so much a question of can the clips sustain their starters' performances - bc I'm sure they more or less can - but of will things go nearly as badly for the spurs independent of what the clips were doing right. I mostly don't see them having transition moves that bad or shooting at 32 percent for 2 consecutive games

slothroprhymes, Monday, 20 April 2015 12:39 (ten years ago)

pat riley, in a complete non-surprise, setting new land-speed records for pettiness
http://www.sbnation.com/2015/4/20/8457393/pat-riley-angry-lebron-james-leave-miami-heat

Pat Riley on the draft: "No more smiling faces with hidden agendas, so we'll be going in clean."

lol you gotta be fuckin kidding me riles

slothroprhymes, Monday, 20 April 2015 16:12 (ten years ago)

lol nice

lag∞n, Monday, 20 April 2015 16:30 (ten years ago)

GOAT

J0rdan S., Monday, 20 April 2015 16:38 (ten years ago)

the whole drafting napier scheme is still the funniest

lag∞n, Monday, 20 April 2015 16:41 (ten years ago)

i dont really think it was a scheme more like a series of weird turns, and i remain p sure that bron was ready to leave before draft night, but who knows

slothroprhymes, Monday, 20 April 2015 16:51 (ten years ago)

ok

lag∞n, Monday, 20 April 2015 16:51 (ten years ago)

not sure why that's exactly a controversial thought, by saying "who knows" i'm def conceding i could be wrong bc i do not in fact possess telepathic abilities that outline the exact thinking of bron or riles to me

slothroprhymes, Monday, 20 April 2015 16:54 (ten years ago)

they 100% drafted shabazz to make lebron happy but it's not like it was an extreme reach or anything at that point

J0rdan S., Monday, 20 April 2015 17:04 (ten years ago)

Blake::Aron Baynes::Madonna:Drake

, Monday, 20 April 2015 17:12 (ten years ago)

Marc Stein ‏@ESPNSteinLine 54s54 seconds ago
Pelicans are officially listing both Tyreke Evans (knee) and Jrue Holiday (leg) as questionable for tonight's Game 2 at Golden State

blah

lag∞n, Monday, 20 April 2015 17:53 (ten years ago)

brow gonna drop 40-15-5-6-6 tonight

#wegonnabechampionship (Spottie), Monday, 20 April 2015 17:55 (ten years ago)

live look-in on monty williams and brow rn
https://www.youtube.com/watch?v=2QjTSnaqUX4

slothroprhymes, Monday, 20 April 2015 18:06 (ten years ago)

http://espn.go.com/video/clip?id=espn:12730260

#wegonnabechampionship (Spottie), Monday, 20 April 2015 23:59 (ten years ago)

cute!

Nhex, Tuesday, 21 April 2015 00:13 (ten years ago)

Man thibs has no idea how to tie a tie his shit is all fucked up

Kidd doesn't even bother with one

Someone get me a cloud I can yell at

juice college (agent hibachi), Tuesday, 21 April 2015 00:16 (ten years ago)

I feel like I would be genuinely terrified to play against Giannis, just crazy spider limbs everywhere

juice college (agent hibachi), Tuesday, 21 April 2015 00:17 (ten years ago)

Derrick Rose three pointers!

Matt Armstrong, Tuesday, 21 April 2015 00:18 (ten years ago)

Lol Giannis u can't do the rondo fake pass then blow the layup, ya played yourself

juice college (agent hibachi), Tuesday, 21 April 2015 00:19 (ten years ago)

bucks playing great d but doubt they can keep it up for 48

A True White Kid that can Jump (Granny Dainger), Tuesday, 21 April 2015 00:21 (ten years ago)

http://bkref.com/tiny/6CL47

Matt Armstrong, Tuesday, 21 April 2015 00:22 (ten years ago)

biggest decline in ability for Rose post-surgery is somehow his ball handling

A True White Kid that can Jump (Granny Dainger), Tuesday, 21 April 2015 00:33 (ten years ago)

mayo hair on fleep

lag∞n, Tuesday, 21 April 2015 00:38 (ten years ago)

no u both have mushroom shape hair dont fight

lag∞n, Tuesday, 21 April 2015 00:42 (ten years ago)

Five techs! This series just got way better

juice college (agent hibachi), Tuesday, 21 April 2015 00:45 (ten years ago)

lol idk if ive ever seen five techs on one play much less one minor scrum before

lag∞n, Tuesday, 21 April 2015 00:47 (ten years ago)

bucks are locked the hell in on D rn

slothroprhymes, Tuesday, 21 April 2015 00:53 (ten years ago)

You know I never really thought about the fact that all of oj mayo's names are food

juice college (agent hibachi), Tuesday, 21 April 2015 00:57 (ten years ago)

he's the food lover's peter o'toole

A True White Kid that can Jump (Granny Dainger), Tuesday, 21 April 2015 01:00 (ten years ago)

Ilyasova ice cold but playing pretty awesome D on mirotic

Matt Armstrong, Tuesday, 21 April 2015 01:01 (ten years ago)

i like how mirotic looks like hes from the bible

lag∞n, Tuesday, 21 April 2015 01:01 (ten years ago)

this play by play guy doesn't watch much basketball huh

Matt Armstrong, Tuesday, 21 April 2015 01:07 (ten years ago)

Kidd takes Ersan out and Mirotic immediately goes nuts

Matt Armstrong, Tuesday, 21 April 2015 01:11 (ten years ago)

Nikola 'The Bible' Mirotic

A True White Kid that can Jump (Granny Dainger), Tuesday, 21 April 2015 01:15 (ten years ago)

https://vine.co/v/eaqqe2gaKb7

O_______O

k3vin k., Tuesday, 21 April 2015 01:26 (ten years ago)

i can't watch this game, sorry

k3vin k., Tuesday, 21 April 2015 01:26 (ten years ago)

it really was only bad for one quarter

Matt Armstrong, Tuesday, 21 April 2015 01:28 (ten years ago)

ok i lied it's on mute

dunleavy just passed up a point-blank layup to pass to rose for 3. rose made it tho

k3vin k., Tuesday, 21 April 2015 01:29 (ten years ago)

Steve Smith says the bucks gotta come out there and run Derrick Rose off the three point line

Matt Armstrong, Tuesday, 21 April 2015 01:30 (ten years ago)

only if he makes them

Giant Purple Wakerobin (Aimless), Tuesday, 21 April 2015 01:33 (ten years ago)

that's more like it rose

slothroprhymes, Tuesday, 21 April 2015 01:35 (ten years ago)

and butler!

slothroprhymes, Tuesday, 21 April 2015 01:36 (ten years ago)

nba marketing the playoffs as "the redefinition of hero ball" is really weird and off

lag∞n, Tuesday, 21 April 2015 01:41 (ten years ago)

BBALLBREAKDOWN ‏@bballbreakdown 53s53 seconds ago
Bulls are discovering a soft spot in the Bucks defense - if they hit the high post, the weakside corner is wide open

lag∞n, Tuesday, 21 April 2015 01:45 (ten years ago)

I got in an argument with the bballbreakdown guy where he argued that isiah thomas would have put up stephen curry's numbers if his coaches just encouraged him to shoot threes.

Matt Armstrong, Tuesday, 21 April 2015 01:47 (ten years ago)

lol yeah coach nick believes some off the wall things but thats part of his charm

lag∞n, Tuesday, 21 April 2015 01:48 (ten years ago)

that's more of a dumb thing tbh

Matt Armstrong, Tuesday, 21 April 2015 01:48 (ten years ago)

hey be nice to coach nick

lag∞n, Tuesday, 21 April 2015 01:49 (ten years ago)

coach nick can take it

Matt Armstrong, Tuesday, 21 April 2015 01:52 (ten years ago)

coach nick taught me about the hop vs the 1-2

lag∞n, Tuesday, 21 April 2015 01:53 (ten years ago)

I think maybe he should stick to Xs and 0s

Matt Armstrong, Tuesday, 21 April 2015 01:54 (ten years ago)

yeah its a weird thing ive noticed other about other coaches turned pundits they can know like every little thing about the game while holding the most blatantly bad wrong opinons

lag∞n, Tuesday, 21 April 2015 01:56 (ten years ago)

someone get a gif of rose insouciantly pedaling his stationary bike on the sideline

slothroprhymes, Tuesday, 21 April 2015 01:58 (ten years ago)

I just realized they're showing that jabari ad because the bucks are in the playoffs

Matt Armstrong, Tuesday, 21 April 2015 02:01 (ten years ago)

The more I watch him the more I think Giannis doesn't make the jump and remains an unfulfilled curio that does something insane every other game
but he's so young its impossible to justify any such stance

tsrobodo, Tuesday, 21 April 2015 02:04 (ten years ago)

his second year progress was just about as much as you could ask for

Matt Armstrong, Tuesday, 21 April 2015 02:05 (ten years ago)

ya i think he will be very good he has already come so far

lag∞n, Tuesday, 21 April 2015 02:05 (ten years ago)

just needs an offensive move or 2 other than put-head-down-charge-to-rim

A True White Kid that can Jump (Granny Dainger), Tuesday, 21 April 2015 02:08 (ten years ago)

lol no one even bothers to guard MCW bulls are just like "sure man"

slothroprhymes, Tuesday, 21 April 2015 02:11 (ten years ago)

http://bkref.com/tiny/Pot91

Matt Armstrong, Tuesday, 21 April 2015 02:11 (ten years ago)

xxxp it's nice

head clowning instructor (art), Tuesday, 21 April 2015 02:13 (ten years ago)

ha Mirotic will throw anything up

tsrobodo, Tuesday, 21 April 2015 02:16 (ten years ago)

MIROTIC FITE

slothroprhymes, Tuesday, 21 April 2015 02:17 (ten years ago)

whoa

k3vin k., Tuesday, 21 April 2015 02:17 (ten years ago)

they better not give zaza a tech for that

Matt Armstrong, Tuesday, 21 April 2015 02:18 (ten years ago)

this is not the series i wldve expected to get chippy

lag∞n, Tuesday, 21 April 2015 02:19 (ten years ago)

the battle for lake michigan

lag∞n, Tuesday, 21 April 2015 02:19 (ten years ago)

idk there's some pretty chippy guys on these teams

Matt Armstrong, Tuesday, 21 April 2015 02:20 (ten years ago)

ya i guess it just seems so inconsequential but hey playoff basketball!! god bless them

lag∞n, Tuesday, 21 April 2015 02:21 (ten years ago)

sorry matt

slothroprhymes, Tuesday, 21 April 2015 02:22 (ten years ago)

man that is home coooking

Matt Armstrong, Tuesday, 21 April 2015 02:22 (ten years ago)

oh wow mirotic hurting

Matt Armstrong, Tuesday, 21 April 2015 02:23 (ten years ago)

ya somehow I don't think anyone wins in that sitch

slothroprhymes, Tuesday, 21 April 2015 02:23 (ten years ago)

This series is getting fun! Eurowrasslin! Giannis! Butler dunks! Announcers blatantly pulling for Derrick rose!

juice college (agent hibachi), Tuesday, 21 April 2015 02:23 (ten years ago)

thibs has def gained over 100lbs since leaving the celtics

lag∞n, Tuesday, 21 April 2015 02:25 (ten years ago)

I will never understand the cult of Derrick Rose. It's like a make a wish foundation thing.

Matt Armstrong, Tuesday, 21 April 2015 02:26 (ten years ago)

lol ya he seems like he needs some cheering up

lag∞n, Tuesday, 21 April 2015 02:26 (ten years ago)

it's like a rule in a lot of sports media to pull for derrick rose unless you're a number of older troll writers or fat drew magary or, well, 3/4 of this board

slothroprhymes, Tuesday, 21 April 2015 02:27 (ten years ago)

mirotic injury looked bone bruisish I guess

Matt Armstrong, Tuesday, 21 April 2015 02:27 (ten years ago)

I miss last year's playoffs already

Clay, Tuesday, 21 April 2015 02:28 (ten years ago)

I can totally understand all anti rose arguments but w/e his shit is gorgeous when it works & it doesn't affect me personally bc I'm not a chi fan

slothroprhymes, Tuesday, 21 April 2015 02:28 (ten years ago)

there's this obsession with Rose as a person, his humility and grace and from what I can tell he's just generally an extremely boring person whose career resembles that of Steve Francis with better rosters.

Matt Armstrong, Tuesday, 21 April 2015 02:28 (ten years ago)

most people pull for anyone who's young and plagued by injuries, where ya guys been

A True White Kid that can Jump (Granny Dainger), Tuesday, 21 April 2015 02:28 (ten years ago)

no one shed a tear for brandon roy

lag∞n, Tuesday, 21 April 2015 02:29 (ten years ago)

sorry can you express your feelings for him solely in bball ref player finder

A True White Kid that can Jump (Granny Dainger), Tuesday, 21 April 2015 02:30 (ten years ago)

Roy felt inevitable, there were whispers about his knees for forever.

also never unjustifiably won mvp

Clay, Tuesday, 21 April 2015 02:30 (ten years ago)

no one shed a tear for brandon roy

― lag∞n, Tuesday, April 21, 2015 2:29 AM (7 seconds ago) Bookmark Flag Post Permalink

idk, people loved Roy. Maybe Blazer cultism turned people off a little tho.

Matt Armstrong, Tuesday, 21 April 2015 02:31 (ten years ago)

I think a lot about the TWolves doctor who redflagged Granger and Roy, hope he wasn't fired.

Matt Armstrong, Tuesday, 21 April 2015 02:31 (ten years ago)

also oden happened at the same time so it was more like rubbernecking at carnage than being like "aw u poor guy"

Clay, Tuesday, 21 April 2015 02:32 (ten years ago)

when is more clips/spurs thats all i want

lag∞n, Tuesday, 21 April 2015 02:32 (ten years ago)

its like a conference finals matchup in the 1st round, its good

lag∞n, Tuesday, 21 April 2015 02:33 (ten years ago)

yes good is an apt description

k3vin k., Tuesday, 21 April 2015 02:33 (ten years ago)

Miercoles

brosario nawson (m bison), Tuesday, 21 April 2015 02:33 (ten years ago)

omg shaq please stop

slothroprhymes, Tuesday, 21 April 2015 02:34 (ten years ago)

we shd have a conspiracy to murder shaq

lag∞n, Tuesday, 21 April 2015 02:35 (ten years ago)

Bucks could really use a rim protector. A Larry Sanders type.

Matt Armstrong, Tuesday, 21 April 2015 02:35 (ten years ago)

its p funny how the spurs totally screwed themselves by not being able to beat the pelicans in the final game

lag∞n, Tuesday, 21 April 2015 02:36 (ten years ago)

and westbrook lol

lag∞n, Tuesday, 21 April 2015 02:36 (ten years ago)

don't forget the infamous knicks game

Matt Armstrong, Tuesday, 21 April 2015 02:37 (ten years ago)

excited for stephathon/browathon parte deux

slothroprhymes, Tuesday, 21 April 2015 02:38 (ten years ago)

dubs r too good

lag∞n, Tuesday, 21 April 2015 02:38 (ten years ago)

didnt see the 1st one tho

lag∞n, Tuesday, 21 April 2015 02:38 (ten years ago)

mark jax ruins jvg, shaq ruins tnt studio, can we trick the 2 of them into commentating on imaginary games on an imaginary station

A True White Kid that can Jump (Granny Dainger), Tuesday, 21 April 2015 02:39 (ten years ago)

xp no one can but we all wish we could

slothroprhymes, Tuesday, 21 April 2015 02:39 (ten years ago)

(re knicks spurs)

slothroprhymes, Tuesday, 21 April 2015 02:40 (ten years ago)

its p funny and weird that this guy is the mvp https://vine.co/v/eaqPTvUqAAA

lag∞n, Tuesday, 21 April 2015 02:41 (ten years ago)

the culture of the nba has really changed

lag∞n, Tuesday, 21 April 2015 02:43 (ten years ago)

cn u imagine how incensed charles oakley wldve been by his presence lol

lag∞n, Tuesday, 21 April 2015 02:43 (ten years ago)

wheres curry mom @

lag∞n, Tuesday, 21 April 2015 02:45 (ten years ago)

wow that shot by steph

k3vin k., Tuesday, 21 April 2015 02:46 (ten years ago)

ya damn

lag∞n, Tuesday, 21 April 2015 02:47 (ten years ago)

we shd have a conspiracy to murder shaq

it'd be cool if we did and it leaked out and ppl spoke of us as legends... "that was the messageboard that murdered shaq..."

Clay, Tuesday, 21 April 2015 02:48 (ten years ago)

it wld be prob the greatest nba story of all time

lag∞n, Tuesday, 21 April 2015 02:48 (ten years ago)

remember when Shaq supposedly had an army of creepy bodyguard dudes committing crimes, what happened to that story

Matt Armstrong, Tuesday, 21 April 2015 02:49 (ten years ago)

the bards will compose songs of our sacrifice

slothroprhymes, Tuesday, 21 April 2015 02:50 (ten years ago)

there would be a 30 for 30 for sure

narrator all reading our posts about shaq as they slowly become more incensed over time

Clay, Tuesday, 21 April 2015 02:50 (ten years ago)

lmao

lag∞n, Tuesday, 21 April 2015 02:51 (ten years ago)

what if I told you
there was a messageboard
that hated
one of america's most celebrated athletes
and they posted online about it

what if I told you
their collective rage
boiled over
and they murdered
a world champion

Clay, Tuesday, 21 April 2015 02:54 (ten years ago)

pelicans missing layups

lag∞n, Tuesday, 21 April 2015 02:54 (ten years ago)

lol xp

lag∞n, Tuesday, 21 April 2015 02:54 (ten years ago)

this is the story of online crossing over into irl with a result that once seemed unimaginable

lag∞n, Tuesday, 21 April 2015 02:55 (ten years ago)

many called him superman, but he turned out to be all too mortal

Clay, Tuesday, 21 April 2015 02:56 (ten years ago)

this team is so fun and arena seems the best. jealous of gsw fans.

A True White Kid that can Jump (Granny Dainger), Tuesday, 21 April 2015 02:56 (ten years ago)

eric gordon turning back the clock

slothroprhymes, Tuesday, 21 April 2015 02:56 (ten years ago)

hack a shaq, a film by andrew jarecki

balls, Tuesday, 21 April 2015 02:57 (ten years ago)

new board descript "we murdered shaq"

lag∞n, Tuesday, 21 April 2015 02:59 (ten years ago)

many called him superman, but he turned out to be all too mortal
--Clay

first he missed the free throws, then he missed the mark on every statement he ever said about professional basketball, then...he did not miss our attack

slothroprhymes, Tuesday, 21 April 2015 03:00 (ten years ago)

idk I couldn't find a good end to that one clay help me out here

slothroprhymes, Tuesday, 21 April 2015 03:01 (ten years ago)

pondexter has been a v good pickup for nola

lag∞n, Tuesday, 21 April 2015 03:01 (ten years ago)

nola defense is on a whole other level today

head clowning instructor (art), Tuesday, 21 April 2015 03:03 (ten years ago)

wow fun pellies quarter

J0rdan S., Tuesday, 21 April 2015 03:03 (ten years ago)

basketball petpeeve when a player is so intent on exploiting a mismatch that he gives away the advantage by being too deliberate

lag∞n, Tuesday, 21 April 2015 03:04 (ten years ago)

does anderson usually not come in until there's like 2 mins left in the first quarter?

J0rdan S., Tuesday, 21 April 2015 03:04 (ten years ago)

so happy norris cole is still in our lives

J0rdan S., Tuesday, 21 April 2015 03:06 (ten years ago)

i saw him in person! it was very exciting!

lag∞n, Tuesday, 21 April 2015 03:07 (ten years ago)

i was all there he is the butt of an online joke lol

lag∞n, Tuesday, 21 April 2015 03:07 (ten years ago)

my friend is v bummed cole trimmed down his hightop fade

slothroprhymes, Tuesday, 21 April 2015 03:11 (ten years ago)

that is what i fear people think every time i walk in a room xp

Clay, Tuesday, 21 April 2015 03:11 (ten years ago)

yeaaaaa monty you're gonna need to put brow back in.

slothroprhymes, Tuesday, 21 April 2015 03:14 (ten years ago)

barbosa offensive rebound and 1 this game has been so wacky

J0rdan S., Tuesday, 21 April 2015 03:18 (ten years ago)

dont be letting barbosa get his own miss smh

lag∞n, Tuesday, 21 April 2015 03:18 (ten years ago)

N O R R I S

J0rdan S., Tuesday, 21 April 2015 03:18 (ten years ago)

i love how norris is like the grizzled playoff veteran of this series lmao

J0rdan S., Tuesday, 21 April 2015 03:19 (ten years ago)

this barbosa v cole matchup is really intense!

lag∞n, Tuesday, 21 April 2015 03:19 (ten years ago)

game is a massive improvement over the first

slothroprhymes, Tuesday, 21 April 2015 03:21 (ten years ago)

i love how norris is like the grizzled playoff veteran of this series lmao

― J0rdan S., Monday, April 20, 2015 11:19 PM (10 minutes ago

hahaha

k3vin k., Tuesday, 21 April 2015 03:30 (ten years ago)

basketball players who are bad at catching basketballs are pretty funny

lag∞n, Tuesday, 21 April 2015 03:31 (ten years ago)

what the hell is davis doing on klay

k3vin k., Tuesday, 21 April 2015 03:31 (ten years ago)

dray passing up open 3s

lag∞n, Tuesday, 21 April 2015 03:32 (ten years ago)

curry/klay must be so frustrating to play against

lag∞n, Tuesday, 21 April 2015 03:32 (ten years ago)

then pellies have a 0% chance of even winning this series but would prob have like a 15% chance of making the east finals

J0rdan S., Tuesday, 21 April 2015 03:33 (ten years ago)

tru

lag∞n, Tuesday, 21 April 2015 03:33 (ten years ago)

15 percent is conservative in the east!

slothroprhymes, Tuesday, 21 April 2015 03:35 (ten years ago)

wow those were some shook-ass free throws from tyreke

k3vin k., Tuesday, 21 April 2015 03:37 (ten years ago)

im not quite certain tyreke should be playing

J0rdan S., Tuesday, 21 April 2015 03:38 (ten years ago)

that bogut pass was pretty good stuff

Clay, Tuesday, 21 April 2015 03:41 (ten years ago)

TNT heard us & is pouring gasoline on our shaq hatred fire holy fuck

slothroprhymes, Tuesday, 21 April 2015 03:52 (ten years ago)

shaq repeatedly very insitant that hes the strong man on top

lag∞n, Tuesday, 21 April 2015 03:53 (ten years ago)

davis reject boaguts

slothroprhymes, Tuesday, 21 April 2015 04:00 (ten years ago)

sick own

lag∞n, Tuesday, 21 April 2015 04:00 (ten years ago)

tyreke can't even jump high enough to put back a point blank tip in why is he not even leaving the court

J0rdan S., Tuesday, 21 April 2015 04:01 (ten years ago)

aaaand now steph's rolling rip pelican birds

slothroprhymes, Tuesday, 21 April 2015 04:02 (ten years ago)

davis was just triple teamed at the elbow

lag∞n, Tuesday, 21 April 2015 04:02 (ten years ago)

this one looks over

k3vin k., Tuesday, 21 April 2015 04:04 (ten years ago)

feel like brow hasn't shot in like an hour

J0rdan S., Tuesday, 21 April 2015 04:05 (ten years ago)

asik really needs to sit

k3vin k., Tuesday, 21 April 2015 04:08 (ten years ago)

Does Davis know that his brow has fallen down onto his chin?

A-Hanisi Coates (Leee), Tuesday, 21 April 2015 04:15 (ten years ago)

J0rdan S.
Posted: April 21, 2015 at 12:05:34 AM
feel like brow hasn't shot in like an hour

sometimes he plays too much in the flow of the game, also nolas offense cld be more focused on getting him good shots

lag∞n, Tuesday, 21 April 2015 04:19 (ten years ago)

tyreke is playing more aggressive than a typical lebron game

J0rdan S., Tuesday, 21 April 2015 04:25 (ten years ago)

wow that cunningham block

Clay, Tuesday, 21 April 2015 04:33 (ten years ago)

i really want the pelicans to come back bcuz after dark playoff harlan is a legal high
--J0rdan S.

slothroprhymes, Tuesday, 21 April 2015 04:33 (ten years ago)

looks like davis is gonna try to take over

k3vin k., Tuesday, 21 April 2015 04:39 (ten years ago)

at least for as long as bogut is on the bench lol

k3vin k., Tuesday, 21 April 2015 04:40 (ten years ago)

i will never get past steph's oral fixation

Clay, Tuesday, 21 April 2015 04:40 (ten years ago)

kudos to the pelis for staying inthis game when it looked like th dubs were abt to blow them out like 20 times

lag∞n, Tuesday, 21 April 2015 04:44 (ten years ago)

this is basically the best game of eric gordon's career considering the circumstances

J0rdan S., Tuesday, 21 April 2015 04:44 (ten years ago)

god, norris has committed some stupid fouls

k3vin k., Tuesday, 21 April 2015 04:48 (ten years ago)

he is trying to do too much

Clay, Tuesday, 21 April 2015 04:50 (ten years ago)

and right on cue a brutal turnover

Clay, Tuesday, 21 April 2015 04:50 (ten years ago)

well so much for the "klay disappears" grumbling

J0rdan S., Tuesday, 21 April 2015 04:51 (ten years ago)

facing brow up v dray doesnt make much sense need to pit him on the low block where he cn use his height

lag∞n, Tuesday, 21 April 2015 04:53 (ten years ago)

OMG that shot of Steph holding the ball, wagging his head at the Brow.

A-Hanisi Coates (Leee), Tuesday, 21 April 2015 04:54 (ten years ago)

yeah i don't understand why they aren't getting him touches deeper in the post

k3vin k., Tuesday, 21 April 2015 04:55 (ten years ago)

ugh the pelis offense these last few possessions just pure cringeball

Clay, Tuesday, 21 April 2015 04:57 (ten years ago)

g/o

lag∞n, Tuesday, 21 April 2015 04:57 (ten years ago)

this is unbelievable

k3vin k., Tuesday, 21 April 2015 04:57 (ten years ago)

not sure NO is gonna play a better game against the dubs than this too

Clay, Tuesday, 21 April 2015 04:58 (ten years ago)

i mean it's believable

k3vin k., Tuesday, 21 April 2015 04:58 (ten years ago)

pelicans look exhausted

lag∞n, Tuesday, 21 April 2015 04:58 (ten years ago)

it's realy unfortunate that monty's gonna keep his job

Clay, Tuesday, 21 April 2015 05:00 (ten years ago)

ya

lag∞n, Tuesday, 21 April 2015 05:01 (ten years ago)

http://www.boomerbrief.com/assets_c/2012/07/Stick%20a%20fork%20in%20it%20-%20600-thumb-600x514-5170.jpg

A-Hanisi Coates (Leee), Tuesday, 21 April 2015 05:02 (ten years ago)

lol why is that chicken raw

lag∞n, Tuesday, 21 April 2015 05:03 (ten years ago)

sorry only bbq chicken itt

Clay, Tuesday, 21 April 2015 05:04 (ten years ago)

Better than being cooked like Iguodala's offense. xp

A-Hanisi Coates (Leee), Tuesday, 21 April 2015 05:04 (ten years ago)

@ESPNStatsInfo: Pelicans shot 25.7% (9-of-35) in the 2nd half, their worst shooting half this season

Anthony Davis: 2-9 in 2nd half, 0-5 in 4th quarter

huge missed opportunity

lag∞n, Tuesday, 21 April 2015 05:05 (ten years ago)

road teams 0-10 now right?

Clay, Tuesday, 21 April 2015 05:05 (ten years ago)

draymond green has been a monster in this series

k3vin k., Tuesday, 21 April 2015 05:06 (ten years ago)

it's realy unfortunate that monty's gonna keep his job
--Clay

prob only as a one year last chance though

slothroprhymes, Tuesday, 21 April 2015 05:06 (ten years ago)

wait no the wiz won but that series is a farce

Clay, Tuesday, 21 April 2015 05:07 (ten years ago)

monty doesn't seem that bad to me. he doesn't add anything but i'm not sure he's actively bad. the hornets have been pretty competitive in this series despite pretty inferior talent. their big problem is that basically every player except AD is overpaid.

tho obv if thibs or someone wanted that job i'd dump monty in a heartbeat

J0rdan S., Tuesday, 21 April 2015 05:30 (ten years ago)

Rip inside the nba

#wegonnabechampionship (Spottie), Tuesday, 21 April 2015 06:29 (ten years ago)

monty doesn't seem that bad to me. he doesn't add anything but i'm not sure he's actively bad. the hornets have been pretty competitive in this series despite pretty inferior talent. their big problem is that basically every player except AD is overpaid.

tho obv if thibs or someone wanted that job i'd dump monty in a heartbeat

― J0rdan S., Tuesday, April 21, 2015 1:30 AM (7 hours ago) Bookmark Flag Post Permalink

there has to be a dude on the spurs bench who would love to have the chance to work with davis. i mean look at golden state and atlanta now

k3vin k., Tuesday, 21 April 2015 13:27 (ten years ago)

sure. that's true for a lot of teams.

i don't really want to take up defending monty but i do think he seems better than like, you know, hiring lawrence frank or alvin gentry for the 300th time or something.

J0rdan S., Tuesday, 21 April 2015 14:27 (ten years ago)

maybe that's faint praise. i guess my real point is that just that i'm not watching that series like "well the problem is the pelicans coach"

J0rdan S., Tuesday, 21 April 2015 14:31 (ten years ago)

he's probably in the bottom row of the league's 30 coaches this year - like #20 or #21 - but the way some folks memeify his ineptitude they make it sound like he's some all-time idiot, which is def untrue. NOLA's front office staff are considerably worse at their jobs than monty is at his

slothroprhymes, Tuesday, 21 April 2015 14:37 (ten years ago)

the real problem is that they have a once in a lifetime talent on their team and they need to be maximizing his chances for success right now

juice college (agent hibachi), Tuesday, 21 April 2015 14:52 (ten years ago)

and a lot of that is due to owner demands

balls, Tuesday, 21 April 2015 14:53 (ten years ago)

Xp

balls, Tuesday, 21 April 2015 14:53 (ten years ago)

basically new orleans needs their equivalents of the andrew bogut acquisition (looked dicey) some more draft luck/skill and the mjax->kerr upgrade

juice college (agent hibachi), Tuesday, 21 April 2015 14:53 (ten years ago)

these are all hard things to pull off obv and monty williams doesnt seem too too bad other than an insistence on not really maximizing his use of the brow

juice college (agent hibachi), Tuesday, 21 April 2015 14:54 (ten years ago)

btw if ilh was going to bump off shaq we would have done it when he helped sink the 2011 celtics

(this post is the equivalent of that book oj simpson was going to write about if he did it wink wink)

juice college (agent hibachi), Tuesday, 21 April 2015 14:56 (ten years ago)

u know who got exposed as a surprise bottom ten type coach this year lionel hollins

kinda think maybe the league passed him by, or that brooklyn sitch is so messed up he's just casually cashing his checks knowing he's probably going to get canned anyway

juice college (agent hibachi), Tuesday, 21 April 2015 14:57 (ten years ago)

they're sort of jammed up cap wise and they cashed in so many draft picks that trying to upgrade on monty might be their only significant move left, but i'm not sure who they could hire that would suddenly vault them to the top half of the west

J0rdan S., Tuesday, 21 April 2015 14:58 (ten years ago)

xp i think it's a combination of both bc he is m/l well-liked for his work with the grizz as far as i know, but i really dont know if anyone can do much of anything with that team of malcontents and outdated dudes so he's probably like fuck it

slothroprhymes, Tuesday, 21 April 2015 15:06 (ten years ago)

they're sort of jammed up cap wise and they cashed in so many draft picks that trying to upgrade on monty might be their only significant move left, but i'm not sure who they could hire that would suddenly vault them to the top half of the west

― J0rdan S., Tuesday, April 21, 2015 10:58 AM (53 minutes ago) Bookmark Flag Post Permalink

literally anyone who can implement a spurs-style offense. they have the brow and shooters. this doesn't need to be rocket science

k3vin k., Tuesday, 21 April 2015 16:17 (ten years ago)

need willing players, maybe all players are willing under the right circumstances idk

lag∞n, Tuesday, 21 April 2015 16:27 (ten years ago)

def requires a high level of unselfishness/heads up play

lag∞n, Tuesday, 21 April 2015 16:29 (ten years ago)

i mean if you could just snap your fingers and implement a "spurs-style offense" the spurs would not be the spurs

J0rdan S., Tuesday, 21 April 2015 16:41 (ten years ago)

also who on the pelicans can shoot

J0rdan S., Tuesday, 21 April 2015 16:42 (ten years ago)

a spurs-style offense also runs counter to the notion that brow needs to see the ball much more

J0rdan S., Tuesday, 21 April 2015 16:42 (ten years ago)

apparently eric gordon can but that is a. not enough b. prob not sustainable

cole & tyreke also inconsistent and then who else is there...luke babbitt?

slothroprhymes, Tuesday, 21 April 2015 16:46 (ten years ago)

ryan anderson but i guess he doesn't play anymore

J0rdan S., Tuesday, 21 April 2015 16:51 (ten years ago)

gordon and ryan anderson are both very good shooters, plus QP. midlevel shooter types are going to want to play with davis

k3vin k., Tuesday, 21 April 2015 16:53 (ten years ago)

i don't see how it's on the coach to implement a spurs-style offense when his front office trades two first round picks for jrue holiday, a first round pick for omer asik and gives tyreke evans $45 million

J0rdan S., Tuesday, 21 April 2015 16:58 (ten years ago)

xp forgot pondexter, he's been good

the front office has been atrocious, which i suppose is to be expected bc own the new orleans saints and that is going the opposite of swimmingly

slothroprhymes, Tuesday, 21 April 2015 17:05 (ten years ago)

*they own

slothroprhymes, Tuesday, 21 April 2015 17:05 (ten years ago)

a spurs-style offense also runs counter to the notion that brow needs to see the ball much more

― J0rdan S., Tuesday, April 21, 2015 12:42 PM (22 minutes ago) Bookmark Flag Post Permalink

was thinking this too

lag∞n, Tuesday, 21 April 2015 17:07 (ten years ago)

A Spurs style offense has the ball changing hands a lot, he'd probably see more of it and in more advantageous situations.

tsrobodo, Tuesday, 21 April 2015 17:12 (ten years ago)

no one on the spurs averages more than 13 shots per game. anthony davis shot 17 times per game this season.

a spurs style offense in which anthony davis shoots more than he already does is not a spurs style offense

J0rdan S., Tuesday, 21 April 2015 17:14 (ten years ago)

feel like w the spurs theyre focused on getting good shots but not getting any particular player a high volume of good shots that wld be something at least a lil different

lol xp

lag∞n, Tuesday, 21 April 2015 17:15 (ten years ago)

Have to imagine a Spurs offense with a bonafide go-to guy (which Kawhi isn't quite yet) would function differently.

tsrobodo, Tuesday, 21 April 2015 17:15 (ten years ago)

His FGA are only likely to go up at this point

tsrobodo, Tuesday, 21 April 2015 17:15 (ten years ago)

Kawhi that is

tsrobodo, Tuesday, 21 April 2015 17:16 (ten years ago)

dont think kawhi will ever be a goto guy hes a much more in the flow of the game type which makes him perfect for the spurs

lag∞n, Tuesday, 21 April 2015 17:17 (ten years ago)

A go-to scorer can operate within the flow of an offense if he's dominant or creates enough panic in defenses that good ball movement results in easy opportunities for him.

Kawhi might never be a gunner but he'll lead them in scoring and there will be more pressure on him to take on that role as the big 3 diminish.

tsrobodo, Tuesday, 21 April 2015 17:21 (ten years ago)

this is a funny conversation as it applies to the pelicans specifically because it's not like the spurs were some dead end franchise that all of a sudden rocketed to the top of the league because they devised this new style of offense.

they won multiple championships when they ran their offense through a historically talented big man

J0rdan S., Tuesday, 21 April 2015 17:21 (ten years ago)

kawhi scored his career game high a few weeks ago, it was 27pts, hes been in the league four years and the most hes ever scored in a single game is 27pts

lag∞n, Tuesday, 21 April 2015 17:25 (ten years ago)

if kawhi is yr best offensive threat yr team is prob gonna have trouble scoring

lag∞n, Tuesday, 21 April 2015 17:26 (ten years ago)

Which is hardly surprising given that he plays within a highly disciplined and successful system that hasn't required him to score in volume. Can't actually remember the last time a Spurs player put up 40.

tsrobodo, Tuesday, 21 April 2015 17:28 (ten years ago)

hes literally never put up 30 in one game ever in four year lol

lag∞n, Tuesday, 21 April 2015 17:29 (ten years ago)

Well they've won a lot more games than any other team over that period so clearly it hasn't hurt them.

tsrobodo, Tuesday, 21 April 2015 17:30 (ten years ago)

im not sure what youre even talking about now

lag∞n, Tuesday, 21 April 2015 17:31 (ten years ago)

the spurs are incredibly unique, that's what makes them the spurs. i find the "play like the spurs!!" talk to be pretty limiting

J0rdan S., Tuesday, 21 April 2015 17:32 (ten years ago)

obv there are certain core principles the spurs currently adhere to that many teams across the league should probably adopt as well, but every team can't just be the spurs

J0rdan S., Tuesday, 21 April 2015 17:33 (ten years ago)

well the hawks have been playing like the spurs and generally the whole league is moving in that direction imo as far as more ball movement and balance fewer isos and so forth

lag∞n, Tuesday, 21 April 2015 17:33 (ten years ago)

You'd imagine a dominant players in that style of offense (Or at least the elements of it that can be approximated) would see a lot of easy opportunities.

tsrobodo, Tuesday, 21 April 2015 17:35 (ten years ago)

i think every team should move the ball. the pelicans might have won last night if they didn't have tyreke evans barreling toward the rim on one leg throwing shots off the underside of the rim.

but the spurs/hawks blueprint is a pretty specific sort of team that's not really a realistic model

J0rdan S., Tuesday, 21 April 2015 17:38 (ten years ago)

idk like if u look at the bron era heat that wld be a better example imo of a quality ball movement offense that was designed to get a few particular players good shots whereas the spurs/hawks are agnostic abt who gets the shots

xp

lag∞n, Tuesday, 21 April 2015 17:40 (ten years ago)

i agree that the pelicans should go small more often, spread the floor, have more shooters etc but again the front office has decided to sign players that necessitate they play a diff style. it's not like this is mark jackson fundamentally misusing incredible backcourt playmakers and shooters like steph and klay.

J0rdan S., Tuesday, 21 April 2015 17:40 (ten years ago)

really think brow shd play center mostly

lag∞n, Tuesday, 21 April 2015 17:41 (ten years ago)

get him closer to the basket on both ends

lag∞n, Tuesday, 21 April 2015 17:41 (ten years ago)

yeah i was thinking that the bron era heat model might be a more realistic blueprint for the pellies, with brow being the focal point out of the elbow/block with shooters around him.

J0rdan S., Tuesday, 21 April 2015 17:42 (ten years ago)

Is Davis a good enough passer for that to work though?

tsrobodo, Tuesday, 21 April 2015 17:48 (ten years ago)

hes a good passer and will no doubt only get better

lag∞n, Tuesday, 21 April 2015 17:49 (ten years ago)

they already play inside out w him at the elbow a lot but mostly theyre just dumping it to him there and letting him create rather than doing anything to encourage a good look

lag∞n, Tuesday, 21 April 2015 17:51 (ten years ago)

dont think kawhi will ever be a goto guy hes a much more in the flow of the game type which makes him perfect for the spurs

― lag∞n, Tuesday, April 21, 2015 1:17 PM (31 minutes ago

kawhi stops the ball plenty actually

it's more about having a system. davis can still get plenty of touches, take advantage of his playmaking abilities, and affect the game on defense. but teams like the spurs/dubs/hawks etc have the whole team buying into the system and can integrate their second units too

obviously they require personnel but they have some decent pieces now, plus anthony davis is going to be the best player in the world starting next year and people are gonna want to play with him. it'll work out

k3vin k., Tuesday, 21 April 2015 17:53 (ten years ago)

idk if u have a bad org it often does not work out, see bron in cleve

lag∞n, Tuesday, 21 April 2015 17:54 (ten years ago)

he spurs are incredibly unique, that's what makes them the spurs. i find the "play like the spurs!!" talk to be pretty limiting

― J0rdan S., Tuesday, April 21, 2015 1:32 PM (20 minutes ago) Bookmark Flag Post Permalink

obv there are certain core principles the spurs currently adhere to that many teams across the league should probably adopt as well, but every team can't just be the spurs

― J0rdan S., Tuesday, April 21, 2015 1:33 PM (20 minutes ago) Bookmark Flag Post Permalink

well the hawks have been playing like the spurs and generally the whole league is moving in that direction imo as far as more ball movement and balance fewer isos and so forth

― lag∞n, Tuesday, April 21, 2015 1:33 PM (19 minutes ago)

this is what i'm saying. this is the direction the league is moving in, this is what all the best teams are doing. take advantage of the situation now while you have a happy historically good player

k3vin k., Tuesday, 21 April 2015 17:55 (ten years ago)

kawhi stops the ball plenty actually

― k3vin k., Tuesday, April 21, 2015 1:53 PM (1 minute ago) Bookmark Flag Post Permalink

kawhi does some isos in the post tho often w mismatches but hes never gonna be anywhere close to a harden/durant/etc type of player who can constantly bring the ball up and make u eat it, hes a very cool player but hes just not a scoring machine

lag∞n, Tuesday, 21 April 2015 17:57 (ten years ago)

ftr, when i said "spurs-style offense" i should have just said a more general term like pace and space

if ryan anderson can remember how to play basketball there is no reason the pellies should not be a top-5 offensive team

k3vin k., Tuesday, 21 April 2015 17:58 (ten years ago)

yeah brow/funtional anderson is a p sweet frontcourt

lag∞n, Tuesday, 21 April 2015 17:59 (ten years ago)

whats going on w him? injury?

#wegonnabechampionship (Spottie), Tuesday, 21 April 2015 18:00 (ten years ago)

he was injured a bunch this year and also had some personal issues iirc

lag∞n, Tuesday, 21 April 2015 18:02 (ten years ago)

thought the girlfriend thing was last year? idk

#wegonnabechampionship (Spottie), Tuesday, 21 April 2015 18:03 (ten years ago)

hes a very cool player but hes just not a scoring machine

― lag∞n, Tuesday, April 21, 2015 1:57 PM (5 minutes ago) Bookmark Flag Post Permalink

also jsut generally not a creating machine, not someone that bends the defense opening up opportunities for the whole team

lag∞n, Tuesday, 21 April 2015 18:03 (ten years ago)

kawhi kind of has an old-man game, on the spurs he knows to not stop the ball too much and wreck on defense but on another team he could be like a poor man's kobe

k3vin k., Tuesday, 21 April 2015 18:05 (ten years ago)

naaaaw

lag∞n, Tuesday, 21 April 2015 18:05 (ten years ago)

i mean he would not score THAT much

k3vin k., Tuesday, 21 April 2015 18:06 (ten years ago)

but i think that's kind of his DNA. dude likes his backdowns and midrange jumpers

k3vin k., Tuesday, 21 April 2015 18:06 (ten years ago)

he just does not seem to have that offensive ingenuity, more of a two dribble straight line driver/opportunistic player than someone who can consistantly break down the D

lag∞n, Tuesday, 21 April 2015 18:07 (ten years ago)

his post game is def developing nicely for sure, tho i suspect some of that is just being hot recently

lag∞n, Tuesday, 21 April 2015 18:08 (ten years ago)

he's so young man, he handles the ball well for his size

obviously he's closer to pippen than kobe, that's probably a better comparison

k3vin k., Tuesday, 21 April 2015 18:12 (ten years ago)

doubt hell ever get to pippens level offensively, like pip was the defacto point guard for the bulls 75% of the time

lag∞n, Tuesday, 21 April 2015 18:14 (ten years ago)

just a fantastic great passer/facilitator/creator

lag∞n, Tuesday, 21 April 2015 18:16 (ten years ago)

was also the prime scoring threat on dece bulls teams while jordan was playing baseball

lag∞n, Tuesday, 21 April 2015 18:19 (ten years ago)

defensively he is def pipesque tho

lag∞n, Tuesday, 21 April 2015 18:19 (ten years ago)

having a guy like that who is disruptive defensively and good offensively is super valuable

lag∞n, Tuesday, 21 April 2015 18:25 (ten years ago)

he's 23 man he's gonna be good

k3vin k., Tuesday, 21 April 2015 18:30 (ten years ago)

hes already very good but as far as being someone who can break down the D thats more of a knack imho, its a natural baller thing, and i dont see any of that in his game

lag∞n, Tuesday, 21 April 2015 18:31 (ten years ago)

wow first you question dray now you h8 kawhi i h8 u

k3vin k., Tuesday, 21 April 2015 18:32 (ten years ago)

you still like cp3 right

k3vin k., Tuesday, 21 April 2015 18:33 (ten years ago)

idk if u have a bad org it often does not work out, see bron in cleve

― lag∞n, Tuesday, April 21, 2015 1:54 PM (37 minutes ago) Bookmark

if you have an org that gives a major asset up for omer asik and gives major money to tyreke evans in free agency you're prob not gonna be about that pace and space life

J0rdan S., Tuesday, 21 April 2015 18:33 (ten years ago)

i like both kawhi and dray i just feel like you know they have strengths and weaknesses just like any other players

lag∞n, Tuesday, 21 April 2015 18:34 (ten years ago)

i feel the same sort of caution about kawhi that goon feels about draymond

J0rdan S., Tuesday, 21 April 2015 18:35 (ten years ago)

you still like cp3 right

― k3vin k., Tuesday, April 21, 2015 2:33 PM (1 minute ago) Bookmark Flag Post Permalink

ya of course he is my fav, you want to talk abt a player who has feel and the ability to shred the D, all that and incredible discipline!

lag∞n, Tuesday, 21 April 2015 18:35 (ten years ago)

liking chris paul is a moral failure

J0rdan S., Tuesday, 21 April 2015 18:38 (ten years ago)

lol hes so good tho, hes like the platonic ideal

lag∞n, Tuesday, 21 April 2015 18:39 (ten years ago)

he's incredible. nonetheless...

J0rdan S., Tuesday, 21 April 2015 18:40 (ten years ago)

https://twitter.com/cjzero/status/590586440461000704

k3vin k., Tuesday, 21 April 2015 18:48 (ten years ago)

was also the prime scoring threat on dece bulls teams while jordan was playing baseball

― lag∞n, Tuesday, April 21, 2015 6:19 PM (40 minutes ago) Bookmark Flag Post Permalink

much much more than dece, perhaps one bad call away from a title in fact.

Matt Armstrong, Tuesday, 21 April 2015 19:01 (ten years ago)

his post game is def developing nicely for sure, tho i suspect some of that is just being hot recently

― lag∞n, Tuesday, April 21, 2015 6:08 PM (53 minutes ago) Bookmark Flag Post Permalink

naw dude we saw it last year too, dude is just a fucking beast in the post

Matt Armstrong, Tuesday, 21 April 2015 19:02 (ten years ago)

After a review by a Grand Jury, felony aggravated assault charges have been filed against Phoenix Suns players and twins Markeiff Morris and Marcus Morris.

Clay, Tuesday, 21 April 2015 21:15 (ten years ago)

guess I missed the first half of that story?

Clay, Tuesday, 21 April 2015 21:15 (ten years ago)

Police say that that Hood was assaulted for sending "an inappropriate text message" to the Morris brothers' mother some time before the incident.

huh

polyphonic, Tuesday, 21 April 2015 21:19 (ten years ago)

never send a dick pic to an nba mom gotcha

Clay, Tuesday, 21 April 2015 21:20 (ten years ago)

http://grantland.com/the-triangle/the-last-ride-of-the-spurs-dynasty/

just in time, lots of words on kawhi and dray

k3vin k., Tuesday, 21 April 2015 21:22 (ten years ago)

It's well reasoned as always and this might maybe really be it but I'm gonna wait until the Spurs are really truly gone, we've seen it too many times before

I mean what if Timmy gets a cyborg leg this summer huh whatcha gonna do then league

juice college (agent hibachi), Tuesday, 21 April 2015 21:44 (ten years ago)

"Derrick Rose's desperate search for his MVP zip"

Matt Armstrong, Tuesday, 21 April 2015 21:53 (ten years ago)

Kawhi Leonard is a free agent wow. I wonder if the Spurs will have the courage to pay him 50% less than every player of his caliber will be making in 2 years.

Matt Armstrong, Tuesday, 21 April 2015 21:54 (ten years ago)

It's well reasoned as always and this might maybe really be it but I'm gonna wait until the Spurs are really truly gone, we've seen it too many times before

I mean what if Timmy gets a cyborg leg this summer huh whatcha gonna do then league
--juice college (agent hibachi)

this presumes he hasn't already been using one. only limping bc he's on the prototype now, when pop perfects it oh shit look out

slothroprhymes, Tuesday, 21 April 2015 21:57 (ten years ago)

ya of course he is my fav, you want to talk abt a player who has feel and the ability to shred the D

cp3 a tru maestro, the standard tv angle doesn't do full justice to how he toys w/a defense

A True White Kid that can Jump (Granny Dainger), Tuesday, 21 April 2015 21:58 (ten years ago)

as far as abysmal disgraces to the game of basketball, Chris Paul is fairly pleasant to watch yeah

Matt Armstrong, Tuesday, 21 April 2015 22:00 (ten years ago)

marcus is starting to get pretttaaayyyy good at shooting 3s wonders never cease

slothroprhymes, Tuesday, 21 April 2015 23:24 (ten years ago)

turner also got a steal off lebron so I would say brother brad has made at least a few adjustments

maybe they won't die in the 2nd quarter this time :/

slothroprhymes, Tuesday, 21 April 2015 23:25 (ten years ago)

ya smart being a dece shooter who cant drive is the exact opposite of what everyone expected from him this year on O xp

lag∞n, Tuesday, 21 April 2015 23:28 (ten years ago)

i thought sully vowed to get in shape?

#wegonnabechampionship (Spottie), Tuesday, 21 April 2015 23:33 (ten years ago)

these things take time lol

lag∞n, Tuesday, 21 April 2015 23:34 (ten years ago)

theyre saying he lost 20lbs while he was out but idk

lag∞n, Tuesday, 21 April 2015 23:34 (ten years ago)

lol get real

#wegonnabechampionship (Spottie), Tuesday, 21 April 2015 23:35 (ten years ago)

maybe like 7

lag∞n, Tuesday, 21 April 2015 23:37 (ten years ago)

7 lbs of muscle maybe

#wegonnabechampionship (Spottie), Tuesday, 21 April 2015 23:38 (ten years ago)

omg mean

lag∞n, Tuesday, 21 April 2015 23:39 (ten years ago)

hah

#wegonnabechampionship (Spottie), Tuesday, 21 April 2015 23:42 (ten years ago)

brad stevens is legit 24 years old

#wegonnabechampionship (Spottie), Tuesday, 21 April 2015 23:42 (ten years ago)

brother brad is 39 excuse me

but yea he totally looks like he's wearing his dad's suit jacket out there

slothroprhymes, Tuesday, 21 April 2015 23:56 (ten years ago)

wearing smaller suits w def help

lag∞n, Tuesday, 21 April 2015 23:57 (ten years ago)

sully was over 300 at one point so I'd believe he lost 25 or so not like that does a lot when you're that weight

slothroprhymes, Tuesday, 21 April 2015 23:58 (ten years ago)

cavs r bad

lag∞n, Wednesday, 22 April 2015 00:01 (ten years ago)

yeah they really aren't v good

#wegonnabechampionship (Spottie), Wednesday, 22 April 2015 00:01 (ten years ago)

What happened to Love's passing? Third time he's thrown it away.

Allen (etaeoe), Wednesday, 22 April 2015 00:02 (ten years ago)

WOW K LOVE POST UP

#wegonnabechampionship (Spottie), Wednesday, 22 April 2015 00:02 (ten years ago)

Whoops gave away most of that lead right quick

juice college (agent hibachi), Wednesday, 22 April 2015 00:04 (ten years ago)

sullys 3pt shot looking p smooth

lag∞n, Wednesday, 22 April 2015 00:08 (ten years ago)

NBA Finals should be Cavs bench v Clips bench.

Allen (etaeoe), Wednesday, 22 April 2015 00:10 (ten years ago)

lol old bron pulling up and passing to the 3pt line on the break w/only lol isaiah thomas between him and the basket

lag∞n, Wednesday, 22 April 2015 00:11 (ten years ago)

idk y LeBron isn't just running through Thomas.

Allen (etaeoe), Wednesday, 22 April 2015 00:12 (ten years ago)

Seriously! It's baffling.

Allen (etaeoe), Wednesday, 22 April 2015 00:12 (ten years ago)

hes very old he doesnt do stuff like that anymore

lag∞n, Wednesday, 22 April 2015 00:13 (ten years ago)

measured in terms of total career minutes played LeBron is pretty old

Giant Purple Wakerobin (Aimless), Wednesday, 22 April 2015 00:22 (ten years ago)

he's 13th among active nba players

Giant Purple Wakerobin (Aimless), Wednesday, 22 April 2015 00:25 (ten years ago)

ugh giving away fouls way too easily c'mon celtics

slothroprhymes, Wednesday, 22 April 2015 00:33 (ten years ago)

fuuuuck love remembering he's a post player not good not good

slothroprhymes, Wednesday, 22 April 2015 00:39 (ten years ago)

olynyk jacking up shots for the rest of the game. go back to ncaa asap.

Allen (etaeoe), Wednesday, 22 April 2015 00:44 (ten years ago)

"olynyk ... way off."

Allen (etaeoe), Wednesday, 22 April 2015 00:44 (ten years ago)

Figured out that lebron without headband looks like a dragon ball z character whose lost all his armor during the fight but achieved higher form and is powering up

, Wednesday, 22 April 2015 01:03 (ten years ago)

Another classic Love pass. LOL

Allen (etaeoe), Wednesday, 22 April 2015 01:03 (ten years ago)

This has been my contribution to the nba 2015 playoffs discussion. Thanks, thanks

, Wednesday, 22 April 2015 01:03 (ten years ago)

Isiah Thomas drives are incredible, he just bounces off people like a lil ping pong ball

juice college (agent hibachi), Wednesday, 22 April 2015 01:05 (ten years ago)

Just saw an add for 'team stream' on my tream what's going on??

, Wednesday, 22 April 2015 01:07 (ten years ago)

Brad Stevens and Tim Duncan are the same age

juice college (agent hibachi), Wednesday, 22 April 2015 01:12 (ten years ago)

Farmersonly.com is real and not a tumblr meme? And they're advertising during the nba playoffs??

, Wednesday, 22 April 2015 01:27 (ten years ago)

these playoffs hella bummin me out idk i think it's just the matchups?

Clay, Wednesday, 22 April 2015 01:27 (ten years ago)

Marv has really really slipped

Matt Armstrong, Wednesday, 22 April 2015 01:29 (ten years ago)

just guesses at what the refs called

Matt Armstrong, Wednesday, 22 April 2015 01:29 (ten years ago)

oh no parsons is out!

lag∞n, Wednesday, 22 April 2015 01:44 (ten years ago)

rip mavs

lag∞n, Wednesday, 22 April 2015 01:44 (ten years ago)

My god mavs starting Richard Jefferson in 2015

Rip mavs

juice college (agent hibachi), Wednesday, 22 April 2015 01:47 (ten years ago)

whoa that dunk by richard jefferson

k3vin k., Wednesday, 22 April 2015 01:52 (ten years ago)

mavs right there though

slothroprhymes, Wednesday, 22 April 2015 02:07 (ten years ago)

nothing makes me sadder than the fact that mavs are doing well here bc of an absence of rondo

slothroprhymes, Wednesday, 22 April 2015 02:37 (ten years ago)

28 points on 12-21 shooting for brad beal tonight

J0rdan S., Wednesday, 22 April 2015 03:00 (ten years ago)

chuck & kenny just killing rondo, dang

man shaq is so bad

J0rdan S., Wednesday, 22 April 2015 03:01 (ten years ago)

rondo getting angry not good

slothroprhymes, Wednesday, 22 April 2015 03:13 (ten years ago)

man shaq is so bad

― J0rdan S., Tuesday, April 21, 2015 8:01 PM (12 minutes ago) Bookmark Flag Post Permalink

dont worry we have a plan where he gets murdered

Clay, Wednesday, 22 April 2015 03:14 (ten years ago)

this is an all time sabotage game from rondo

J0rdan S., Wednesday, 22 April 2015 03:23 (ten years ago)

oh god fuckin damnit josh smith is making threes fuck everything

slothroprhymes, Wednesday, 22 April 2015 03:23 (ten years ago)

he keeps scoring this is like a triumph of garbage basketball

slothroprhymes, Wednesday, 22 April 2015 03:32 (ten years ago)

man shaq is so bad

― J0rdan S., Tuesday, April 21, 2015 11:01 PM (30 minutes ago) Bookmark Flag Post Permalink

lol at one point shaq pointed out something in the tape and kenny said i did not notice that three times in a row so shocked shaq caught something he didnt

lag∞n, Wednesday, 22 April 2015 03:33 (ten years ago)

lol yes

J0rdan S., Wednesday, 22 April 2015 03:38 (ten years ago)

aminu somehow interesting now

J0rdan S., Wednesday, 22 April 2015 03:40 (ten years ago)

did rondo just get straight benched tonight? i'm not watching but he's played ten minutes, has 4 points and an assist.

Clay, Wednesday, 22 April 2015 03:57 (ten years ago)

well he has 4 fouls but they've been utterly baffling and boneheaded fouls

J0rdan S., Wednesday, 22 April 2015 03:57 (ten years ago)

man a totally anonymous dirk game tonight

J0rdan S., Wednesday, 22 April 2015 03:57 (ten years ago)

sorta feel like the rockets could crash the west finals

J0rdan S., Wednesday, 22 April 2015 03:58 (ten years ago)

barea's been dallas' best player :---[

J0rdan S., Wednesday, 22 April 2015 04:00 (ten years ago)

how much money will the lakers throw at rondo this summer vs how much is he actually worth

Clay, Wednesday, 22 April 2015 04:00 (ten years ago)

mavs shd consider guarding that dwight lob

lag∞n, Wednesday, 22 April 2015 04:00 (ten years ago)

josh smith point god

lag∞n, Wednesday, 22 April 2015 04:03 (ten years ago)

josh was always an underrated passer

Heez, Wednesday, 22 April 2015 04:09 (ten years ago)

Rox look pretty good. Def a threat

#wegonnabechampionship (Spottie), Wednesday, 22 April 2015 07:03 (ten years ago)

josh smith/rondo column by woj is so depressing http://yhoo.it/1Gi225U

slothroprhymes, Wednesday, 22 April 2015 11:59 (ten years ago)

it does feel like all the new logos are pushing bballs on us

http://i.imgur.com/8mOsERm.png

micah, Wednesday, 22 April 2015 12:12 (ten years ago)

Someone forgot to multiply.

Allen (etaeoe), Wednesday, 22 April 2015 12:20 (ten years ago)

how much money will the lakers throw at rondo this summer vs how much is he actually worth

Honestly, I would not be shocked if Rondo did not have a job next year. I miss Rondo. :,(

Allen (etaeoe), Wednesday, 22 April 2015 12:22 (ten years ago)

Mirotic unlikely for Thursday's Game 3

:|

Allen (etaeoe), Wednesday, 22 April 2015 12:23 (ten years ago)

in a world where dellavedova and norris cole are playing meaningful playoff minutes, rondo will have no problem getting paid

k3vin k., Wednesday, 22 April 2015 13:13 (ten years ago)

someone will pick rondo up but damn he has done damage to his future earning

lag∞n, Wednesday, 22 April 2015 14:04 (ten years ago)

i dont think the rockets have any shat at beating clips/spurs shd they make it to the 2nd round imho

lag∞n, Wednesday, 22 April 2015 14:05 (ten years ago)

i mean dallas hung with them even while looking clinically depressed

lag∞n, Wednesday, 22 April 2015 14:08 (ten years ago)

/starting richard jefferson

lag∞n, Wednesday, 22 April 2015 14:08 (ten years ago)

jefferson, aminu & felton were all shockingly competent, rondo turned to shit, dirk's shot was way off

slothroprhymes, Wednesday, 22 April 2015 14:22 (ten years ago)

my mavs in 7 first round prediction is bound for a quick death

slothroprhymes, Wednesday, 22 April 2015 14:23 (ten years ago)

might take one in dallas, assuming they bench rondo, but at this pt it is a long shot. now competing for most depressing series in the playoffs imo. watch out dc & toronto

head clowning instructor (art), Wednesday, 22 April 2015 14:45 (ten years ago)

no one actually knows if dc/raps is the most depressing cause no one has seen it

lag∞n, Wednesday, 22 April 2015 14:48 (ten years ago)

xp i think rondo might get one more chance, during a home game, but if he shits the bed he'd be benched in favor of felton/barea the rest of the series, and might not even get that benefit of the doubt way things are going

slothroprhymes, Wednesday, 22 April 2015 15:03 (ten years ago)

dc at least has paul pierce actually succeeding and taunting canadians so it ekes out a slight margin of victory

slothroprhymes, Wednesday, 22 April 2015 15:03 (ten years ago)

xp after a poor showing in game one and a worse showing/benching in 4q in game 2 i think it'd be a mistake not to read the writing on the wall. rondo has checked out and i am not sure what dallas stands to gain by giving him minutes. after so many wasted games waiting for him to adapt and make an impact in the mavs' system, i say give the nod to someone who has, you know, demonstrated some kind of will to actually play.

head clowning instructor (art), Wednesday, 22 April 2015 15:33 (ten years ago)

rondo flamboyantly checked out, more like straight up protested, clearly needs to figure some stuff out, maybe go to australia over the offseason

lag∞n, Wednesday, 22 April 2015 15:35 (ten years ago)

go hoop it up w meta in italy or something

head clowning instructor (art), Wednesday, 22 April 2015 15:41 (ten years ago)

feels like he might benefit from a crazy mentor

head clowning instructor (art), Wednesday, 22 April 2015 15:41 (ten years ago)

couldnt we all u know

lag∞n, Wednesday, 22 April 2015 15:43 (ten years ago)

maybe he could go be malcontented alongside boogie on the kings

slothroprhymes, Wednesday, 22 April 2015 15:58 (ten years ago)

sac has spoken of interest in him as i recall. feel like he and karl wld prob not mesh v well

head clowning instructor (art), Wednesday, 22 April 2015 15:58 (ten years ago)

ofc the goodness of fit has no bearing on whether vivek brings him on board

head clowning instructor (art), Wednesday, 22 April 2015 16:02 (ten years ago)

lol very true

slothroprhymes, Wednesday, 22 April 2015 16:03 (ten years ago)

jason kidd could prob contain that personality but i dont think rondo would be a great fit for the bucks, plus they seem committed to MCW thus far

slothroprhymes, Wednesday, 22 April 2015 16:04 (ten years ago)

rondo to knicks/lakers just seem like perfect bedfellows at this point. those teams will need to attract desperate or otherwise unwanted players, and which teams are really gonna want rondo?

J0rdan S., Wednesday, 22 April 2015 16:12 (ten years ago)

the ones where inept ownership/front office doesnt consider the coaches opinion slash teams desperate for any warm body. Knicks maybe longer shot now that Jackson is ostensibly running the show. wld guess kings, lakers (b/c Kobe), maybe brooklyn, maybe Denver. there's plenty of poorly run outfits that might ignore historical precedent and bring him in

head clowning instructor (art), Wednesday, 22 April 2015 16:18 (ten years ago)

if he found fault with rick carlisle's opinions i can't wait to see how he screams at byron fucking scott

slothroprhymes, Wednesday, 22 April 2015 16:25 (ten years ago)

if scott lets him control the offense they'd get along fine, not sure that's in the lakers best interest but it's what rondo needs to succeed to whatever extent bball success is still a possibility for him

head clowning instructor (art), Wednesday, 22 April 2015 16:31 (ten years ago)

most likely outcome imo rondo sings a one year deal for backup money and tries to rehab his game/rep

lag∞n, Wednesday, 22 April 2015 16:54 (ten years ago)

no way

J0rdan S., Wednesday, 22 April 2015 17:31 (ten years ago)

whos gonna pay him hes terrible and a cancer

lag∞n, Wednesday, 22 April 2015 17:56 (ten years ago)

and the league is filthy w quality point guards

lag∞n, Wednesday, 22 April 2015 17:57 (ten years ago)

Sactown

juice college (agent hibachi), Wednesday, 22 April 2015 18:02 (ten years ago)

Also the lakers seem to be dying to pay anybody this summer

juice college (agent hibachi), Wednesday, 22 April 2015 18:03 (ten years ago)

ya i mean there are a couple teams who wld maybe do it but what if they dont! or if they realize theyre competing against no one for his services

lag∞n, Wednesday, 22 April 2015 18:04 (ten years ago)

wld be pretty amazing if kobes last meaningful act as a player was to max rondo out

lag∞n, Wednesday, 22 April 2015 18:05 (ten years ago)

no one actually knows if dc/raps is the most depressing cause no one has seen it

― lag∞n, Wednesday, April 22, 2015 10:48 AM (2 hours ago) Bookmark Flag Post Permalink

btw I was so OTM when I predicted that it would be nu-hawks/magic and be relegated to NBATV

k3vin k., Wednesday, 22 April 2015 18:06 (ten years ago)

sad how toronto lost two at home. those fans were so ready and the team just wet the bed

#wegonnabechampionship (Spottie), Wednesday, 22 April 2015 18:09 (ten years ago)

they the north

lag∞n, Wednesday, 22 April 2015 18:12 (ten years ago)

pumped 4 spurs clips tonight

#wegonnabechampionship (Spottie), Wednesday, 22 April 2015 18:27 (ten years ago)

same

lag∞n, Wednesday, 22 April 2015 18:31 (ten years ago)

yes very excite

k3vin k., Wednesday, 22 April 2015 18:49 (ten years ago)

it seems possible that the raptors don't actually have any good players, not sure what's going on there

J0rdan S., Wednesday, 22 April 2015 19:01 (ten years ago)

Dion Waiters has played 3 NBA seasons. His coach has been fired at the end of each one.

^_____^

polyphonic, Wednesday, 22 April 2015 19:03 (ten years ago)

lol

lag∞n, Wednesday, 22 April 2015 19:13 (ten years ago)

V consistent

juice college (agent hibachi), Wednesday, 22 April 2015 19:41 (ten years ago)

he can't sustain that level

A True White Kid that can Jump (Granny Dainger), Wednesday, 22 April 2015 19:58 (ten years ago)

I realized yesterday that there is a significant chance that someone pays Enes Kanter near-max money.

Matt Armstrong, Wednesday, 22 April 2015 20:00 (ten years ago)

@ESPNSteinLine: ESPN sources says Mavs are ruling out Rajon Rondo indefinitely after back injury he sustained in Game 2

yeah rondo's never putting on a mavs uni again

J0rdan S., Wednesday, 22 April 2015 20:01 (ten years ago)

I realized yesterday that there is a significant chance that someone pays Enes Kanter near-max money.

― Matt Armstrong, Wednesday, April 22, 2015 4:00 PM (51 seconds ago) Bookmark

kanter is bad imo. whatever he gets on offense he gives back on defense.

J0rdan S., Wednesday, 22 April 2015 20:02 (ten years ago)

The numbers back that up, but the exploding cap and his rare scoring talent means someone might go totally nuts in an effort to prevent OKC from matching.

Matt Armstrong, Wednesday, 22 April 2015 20:03 (ten years ago)

Kanter is also a headcase who does really weird shit and seems to be an awful teammate, just to complete the package

Matt Armstrong, Wednesday, 22 April 2015 20:04 (ten years ago)

god, Kanter averaged 22-13-1 for OKC on 57% shooting

Matt Armstrong, Wednesday, 22 April 2015 20:06 (ten years ago)

per 36

Matt Armstrong, Wednesday, 22 April 2015 20:06 (ten years ago)

It's hard for me to believe that he can't be a productive player if Kevin Love and Al Jefferson can, but maybe the defense really is next level bad.

Matt Armstrong, Wednesday, 22 April 2015 20:09 (ten years ago)

kanter sucks, and presti being lauded for bringing on a freaky big man who's a defensive turnstile and has personality issues/irrational confidence that he doesn't back up baffled me.

slothroprhymes, Wednesday, 22 April 2015 20:11 (ten years ago)

on some simmons podcast either him or lowe was saying that the thunder might think they can bring kanter back and it will be ok with ibaka fortifying the back line but paying $50 something million or whatever to a guy who can only play if another dude is on the floor sounds terrible and i doubt presti will do it

J0rdan S., Wednesday, 22 April 2015 20:11 (ten years ago)

i mean if the thunder traded harden because he wanted $50 million and they would only give him $44 and then they turn around and give that money to enes kanter.... i dunno man

J0rdan S., Wednesday, 22 April 2015 20:12 (ten years ago)

xp re rondo's back, prob let the door hit him on his way out of town

head clowning instructor (art), Wednesday, 22 April 2015 20:12 (ten years ago)

@ESPNSteinLine: ESPN sources says Mavs are ruling out Rajon Rondo indefinitely after back injury he sustained in Game 2

yeah rondo's never putting on a mavs uni again

― J0rdan S., Wednesday, April 22, 2015 4:01 PM (23 minutes ago) Bookmark Flag Post Permalink

damnnnn

lag∞n, Wednesday, 22 April 2015 20:25 (ten years ago)

sitting rondo prob wise rn

Giant Purple Wakerobin (Aimless), Wednesday, 22 April 2015 20:28 (ten years ago)

on some simmons podcast either him or lowe was saying that the thunder might think they can bring kanter back and it will be ok with ibaka fortifying the back line but paying $50 something million or whatever to a guy who can only play if another dude is on the floor sounds terrible and i doubt presti will do it

― J0rdan S., Wednesday, April 22, 2015 8:11 PM (25 minutes ago) Bookmark Flag Post Permalink

he's also 22 or whatever so you could hope that he'd become at least somewhat responsible on defense.

Favors is good on defense and Gobert is great and the Jazz could never figure out a way to cover for Kanter so...

Matt Armstrong, Wednesday, 22 April 2015 20:38 (ten years ago)

chandler also out for good, rip mavs :[

slothroprhymes, Wednesday, 22 April 2015 20:40 (ten years ago)

his jazz teammates seem to really dislike him, like im not sure ive seen so many ex teammates go out of their way to talk shit before

lag∞n, Wednesday, 22 April 2015 20:41 (ten years ago)

yeah when you're on Gordon Hayward's shitlist...

Matt Armstrong, Wednesday, 22 April 2015 20:44 (ten years ago)

haha

#wegonnabechampionship (Spottie), Wednesday, 22 April 2015 20:45 (ten years ago)

Big men get paid tho guarantee someone throws max or damn close to it at him

juice college (agent hibachi), Wednesday, 22 April 2015 21:39 (ten years ago)

I mean ilh knows brook Lopez is secretly not that bad at defense but most ppl don't and even if you're a dummy gm u probably think enes kanter is basically blopez without the chronic injuries and thus why not chuck big money at him

juice college (agent hibachi), Wednesday, 22 April 2015 21:41 (ten years ago)

there's zero chance some gm looks at his age and 22 & 13 or whatever and doesn't start wildly writing checks for near max money

Clay, Wednesday, 22 April 2015 21:44 (ten years ago)

Carlisle said Parsons is out for the rest of this season.

polyphonic, Wednesday, 22 April 2015 21:45 (ten years ago)

that contract is paying off eh

#wegonnabechampionship (Spottie), Wednesday, 22 April 2015 21:46 (ten years ago)

Do you expect Rajon Rondo to ever wear a Mavericks uniform again? "No, I don't," Rick Carlisle said.

polyphonic, Wednesday, 22 April 2015 21:47 (ten years ago)

seriously!?

#wegonnabechampionship (Spottie), Wednesday, 22 April 2015 21:47 (ten years ago)

wow he is mad @rondo

lag∞n, Wednesday, 22 April 2015 21:47 (ten years ago)

Carlisle/Rondo thing I am so intrigued by, like true detective season 2 should be about them and not dark highway guys

Clay, Wednesday, 22 April 2015 21:49 (ten years ago)

I just want the interview cops from td1 to have scenes where they ask rondo and carlisle, separately, why they hate each other, and for our heroes to drip venom about the other

Clay, Wednesday, 22 April 2015 21:50 (ten years ago)

wld stream

lag∞n, Wednesday, 22 April 2015 21:51 (ten years ago)

Rondo has an injury apparently

polyphonic, Wednesday, 22 April 2015 21:51 (ten years ago)

lollll lagoon (or someone else graphically inclined) please make a photoshop poster of that xps

slothroprhymes, Wednesday, 22 April 2015 21:52 (ten years ago)

I just want the interview cops from td1 to have scenes where they ask rondo and carlisle, separately, why they hate each other, and for our heroes to drip venom about the other

― Clay, Wednesday, April 22, 2015 5:50 PM (1 minute ago) Bookmark Flag Post Permalink

but then they team up against a common enemy right?

right???????

slothroprhymes, Wednesday, 22 April 2015 21:53 (ten years ago)

I guess at the end of the day I just want honest books of interviews about NBA feuds, this is hugely important to me but our journalists aren't up to the task, guess we get the world we deserve after all

Clay, Wednesday, 22 April 2015 21:53 (ten years ago)

we get the passive aggressive wojo columns we derserve

lag∞n, Wednesday, 22 April 2015 21:55 (ten years ago)

but then they team up against a common enemy right?

right???????

yes but the common enemy is sub .400 shooting from the line boom roasted

Clay, Wednesday, 22 April 2015 21:56 (ten years ago)

*cries*

slothroprhymes, Wednesday, 22 April 2015 22:03 (ten years ago)

Rick Carlisle is sassy I like it

Did anyone actually see rondos 8'second violation last night? I missed it

juice college (agent hibachi), Wednesday, 22 April 2015 23:04 (ten years ago)

where are all the posts about this big hawks nets game j/k

Clay, Wednesday, 22 April 2015 23:44 (ten years ago)

im watching it / trying to stay awake and i dont think the arena is even at capacity for this terrible game. poor hawks

head clowning instructor (art), Wednesday, 22 April 2015 23:53 (ten years ago)

hawks just scored after 5.5 minute drought

head clowning instructor (art), Wednesday, 22 April 2015 23:55 (ten years ago)

sure wish any other team was playing rn

head clowning instructor (art), Wednesday, 22 April 2015 23:57 (ten years ago)

memphis and the half-blazers about to tip

Clay, Thursday, 23 April 2015 00:05 (ten years ago)

oh some jag just bought the hawks for $850 million i see

Clay, Thursday, 23 April 2015 00:06 (ten years ago)

Jami Gertz's husband

polyphonic, Thursday, 23 April 2015 00:07 (ten years ago)

ah sweet another bigtime private equity guy, love it

Clay, Thursday, 23 April 2015 00:09 (ten years ago)

one of the color guys for this grizz game just referred to a successful shot as a 'deuce'. pls no

head clowning instructor (art), Thursday, 23 April 2015 00:13 (ten years ago)

just checked the score of nets-hawks, gonna go out on a limb & say the most boring parts of the red sox game I'm watching while I wait for spurstime will be notably less boring than nets-hawks

slothroprhymes, Thursday, 23 April 2015 00:29 (ten years ago)

(will prob check on the blaze tho)

slothroprhymes, Thursday, 23 April 2015 00:31 (ten years ago)

This nets Hawks game is actually fine, I remembered I coul d see the local feed even tho I have no NBA TV so I'm flipping back and forth, it's fine acceptable basketball being played reasonably hard

juice college (agent hibachi), Thursday, 23 April 2015 00:37 (ten years ago)

I also just learned that Elton brands favorite tv show is curb your enthusiasm

juice college (agent hibachi), Thursday, 23 April 2015 00:37 (ten years ago)

I also just learned that Elton brand is on the Hawks

juice college (agent hibachi), Thursday, 23 April 2015 00:38 (ten years ago)

the nets are just so dire, I will def watch the hawks vs whoever they face in round 2 bc even wash would be a more compelling opponent

slothroprhymes, Thursday, 23 April 2015 00:41 (ten years ago)

Lol joe Johnson just wedgied a 3 and Ian eagle got mad hyped

juice college (agent hibachi), Thursday, 23 April 2015 01:16 (ten years ago)

the annual jarret jack playoff gaeme

lettered and hapful (symsymsym), Thursday, 23 April 2015 01:19 (ten years ago)

lol dwill

lettered and hapful (symsymsym), Thursday, 23 April 2015 01:28 (ten years ago)

blazers are so depressing, total lost season

k3vin k., Thursday, 23 April 2015 01:40 (ten years ago)

gonna lose lma, matthews lord only knows what becomes of him

Clay, Thursday, 23 April 2015 01:42 (ten years ago)

lillard might have a westbrookian year in 16-17 while shooting like 30% from the field

Clay, Thursday, 23 April 2015 01:43 (ten years ago)

Do tell abt lma?

brosario nawson (m bison), Thursday, 23 April 2015 01:43 (ten years ago)

The Spurs accepted (the) risk (of not locking up Kawhi Leonard to an extension last summer) because waiting to bump up Leonard’s salary gives them the chance to dangle max cap space in front of Marc Gasol and LaMarcus Aldridge this summer. Neither is a good bet to leave his current team, but sources around the league have been saying for weeks that the Spurs might get a hearing with Aldridge — and that was before the Oregonian reported that at least one Blazers player thinks there is only a 50-50 chance that Aldridge stays in Portland.

enjoy!

Clay, Thursday, 23 April 2015 01:48 (ten years ago)

i mean im def interested as a fan, but im a bit skeptical given his track record of saying he'd like to stay in portland. spurs have never made free agent plays that big and succeeded.

brosario nawson (m bison), Thursday, 23 April 2015 02:33 (ten years ago)

I think he probably stays honestly, I'm just v bearish on this squad since Wes went down

Clay, Thursday, 23 April 2015 02:35 (ten years ago)

i think the spurs with max room can obv sell themselves on championship peidgree and "The System" and a nucleus of some good young pieces (well, two) plus a year or two of tim duncan. lma on the spurs would be sick and definitely open the championship window with kawhi another handful of years. but hes talked about pdx legacy shit and i cant hate on that at all.

brosario nawson (m bison), Thursday, 23 April 2015 02:44 (ten years ago)

DAJ still owning the spurs in the paint, v defensive game so far

brosario nawson (m bison), Thursday, 23 April 2015 02:47 (ten years ago)

yo tim duncan has 8 pts on 4/4 and it hasnt even been 5 minutes yet

brosario nawson (m bison), Thursday, 23 April 2015 02:50 (ten years ago)

duncan's not retiring after this year? i thought i'd seen a report that said he was but it could just be talk. xps

Clay, Thursday, 23 April 2015 02:51 (ten years ago)

he was basically saying he would play as long as he feels like he could contribute which should be another 10 years or so

brosario nawson (m bison), Thursday, 23 April 2015 02:52 (ten years ago)

i would honestly be v surprised if tim retired after this year. he still has so much game and has been fairly durable with this reduced minutes.

brosario nawson (m bison), Thursday, 23 April 2015 02:53 (ten years ago)

lol boris trying to pick up the charge and blake just dribbling around him

lag∞n, Thursday, 23 April 2015 02:53 (ten years ago)

harlan came to play tonight

Clay, Thursday, 23 April 2015 02:54 (ten years ago)

spurs seem a lil more dialed in on D tonight

lag∞n, Thursday, 23 April 2015 02:55 (ten years ago)

kawhi working around screens is like listening to satie

brosario nawson (m bison), Thursday, 23 April 2015 02:56 (ten years ago)

this series >>>>>>>>>>>>>

k3vin k., Thursday, 23 April 2015 02:56 (ten years ago)

BORIS HEAT CHECK

brosario nawson (m bison), Thursday, 23 April 2015 02:57 (ten years ago)

lol boris

k3vin k., Thursday, 23 April 2015 02:57 (ten years ago)

remember when dre jordan was a pointless basketball player

lag∞n, Thursday, 23 April 2015 02:58 (ten years ago)

like two years ago

lag∞n, Thursday, 23 April 2015 02:58 (ten years ago)

god the clips punish you off misses, spurs transition d still lookina little lost

brosario nawson (m bison), Thursday, 23 April 2015 02:58 (ten years ago)

gonna be intereting to see how doc substitutes

k3vin k., Thursday, 23 April 2015 02:59 (ten years ago)

lol red mamba calling traveling on the bench

k3vin k., Thursday, 23 April 2015 02:59 (ten years ago)

do i see joey crawford covering this game?

brosario nawson (m bison), Thursday, 23 April 2015 02:59 (ten years ago)

ha yeah he's there

k3vin k., Thursday, 23 April 2015 02:59 (ten years ago)

beautiful, this game is already feeling classic

brosario nawson (m bison), Thursday, 23 April 2015 03:00 (ten years ago)

duncan never been down 0-2 in the first round his entire career

lag∞n, Thursday, 23 April 2015 03:01 (ten years ago)

hes playing like the doesnt plan to start today

brosario nawson (m bison), Thursday, 23 April 2015 03:02 (ten years ago)

matt barnes doing the classic clothesline

brosario nawson (m bison), Thursday, 23 April 2015 03:02 (ten years ago)

(btw i kinda feel like that should be a flagrant 1)

brosario nawson (m bison), Thursday, 23 April 2015 03:03 (ten years ago)

ballmer going w the tee over collar is a great look for him

lag∞n, Thursday, 23 April 2015 03:03 (ten years ago)

ya thats prob a flagrant

lag∞n, Thursday, 23 April 2015 03:03 (ten years ago)

or not

lag∞n, Thursday, 23 April 2015 03:04 (ten years ago)

home cookin

brosario nawson (m bison), Thursday, 23 April 2015 03:05 (ten years ago)

kawhi hitting that midrange tonight, its on and poppin

brosario nawson (m bison), Thursday, 23 April 2015 03:05 (ten years ago)

i worry about daj sometimes, he is very excited about everything that he does

brosario nawson (m bison), Thursday, 23 April 2015 03:07 (ten years ago)

wow chris paul shoving marco midjump he is such an asssssssssss

brosario nawson (m bison), Thursday, 23 April 2015 03:08 (ten years ago)

cp3 shredding spurs pressure w the clips bench in

lag∞n, Thursday, 23 April 2015 03:08 (ten years ago)

spurs played p great and are only up 4 so thats this series then

brosario nawson (m bison), Thursday, 23 April 2015 03:09 (ten years ago)

ballmer going w the tee over collar is a great look for him

― lag∞n, Wednesday, April 22, 2015 8:03 PM (6 minutes ago) Bookmark Flag Post Permalink

this look could reasonably be called "the ballmer" don't think anyone would object

Clay, Thursday, 23 April 2015 03:10 (ten years ago)

splitter is so good at defending the midrange jumper. nothing fancy, just good feet and well timed jumping and a hand in the face.

brosario nawson (m bison), Thursday, 23 April 2015 03:14 (ten years ago)

clips have v little interest in contesting diaws 3pt shot

lag∞n, Thursday, 23 April 2015 03:14 (ten years ago)

crawford lol smh

lag∞n, Thursday, 23 April 2015 03:16 (ten years ago)

he will eventually make them pay for that xp

brosario nawson (m bison), Thursday, 23 April 2015 03:17 (ten years ago)

lol every time rivers jr touches the ball i think of blakes impression so otm

lag∞n, Thursday, 23 April 2015 03:18 (ten years ago)

eh idk hes already missed 7 in a row digging himself a hole xp

lag∞n, Thursday, 23 April 2015 03:19 (ten years ago)

love blakes passing so heads up no hesitation

lag∞n, Thursday, 23 April 2015 03:22 (ten years ago)

REGRESS TO THE MEAN, BORIS

brosario nawson (m bison), Thursday, 23 April 2015 03:23 (ten years ago)

MANU ESTA LISTO

brosario nawson (m bison), Thursday, 23 April 2015 03:24 (ten years ago)

have to put paul back in now

k3vin k., Thursday, 23 April 2015 03:24 (ten years ago)

clips actually doin aight w/o him

brosario nawson (m bison), Thursday, 23 April 2015 03:25 (ten years ago)

yeah you can't expect it to last tho

k3vin k., Thursday, 23 April 2015 03:27 (ten years ago)

PLAYOFF BELINELLI BALL

brosario nawson (m bison), Thursday, 23 April 2015 03:32 (ten years ago)

italian robbery!

slothroprhymes, Thursday, 23 April 2015 03:32 (ten years ago)

the italian job

lag∞n, Thursday, 23 April 2015 03:33 (ten years ago)

MARCO HULKIN OUT ON BLAKE just kidding that fool flopped

brosario nawson (m bison), Thursday, 23 April 2015 03:33 (ten years ago)

were they just comparing duncan to a prius

slothroprhymes, Thursday, 23 April 2015 03:35 (ten years ago)

want to see kawhi on cp3 fascinating matchup give it to us

lag∞n, Thursday, 23 April 2015 03:36 (ten years ago)

v nice video footage of tim rubbing kawhi's chest for comfort, he has good parental instincts

brosario nawson (m bison), Thursday, 23 April 2015 03:38 (ten years ago)

griffin dominating this series

lag∞n, Thursday, 23 April 2015 03:40 (ten years ago)

insane pass barnes blew the finish tho

lag∞n, Thursday, 23 April 2015 03:40 (ten years ago)

yo somone needs to out a body on duncan but dre doesnt want to be in foul trouble cause of the clips garbage bench

lag∞n, Thursday, 23 April 2015 03:42 (ten years ago)

timmy exposing DAJ this half

brosario nawson (m bison), Thursday, 23 April 2015 03:44 (ten years ago)

timmy has made some tough shots tbf

k3vin k., Thursday, 23 April 2015 03:47 (ten years ago)

clips have taken 2 FTs

k3vin k., Thursday, 23 April 2015 03:48 (ten years ago)

surprised cp3 hasn't worked some of his savvy vet magic to get to the line more

slothroprhymes, Thursday, 23 April 2015 03:51 (ten years ago)

you mean the crawford-patented flail your legs after a j and draw contact move? he and reddick have both tried it.

brosario nawson (m bison), Thursday, 23 April 2015 03:53 (ten years ago)

glad refs seem to have not fallen for it

slothroprhymes, Thursday, 23 April 2015 03:59 (ten years ago)

yeah me too, crawford esp likes to do that while taking threes it is basically legal cheating imo

brosario nawson (m bison), Thursday, 23 April 2015 04:00 (ten years ago)

clippers court is so pretty

J0rdan S., Thursday, 23 April 2015 04:01 (ten years ago)

tim duncan is one of those big ass trees in lord of the rings

brosario nawson (m bison), Thursday, 23 April 2015 04:02 (ten years ago)

lol reggie just had a spectacularly incoherent monologue where he said he grew up watching karl malone he was on the dream team and blake griffins key weapon is his size

lag∞n, Thursday, 23 April 2015 04:02 (ten years ago)

spurs up 10...

brosario nawson (m bison), Thursday, 23 April 2015 04:03 (ten years ago)

danger zone

lag∞n, Thursday, 23 April 2015 04:04 (ten years ago)

kawhiway to the danger zone

brosario nawson (m bison), Thursday, 23 April 2015 04:05 (ten years ago)

unbelievable we might have a 1-1 series on our hands

Clay, Thursday, 23 April 2015 04:05 (ten years ago)

spurs big men should stop contesting dunks

J0rdan S., Thursday, 23 April 2015 04:05 (ten years ago)

that reminds me that aron baynes has played 0 minutes, bout to get a DNP-DEAD

brosario nawson (m bison), Thursday, 23 April 2015 04:06 (ten years ago)

baynes has no places in this series too srs

lag∞n, Thursday, 23 April 2015 04:07 (ten years ago)

too australian

slothroprhymes, Thursday, 23 April 2015 04:08 (ten years ago)

i remember that one time he scored 10 pts against potland, that was tight

brosario nawson (m bison), Thursday, 23 April 2015 04:08 (ten years ago)

tony parker having a low key terrible game

brosario nawson (m bison), Thursday, 23 April 2015 04:09 (ten years ago)

THIS IS WAR

slothroprhymes, Thursday, 23 April 2015 04:09 (ten years ago)

oh man this is the best

slothroprhymes, Thursday, 23 April 2015 04:10 (ten years ago)

cp can't get to the rim on kawahi

J0rdan S., Thursday, 23 April 2015 04:10 (ten years ago)

clippers just missed like 25 shots in 1 min

lag∞n, Thursday, 23 April 2015 04:10 (ten years ago)

this fn common ad what did we do to deserve it

lag∞n, Thursday, 23 April 2015 04:11 (ten years ago)

i feel weird because i def hate the lakers and mavs more historically, but i hate them like i hate wrestling heels. i find myself hating the clips like i hate certain distant relatives.

brosario nawson (m bison), Thursday, 23 April 2015 04:13 (ten years ago)

xp we gave him an oscar thats what

brosario nawson (m bison), Thursday, 23 April 2015 04:13 (ten years ago)

lol xp

lag∞n, Thursday, 23 April 2015 04:14 (ten years ago)

oh man that stepback cp3

k3vin k., Thursday, 23 April 2015 04:16 (ten years ago)

how do you even do that going to your right

k3vin k., Thursday, 23 April 2015 04:16 (ten years ago)

reggie just called cp3's arm a chicken wing

slothroprhymes, Thursday, 23 April 2015 04:16 (ten years ago)

chicken wing just refers to the pushoff

k3vin k., Thursday, 23 April 2015 04:16 (ten years ago)

boris!!

slothroprhymes, Thursday, 23 April 2015 04:18 (ten years ago)

lol dre does some extravagant goal tends

lag∞n, Thursday, 23 April 2015 04:19 (ten years ago)

im convinced boris could play a whole game running backwards. i think he will do it once he enters his avant garde phase in his late 30s.

brosario nawson (m bison), Thursday, 23 April 2015 04:19 (ten years ago)

this fn common ad what did we do to deserve it

― lag∞n, Wednesday, April 22, 2015 9:11 PM (6 minutes ago) Bookmark Flag Post Permalink

i was gonna say

Clay, Thursday, 23 April 2015 04:19 (ten years ago)

not sure whats funnier, clips getting rocked in the first round again or ilh watching the spurs lose

micah, Thursday, 23 April 2015 04:20 (ten years ago)

why does a celeb even need to implore me to watch more basketball, i am already watching basketball and i also know there is more tomorrow, i'd rather learn about taco bell's wonderful new breakfast options

Clay, Thursday, 23 April 2015 04:20 (ten years ago)

griffin is a better passer than most point guards

lag∞n, Thursday, 23 April 2015 04:21 (ten years ago)

taco bell is on one right now, i dont even eat anything there except bean burritos but man they are innoblazing foodtrails

brosario nawson (m bison), Thursday, 23 April 2015 04:22 (ten years ago)

why does a celeb even need to implore me to watch more basketball, i am already watching basketball and i also know there is more tomorrow, i'd rather learn about taco bell's wonderful new breakfast options
--Clay

r u a breakfast defector

slothroprhymes, Thursday, 23 April 2015 04:22 (ten years ago)

i just want 2 eat like the beard

Clay, Thursday, 23 April 2015 04:25 (ten years ago)

lol jordans lil celebration when he hits a ft

lag∞n, Thursday, 23 April 2015 04:25 (ten years ago)

wow this clippers unit is not going to be getting many stops

k3vin k., Thursday, 23 April 2015 04:30 (ten years ago)

clipper flopping outta control right now

brosario nawson (m bison), Thursday, 23 April 2015 04:30 (ten years ago)

this game bananas

lag∞n, Thursday, 23 April 2015 04:32 (ten years ago)

the return of patrick thrills. *lakersdouche.gif* playoffs baby

brosario nawson (m bison), Thursday, 23 April 2015 04:33 (ten years ago)

lakers guy looks like paul giamatti's brother or something

slothroprhymes, Thursday, 23 April 2015 04:36 (ten years ago)

JFC DOC HAVE A DRINK OF WATER your shot to shit voice is so grating

slothroprhymes, Thursday, 23 April 2015 04:37 (ten years ago)

what is doc doing with this lineup!!!

k3vin k., Thursday, 23 April 2015 04:37 (ten years ago)

lol spurs straight up not guarding rivers even when he has the ball

lag∞n, Thursday, 23 April 2015 04:37 (ten years ago)

k3vin k.
Posted: April 23, 2015 at 12:37:23 AM
what is doc doing with this lineup!!!

crazy

lag∞n, Thursday, 23 April 2015 04:38 (ten years ago)

spurs missing some bunnies right now, gotta extend this lead while the starters are out

brosario nawson (m bison), Thursday, 23 April 2015 04:39 (ten years ago)

timmy continues to hit v difficult shots

k3vin k., Thursday, 23 April 2015 04:41 (ten years ago)

timmy winning this game singlehandedly

lag∞n, Thursday, 23 April 2015 04:41 (ten years ago)

he turns 39 on Saturday

slothroprhymes, Thursday, 23 April 2015 04:42 (ten years ago)

lol harlan just lost his shit on that kawhi bucket

slothroprhymes, Thursday, 23 April 2015 04:47 (ten years ago)

nice shot

lag∞n, Thursday, 23 April 2015 04:47 (ten years ago)

kawhi just ate jj reddick like cut him into pieces and devoured him

brosario nawson (m bison), Thursday, 23 April 2015 04:49 (ten years ago)

clips will not die

lag∞n, Thursday, 23 April 2015 04:53 (ten years ago)

wow i have never seen a ball do that on the rim before

k3vin k., Thursday, 23 April 2015 04:57 (ten years ago)

ball cld not decide whether to lie

lag∞n, Thursday, 23 April 2015 04:58 (ten years ago)

demand new rule intentional off the ball fouls u get the ball back

lag∞n, Thursday, 23 April 2015 04:59 (ten years ago)

or the team gets to choose the shooter how bout that

lag∞n, Thursday, 23 April 2015 05:00 (ten years ago)

omg i h8 the hacka what bummer

lag∞n, Thursday, 23 April 2015 05:01 (ten years ago)

alternate idea: professional basketball players should learn how to shoot free throws

brosario nawson (m bison), Thursday, 23 April 2015 05:02 (ten years ago)

does duncan really want to be picking up his 4th foul tho

k3vin k., Thursday, 23 April 2015 05:02 (ten years ago)

wow manu fouled out

k3vin k., Thursday, 23 April 2015 05:03 (ten years ago)

harlan: that's three in a row for him
miller: well how 'bout that

lol like they're 2 dads assistant coaching an elementary school team

Clay, Thursday, 23 April 2015 05:03 (ten years ago)

brosario nawson (m bison)
Posted: April 23, 2015 at 1:02:10 AM
alternate idea: professional basketball players should learn how to shoot free throws

w/e fts r bs

lag∞n, Thursday, 23 April 2015 05:04 (ten years ago)

honestly pop has not played this well at all

k3vin k., Thursday, 23 April 2015 05:04 (ten years ago)

jamal clearly putting ideas in deandre's head

Clay, Thursday, 23 April 2015 05:06 (ten years ago)

lol

lag∞n, Thursday, 23 April 2015 05:07 (ten years ago)

the "pick the FT shooter" solution is so obvious and perfect, all off-ball fouls the team picks the shooter, who complains

k3vin k., Thursday, 23 April 2015 05:07 (ten years ago)

5 fouls on tim

k3vin k., Thursday, 23 April 2015 05:07 (ten years ago)

omg barnes is so dumb give the ball to chris

k3vin k., Thursday, 23 April 2015 05:07 (ten years ago)

gotta go at timmy now

k3vin k., Thursday, 23 April 2015 05:08 (ten years ago)

barnes taking shooting lessons from dre

lag∞n, Thursday, 23 April 2015 05:08 (ten years ago)

k3vin k.
Posted: April 23, 2015 at 1:07:12 AM
the "pick the FT shooter" solution is so obvious and perfect, all off-ball fouls the team picks the shooter, who complains

ya v elegant

lag∞n, Thursday, 23 April 2015 05:08 (ten years ago)

spurs becoming victims of lazy basketball, not sure anybody saw that coming

Clay, Thursday, 23 April 2015 05:11 (ten years ago)

this gaaaaaame got me stressed

brosario nawson (m bison), Thursday, 23 April 2015 05:11 (ten years ago)

deandre...

Clay, Thursday, 23 April 2015 05:12 (ten years ago)

wow pop is incensed

k3vin k., Thursday, 23 April 2015 05:13 (ten years ago)

duncan gassed

lag∞n, Thursday, 23 April 2015 05:13 (ten years ago)

yeah he is

brosario nawson (m bison), Thursday, 23 April 2015 05:13 (ten years ago)

buuummmmeeerrrr

slothroprhymes, Thursday, 23 April 2015 05:14 (ten years ago)

clips d is insane rn

Clay, Thursday, 23 April 2015 05:15 (ten years ago)

wow blake just shit his pants

k3vin k., Thursday, 23 April 2015 05:15 (ten years ago)

clips needed to run a play!

lag∞n, Thursday, 23 April 2015 05:16 (ten years ago)

call a to something

lag∞n, Thursday, 23 April 2015 05:16 (ten years ago)

i hate ot

micah, Thursday, 23 April 2015 05:17 (ten years ago)

blake shook

lag∞n, Thursday, 23 April 2015 05:17 (ten years ago)

ya ot is bad

lag∞n, Thursday, 23 April 2015 05:17 (ten years ago)

i'm fine with just letting chris do something here

k3vin k., Thursday, 23 April 2015 05:18 (ten years ago)

k3vin k.
Posted: April 23, 2015 at 1:07:12 AM
the "pick the FT shooter" solution is so obvious and perfect, all off-ball fouls the team picks the shooter, who complains

ya v elegant

― lag∞n, Thursday, April 23, 2015 3:08 PM

i hope you enjoy it when the market value of big men who actually put in the time+effort to learn how to shoot gets destroyed

micah, Thursday, 23 April 2015 05:18 (ten years ago)

i hope you enjoy watching joey dorsey play 35 minutes

micah, Thursday, 23 April 2015 05:19 (ten years ago)

shooting will still be valuable dont worry too much

lag∞n, Thursday, 23 April 2015 05:19 (ten years ago)

this is so intense for a rd 1 game 2

Clay, Thursday, 23 April 2015 05:20 (ten years ago)

barnes missing that tip, the blake to clips letting this slip though their fingers

lag∞n, Thursday, 23 April 2015 05:21 (ten years ago)

k3vin k.
Posted: April 23, 2015 at 1:07:12 AM
the "pick the FT shooter" solution is so obvious and perfect, all off-ball fouls the team picks the shooter, who complains

ya v elegant

― lag∞n, Thursday, April 23, 2015 3:08 PM

i hope you enjoy it when the market value of big men who actually put in the time+effort to learn how to shoot gets destroyed

― micah, Thursday, April 23, 2015 1:18 AM (1 minute ago)

naw the game is still moving toward stretch 4/5s, that's a trend that can't be stopped

k3vin k., Thursday, 23 April 2015 05:21 (ten years ago)

don't like the Spurs b team w/ gassed Duncan's chances in ot

Clay, Thursday, 23 April 2015 05:22 (ten years ago)

Patty's gotta beast rn

brosario nawson (m bison), Thursday, 23 April 2015 05:22 (ten years ago)

danny greeeeeen

slothroprhymes, Thursday, 23 April 2015 05:23 (ten years ago)

wow all ball by kawhi there tho

k3vin k., Thursday, 23 April 2015 05:23 (ten years ago)

all naww more like

lag∞n, Thursday, 23 April 2015 05:24 (ten years ago)

wow great pass redick, straight outta cp3's book

k3vin k., Thursday, 23 April 2015 05:25 (ten years ago)

trip-dub for blake

k3vin k., Thursday, 23 April 2015 05:26 (ten years ago)

naw the game is still moving toward stretch 4/5s, that's a trend that can't be stopped

― k3vin k., Thursday, April 23, 2015 3:21 PM

if anything offenses that rely on penetration and shooting have reinforced the need for a big stupid rim protector

micah, Thursday, 23 April 2015 05:27 (ten years ago)

oh my goddddd timmy

slothroprhymes, Thursday, 23 April 2015 05:27 (ten years ago)

and patty

slothroprhymes, Thursday, 23 April 2015 05:28 (ten years ago)

Spurs scrapping their way through this OT

brosario nawson (m bison), Thursday, 23 April 2015 05:28 (ten years ago)

omg i need kawaii leonard image.....

moullet, Thursday, 23 April 2015 05:28 (ten years ago)

jeez blake

k3vin k., Thursday, 23 April 2015 05:31 (ten years ago)

blake the hell

lag∞n, Thursday, 23 April 2015 05:31 (ten years ago)

juiceman goofin'

Matt Armstrong, Thursday, 23 April 2015 05:31 (ten years ago)

major display of ass-showing rn by the kia commercial star

slothroprhymes, Thursday, 23 April 2015 05:31 (ten years ago)

oh man redick that was so close

k3vin k., Thursday, 23 April 2015 05:33 (ten years ago)

o gosh

lag∞n, Thursday, 23 April 2015 05:33 (ten years ago)

WOW REDICK

k3vin k., Thursday, 23 April 2015 05:36 (ten years ago)

that man can shoot

brosario nawson (m bison), Thursday, 23 April 2015 05:36 (ten years ago)

got away with a walk i think but wow stll

k3vin k., Thursday, 23 April 2015 05:36 (ten years ago)

redick's made a couple of completely ridiculous shots for sure

Clay, Thursday, 23 April 2015 05:38 (ten years ago)

he's so huge for this team, makes that offensive so much more dynamic

brosario nawson (m bison), Thursday, 23 April 2015 05:38 (ten years ago)

patty has made some huge FTs

k3vin k., Thursday, 23 April 2015 05:38 (ten years ago)

BOUT THIS LIFE

brosario nawson (m bison), Thursday, 23 April 2015 05:39 (ten years ago)

that was an ugly ass game but i liked it

Clay, Thursday, 23 April 2015 05:39 (ten years ago)

LAGOON SO MAD RN

brosario nawson (m bison), Thursday, 23 April 2015 05:40 (ten years ago)

you are up there god

slothroprhymes, Thursday, 23 April 2015 05:40 (ten years ago)

congrats to the nba for having one competitive series

Clay, Thursday, 23 April 2015 05:40 (ten years ago)

lol seriously

k3vin k., Thursday, 23 April 2015 05:40 (ten years ago)

timmy is gonna cry I think

slothroprhymes, Thursday, 23 April 2015 05:40 (ten years ago)

LAGOON SO MAD RN

― brosario nawson (m bison), Thursday, April 23, 2015 1:40 AM (4 seconds ago) Bookmark Flag Post Permalink

what im cool man im into this series its good i want it to go seven

lag∞n, Thursday, 23 April 2015 05:40 (ten years ago)

(or he's just losing his voice)

slothroprhymes, Thursday, 23 April 2015 05:41 (ten years ago)

"worst 4th quarter of my career" duncan

moullet, Thursday, 23 April 2015 05:41 (ten years ago)

tbh tho not loving what these first two games are portending for the spurs repeat chances, parker/diaw looking dun

lag∞n, Thursday, 23 April 2015 05:42 (ten years ago)

hard to tell if the griz look really good or if the blazers are just at the nadir of their season, hard to feel out how they could look against the spurs in rd 2

Clay, Thursday, 23 April 2015 05:44 (ten years ago)

healthy griz can beat the spurs

lag∞n, Thursday, 23 April 2015 05:47 (ten years ago)

^^^ this

micah, Thursday, 23 April 2015 05:55 (ten years ago)

good game! those blake turnovers were killer

#wegonnabechampionship (Spottie), Thursday, 23 April 2015 06:21 (ten years ago)

yeah the game was sick

Nhex, Thursday, 23 April 2015 06:58 (ten years ago)

https://vine.co/v/eaTpjPYYE2I
http://s30.postimg.org/f74u11map/w_Xcwznx.png

tsrobodo, Thursday, 23 April 2015 09:04 (ten years ago)

healthy griz can beat the spurs
― lag∞n, Thursday, April 23, 2015 12:47 AM (5 hours ago) Bookmark Flag Post Permalink

No they can't

brosario nawson (m bison), Thursday, 23 April 2015 10:56 (ten years ago)

they can, but they'd be a significant dog. spurs are just much better

k3vin k., Thursday, 23 April 2015 11:59 (ten years ago)

spurs are not that good right now, parker basically out

lag∞n, Thursday, 23 April 2015 14:21 (ten years ago)

clips shdve won last night despite duncan turning the clock back

lag∞n, Thursday, 23 April 2015 14:22 (ten years ago)

i mean does anyone think the spurs resembled last years team that sliced the whole dang league up prescision style, not that they cant regain their form, theyre just not there right now

lag∞n, Thursday, 23 April 2015 14:32 (ten years ago)

They had a rough go in the first round last year too.

#wegonnabechampionship (Spottie), Thursday, 23 April 2015 14:43 (ten years ago)

yeah if they can survive this round theyll have an easier opponent in the next and maybe itll give parker and splitter time to find their form, having a hard time visualizing this team beating golden state tho, while its easy to imagine them losing to the clips or griz

lag∞n, Thursday, 23 April 2015 16:03 (ten years ago)

clips prob the only team with any shot of keeping up w the dubs, tho if its a fast paced series they wont survive via having no bench

lag∞n, Thursday, 23 April 2015 16:04 (ten years ago)

its crazy to think that if the clips had just hired doc as their coach and not gm theyd might be champ favs right now

lag∞n, Thursday, 23 April 2015 16:05 (ten years ago)

the jared dudley/spencer hawes string of moves might be one of the worst GM sequences of the last 5 years

J0rdan S., Thursday, 23 April 2015 16:12 (ten years ago)

dudley was bad luck tho. injuries

#wegonnabechampionship (Spottie), Thursday, 23 April 2015 16:12 (ten years ago)

yeah but like u trade for him he is injured and plays poorly, u know hes injured, then u pay someone a draft pick to take him off yr hands, u cld just like wait until hes not injured anymore idk

lag∞n, Thursday, 23 April 2015 16:14 (ten years ago)

there was nothing bad luck about them attaching a first round pick to jared dudley just to ship him out of town so that they could sign spencer hawes to the full MLE and then dudley immediately reverting to form

J0rdan S., Thursday, 23 April 2015 16:14 (ten years ago)

imagine how much better they wld be with duds!

lag∞n, Thursday, 23 April 2015 16:16 (ten years ago)

yea dudley is doing just fine on the bucks & seems happy, he had an interesting interview w/ lowe about the whole situation a while back like just before the ASB

slothroprhymes, Thursday, 23 April 2015 16:16 (ten years ago)

or bledsoe!

lag∞n, Thursday, 23 April 2015 16:16 (ten years ago)

i mean if they had kept dudley and he had played as well in LAC as he did this year in mil, with the way redick has played this year that would be pretty fair value

J0rdan S., Thursday, 23 April 2015 16:22 (ten years ago)

for bledsoe

J0rdan S., Thursday, 23 April 2015 16:22 (ten years ago)

yah giving away picks was dumb

#wegonnabechampionship (Spottie), Thursday, 23 April 2015 16:22 (ten years ago)

tru xp

lag∞n, Thursday, 23 April 2015 16:24 (ten years ago)

wait you're not saying dudley and redick are roughly equivalent players

k3vin k., Thursday, 23 April 2015 16:24 (ten years ago)

hes saying trading bledsoe for redick and duds is good

lag∞n, Thursday, 23 April 2015 16:25 (ten years ago)

the wiki transaction log is hilarious (even acknowledging that the trade was to allow for the MLE and not to actually acquire those guys)

August 2, 2014
To Los Angeles Clippers
Carlos Delfino, Miroslav Raduljica & 2015 second-round draft pick
To Milwaukee Bucks
Jared Dudley & 2017 conditional first-round pick

slothroprhymes, Thursday, 23 April 2015 16:26 (ten years ago)

and lagoon you are way blinded by the fact that the spurs look not great because they happen to be playing a WCF-caliber opponent in the first round, yes they are a bit banged up and no they have not looked perfect, and honestly pop has been horrible, but they are playing a great opponent. they were killing the league 2 weeks ago

this reminds me of that year the thunder rolled off 4 straight wins against the spurs and all you guys were saying they got "figured out" or weren't athletic enough, like you guys have heard of this concept of having a bad week right?

k3vin k., Thursday, 23 April 2015 16:28 (ten years ago)

they do have problems with super athletic teams!

lag∞n, Thursday, 23 April 2015 16:31 (ten years ago)

and the regular season is an illusion

lag∞n, Thursday, 23 April 2015 16:31 (ten years ago)

and lagoon you are way blinded by the fact that the spurs look not great because they happen to be playing a WCF-caliber opponent in the first round

― k3vin k., Thursday, April 23, 2015 12:28 PM (3 minutes ago) Bookmark Flag Post Permalink

this wld be a good argument if there wasnt a better team lurking out there

lag∞n, Thursday, 23 April 2015 16:32 (ten years ago)

CP takes losing well
https://vine.co/v/eaTV33EKEXi

#wegonnabechampionship (Spottie), Thursday, 23 April 2015 16:57 (ten years ago)

what if the floor cracked open and danny green fell in there cld happen

lag∞n, Thursday, 23 April 2015 17:05 (ten years ago)

https://pbs.twimg.com/media/Bp-xTmGCUAEkjrL.jpgp

im that guy, DPoY & finals MVP, under 24, like MJ and hakeem

moullet, Thursday, 23 April 2015 17:41 (ten years ago)

https://pbs.twimg.com/media/Bp-xTmGCUAEkjrL.jpg

moullet, Thursday, 23 April 2015 17:42 (ten years ago)

who the hell are you man

lag∞n, Thursday, 23 April 2015 18:21 (ten years ago)

Spurs are having trouble because (a) key rotation players are playing with injuries (tony and tiago) and (b) the clippers have been a top 3 team since the all star break (c) they played two games on the road. Guaranteeing if the spurs make it out of the 1st round they're gonna murk Houston bad.

brosario nawson (m bison), Thursday, 23 April 2015 19:54 (ten years ago)

agreed

k3vin k., Thursday, 23 April 2015 21:56 (ten years ago)

being better than houston is not that impressive!

lag∞n, Thursday, 23 April 2015 21:57 (ten years ago)

houston are alright man! dwight looks healthy

#wegonnabechampionship (Spottie), Thursday, 23 April 2015 21:58 (ten years ago)

that is very kind of you to say!

lag∞n, Thursday, 23 April 2015 21:59 (ten years ago)

being better than houston is not that impressive!

― lag∞n, Thursday, April 23, 2015 5:57 PM (5 minutes ago) Bookmark Flag Post Permalink

how about being better than the clipdawgs

slothroprhymes, Thursday, 23 April 2015 22:03 (ten years ago)

i mean u guys realize u r just agreeing w me (aside from the fact that i thought the spurs were lined up to play the griz in the second round)

lag∞n, Thursday, 23 April 2015 22:03 (ten years ago)

how about being better than the clipdawgs

― slothroprhymes, Thursday, April 23, 2015 6:03 PM (55 seconds ago) Bookmark Flag Post Permalink

yet to be seen lol

lag∞n, Thursday, 23 April 2015 22:04 (ten years ago)

griz/dubs is actually a p fascinating matchup, maybe the only team that has a chance to slow dubs pace down via gritty D and size

lag∞n, Thursday, 23 April 2015 22:06 (ten years ago)

http://blog.shaq.com/

polyphonic, Thursday, 23 April 2015 22:06 (ten years ago)

xxp i mean they inherently are, imo, but i thought you kind of were digging on/pulling for the clips bc cp3 is your dad

slothroprhymes, Thursday, 23 April 2015 22:08 (ten years ago)

the basic nature of the spurs is better than the clippers even if they have been outplayed in the first two games of a seven game series ?

lag∞n, Thursday, 23 April 2015 22:09 (ten years ago)

makes sense

lag∞n, Thursday, 23 April 2015 22:10 (ten years ago)

sorry u all are taking this the spurs are obvs not as good as last season news so hard, dont zing the messenger

lag∞n, Thursday, 23 April 2015 22:12 (ten years ago)

no i'm not denying that you said that (just dont remember it bc we post a lot and i dont feel like clicking load all messages at the moment), people are capable of objectively concluding something that they subjectively don't fully (or at all) support especially w/r/t sports

slothroprhymes, Thursday, 23 April 2015 22:13 (ten years ago)

this was mostly a joke centered around your cp3 fandom obviously the spurs arent going all the way

slothroprhymes, Thursday, 23 April 2015 22:13 (ten years ago)

literally have no idea what ur talking abt

lag∞n, Thursday, 23 April 2015 22:13 (ten years ago)

aight i'm hallucinating

slothroprhymes, Thursday, 23 April 2015 22:18 (ten years ago)

im not like contesting your claim i have no idea what it is is what im saying

lag∞n, Thursday, 23 April 2015 22:19 (ten years ago)

i was, apparently poorly, making a joking allusion to some of the ilh MVP debate & your intense chris paul argument as well as your initial pick for the series, although to be fair some of that may have been attempts to troll m. bison & i did not fully take that into account

slothroprhymes, Thursday, 23 April 2015 22:25 (ten years ago)

it was a good pick! i mean the spurs may still win this series but at the time everyone acting like they were gonna roll over the clips, everyone much closer to my opinon than they were before the series

lag∞n, Thursday, 23 April 2015 22:30 (ten years ago)

man clips really shdve gone ahead and won last night tho that game will haunt them if they lose this

lag∞n, Thursday, 23 April 2015 22:31 (ten years ago)

redicks tech hanging on the rim, blakes turnovers, redicks three in and out, brutal

lag∞n, Thursday, 23 April 2015 22:32 (ten years ago)

yeah that last redick three was the perfect open look

#wegonnabechampionship (Spottie), Thursday, 23 April 2015 22:43 (ten years ago)

I'm at tonight's Celtics and Cavs game. Boston fans, which Cleveland player would you like me to punch?

Allen (etaeoe), Thursday, 23 April 2015 22:47 (ten years ago)

redick shot was totally a coin flip thing, blake having a couple of quick meltdowns as we noted during the game itself is more of a prob

slothroprhymes, Thursday, 23 April 2015 22:47 (ten years ago)

xp I would say dellevadova but that almost seems too mean and we need kevin love so danny can make him an offer

slothroprhymes, Thursday, 23 April 2015 22:48 (ten years ago)

idk I don't really actively dislike anyone on that team

slothroprhymes, Thursday, 23 April 2015 22:51 (ten years ago)

Waiting for Kelly Olynyk to make a practice three.

Allen (etaeoe), Thursday, 23 April 2015 22:52 (ten years ago)

Iman Shumpert? Mike Miller?

Allen (etaeoe), Thursday, 23 April 2015 22:54 (ten years ago)

obv you need to merk perk

#wegonnabechampionship (Spottie), Thursday, 23 April 2015 22:55 (ten years ago)

Jonas Jerebko, what's on your iPod?

Allen (etaeoe), Thursday, 23 April 2015 22:58 (ten years ago)

xp you don't bark up that perk tree that tree will fall the fuck on you though

slothroprhymes, Thursday, 23 April 2015 23:00 (ten years ago)

I guess shump not bc I particularly want to cause him harm but bc he's a pesky 2nd unit player losing him would be a big deal...

slothroprhymes, Thursday, 23 April 2015 23:01 (ten years ago)

Have I mentioned that Lucky the Leprechaun is also a DJ?

https://m.soundcloud.com/kitackermann

Allen (etaeoe), Thursday, 23 April 2015 23:45 (ten years ago)

I'm at tonight's Celtics and Cavs game. Boston fans, which Cleveland player would you like me to punch?

― Allen (etaeoe), Thursday, April 23, 2015 6:47 PM (1 hour ago) Bookmark Flag Post Permalink

niice, bron obvs

lag∞n, Friday, 24 April 2015 00:01 (ten years ago)

the looks love in deep the eyes and say "i did it for u kevin"

lag∞n, Friday, 24 April 2015 00:03 (ten years ago)

we need to talk about kevin (playing for the celtics next season)

lag∞n, Friday, 24 April 2015 00:03 (ten years ago)

tonight is a good night for the celtics to get a win imo

lag∞n, Friday, 24 April 2015 00:11 (ten years ago)

I wouldn't want Love. But I'm not a Celtics fan.

Allen (etaeoe), Friday, 24 April 2015 00:11 (ten years ago)

its his destiny to be a celtics

lag∞n, Friday, 24 April 2015 00:13 (ten years ago)

tonight is a good night for the celtics to get a win imo
--lag∞n

they're at home, bill simmons is at the game, it could happen

slothroprhymes, Friday, 24 April 2015 00:15 (ten years ago)

CWebb subtly corrects Marv after he gets the story of how Isaiah Thomas got his name almost completely wrong

Matt Armstrong, Friday, 24 April 2015 00:15 (ten years ago)

seeing love actually score in the post has been encouraging I don't consider him quite as overrated as I did before

slothroprhymes, Friday, 24 April 2015 00:16 (ten years ago)

still a bit tho bc he's quite a headcase

slothroprhymes, Friday, 24 April 2015 00:16 (ten years ago)

rose 4 3s in 4 mins ugh why he so dum

A True White Kid that can Jump (Granny Dainger), Friday, 24 April 2015 00:17 (ten years ago)

oh great job turner flagranting bron

slothroprhymes, Friday, 24 April 2015 00:17 (ten years ago)

Not sure why they think that's such a clear flagrant

Matt Armstrong, Friday, 24 April 2015 00:18 (ten years ago)

prob that view where you see him hug bron then throw him to the ground.

head clowning instructor (art), Friday, 24 April 2015 00:19 (ten years ago)

celtics shd flagrant bron whenever they get the chance and also while theyre doing it whisper to him "u need a vacation... in miami"

lag∞n, Friday, 24 April 2015 00:20 (ten years ago)

prob that view where you see him hug bron then throw him to the ground.

I really don't think he threw him to the ground at all. He definitely fell down tho.

Matt Armstrong, Friday, 24 April 2015 00:21 (ten years ago)

I'm watching Bulls-bucks, the game of the night

Matt Armstrong, Friday, 24 April 2015 00:22 (ten years ago)

they need to adopt lebron rules asap

Allen (etaeoe), Friday, 24 April 2015 00:23 (ten years ago)

homer here and it was totally a flagrant goddamn you evan turner

slothroprhymes, Friday, 24 April 2015 00:26 (ten years ago)

I'm watching Bulls-bucks, the game of the night

― Matt Armstrong, Thursday, April 23, 2015 8:22 PM (4 minutes ago) Bookmark Flag Post Permalink

rude

lag∞n, Friday, 24 April 2015 00:27 (ten years ago)

so this cavs team is kind of bad. i still think hawks and bulls can beat them. celtics scrubs is playing them close with the cavs hustling. even if they make it to the finals, i can't imagine them not getting swept.

Allen (etaeoe), Friday, 24 April 2015 00:27 (ten years ago)

Bullies gonna lose this one I think

Matt Armstrong, Friday, 24 April 2015 00:28 (ten years ago)

duh right in line with my bulls in 5 prediction

slothroprhymes, Friday, 24 April 2015 00:35 (ten years ago)

such a weird crowd for bulls/bucks. seems 1/2 rooting for each team, but each side is driven to be louder than otherwise would be in order to try to drown out the opposing fans.

A True White Kid that can Jump (Granny Dainger), Friday, 24 April 2015 00:36 (ten years ago)

so this cavs team is kind of bad. i still think hawks and bulls can beat them. celtics scrubs is playing them close with the cavs hustling. even if they make it to the finals, i can't imagine them not getting swept.

― Allen (etaeoe), Thursday, April 23, 2015 8:27 PM (8 minutes ago) Bookmark Flag Post Permalink

same

lag∞n, Friday, 24 April 2015 00:36 (ten years ago)

haha bron does not know which basket to shoot at how dum

lag∞n, Friday, 24 April 2015 00:38 (ten years ago)

No one from the east has looked very good so far

Heez, Friday, 24 April 2015 00:40 (ten years ago)

Giannis doin things, 15 pts 15 mins

A True White Kid that can Jump (Granny Dainger), Friday, 24 April 2015 00:43 (ten years ago)

tom thibodeau looks like the penguin

head clowning instructor (art), Friday, 24 April 2015 00:44 (ten years ago)

Yo I skipped thru commercials and intros and shit to catch up, so was jelly o benched for sucking or what bc this is way more jerebko and Zeller than I expected

juice college (agent hibachi), Friday, 24 April 2015 00:44 (ten years ago)

CWebb subtly corrects Marv after he gets the story of how Isaiah Thomas got his name almost completely wrong

― Matt Armstrong, Thursday, April 23, 2015 8:15 PM (28 minutes ago) Bookmark Flag Post Permalink

:(

juice college (agent hibachi), Friday, 24 April 2015 00:47 (ten years ago)

Matt's official marv is slipping watch is one of the saddest things to me

juice college (agent hibachi), Friday, 24 April 2015 00:47 (ten years ago)

Cwebb got good practice helping out old announcers back when they paired him with Dick Stockton

juice college (agent hibachi), Friday, 24 April 2015 00:49 (ten years ago)

22-4 bucks run followed by 17-2 bulls run, fans loved and hated both

A True White Kid that can Jump (Granny Dainger), Friday, 24 April 2015 01:04 (ten years ago)

1st time Rose made me go 'wow' post-1st injury

A True White Kid that can Jump (Granny Dainger), Friday, 24 April 2015 01:37 (ten years ago)

last chance to not get swept this sunday and of course it's on network national TV

slothroprhymes, Friday, 24 April 2015 01:55 (ten years ago)

go ahead now, bucks

head clowning instructor (art), Friday, 24 April 2015 02:21 (ten years ago)

Pelis going berserk and GS can't shoot what is happening

juice college (agent hibachi), Friday, 24 April 2015 02:26 (ten years ago)

Rose playing All Star defense. Exciting stuff.

Allen (etaeoe), Friday, 24 April 2015 02:56 (ten years ago)

how many commercials must i endure my god

Clay, Friday, 24 April 2015 02:58 (ten years ago)

they want to make sure you go see age of ultron

slothroprhymes, Friday, 24 April 2015 03:07 (ten years ago)

i do not want to see it though

Clay, Friday, 24 April 2015 03:10 (ten years ago)

nola up almost 20 in the third still not convinced they have this won

head clowning instructor (art), Friday, 24 April 2015 03:20 (ten years ago)

i can confirm that you do not want to see the age of ultrons

micah, Friday, 24 April 2015 03:26 (ten years ago)

also many lols at speights trying to act tuff

micah, Friday, 24 April 2015 03:28 (ten years ago)

Wow Ryan Anderson with the game of his life

#wegonnabechampionship (Spottie), Friday, 24 April 2015 03:49 (ten years ago)

well so much for the death of ryan anderson's career

J0rdan S., Friday, 24 April 2015 03:49 (ten years ago)

yeah he's going nuts

k3vin k., Friday, 24 April 2015 03:50 (ten years ago)

Pelis bench can't miss

#wegonnabechampionship (Spottie), Friday, 24 April 2015 03:50 (ten years ago)

if the pelis somehow tie this series up i could see it getting pretty testy

Clay, Friday, 24 April 2015 03:51 (ten years ago)

Dubs offense hasn't really looked good yet in this series

#wegonnabechampionship (Spottie), Friday, 24 April 2015 03:56 (ten years ago)

i may have put a few bucks on the GS moneyline about 10 minutes ago when it was +1200 :)

k3vin k., Friday, 24 April 2015 03:57 (ten years ago)

HB!

#wegonnabechampionship (Spottie), Friday, 24 April 2015 03:58 (ten years ago)

Haven't seen enough of draymond pushing the ball up like that

#wegonnabechampionship (Spottie), Friday, 24 April 2015 03:58 (ten years ago)

Monty w sweatin

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:03 (ten years ago)

Curry can't hit

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:05 (ten years ago)

green has taken this game over and Nola can't fucking score

head clowning instructor (art), Friday, 24 April 2015 04:05 (ten years ago)

pells went super small and got killed on the boards.... somehow they have a small lineup that doesn't include ryan anderson ok

J0rdan S., Friday, 24 April 2015 04:06 (ten years ago)

all these offensive boards my goodness

head clowning instructor (art), Friday, 24 April 2015 04:07 (ten years ago)

utterly terrible clock management

Clay, Friday, 24 April 2015 04:08 (ten years ago)

somehow the pells went big but without omer asik ok

J0rdan S., Friday, 24 April 2015 04:08 (ten years ago)

montyyyy

head clowning instructor (art), Friday, 24 April 2015 04:10 (ten years ago)

omer has been p wack in his few minutes

slothroprhymes, Friday, 24 April 2015 04:10 (ten years ago)

Pels giving the dubs a taste of the switch everything defense has worked pretty well

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:13 (ten years ago)

oh ffs we're gonna have another drag ass overtime ain't we just bc dubs are thirsty for the sweep, YOULL WIN THE NEXT TWO LET BROW HAVE THIS

slothroprhymes, Friday, 24 April 2015 04:15 (ten years ago)

that was a video game pump fake by steph

Clay, Friday, 24 April 2015 04:16 (ten years ago)

lol give steph an easier shot

pelis pls

head clowning instructor (art), Friday, 24 April 2015 04:17 (ten years ago)

oh brow no u gotta hit these my man

Clay, Friday, 24 April 2015 04:17 (ten years ago)

that was a bold call

head clowning instructor (art), Friday, 24 April 2015 04:17 (ten years ago)

brow no

brow pls

head clowning instructor (art), Friday, 24 April 2015 04:18 (ten years ago)

if steph gets a shot off my heart is gonna stop while it's in the air

J0rdan S., Friday, 24 April 2015 04:18 (ten years ago)

YAAAAAAS

J0rdan S., Friday, 24 April 2015 04:19 (ten years ago)

!!!!!!!!!!!!!!!!!!!!!!

brimstead, Friday, 24 April 2015 04:19 (ten years ago)

DUDES

Clay, Friday, 24 April 2015 04:19 (ten years ago)

i'm losing my mind rn

Clay, Friday, 24 April 2015 04:19 (ten years ago)

Was siiiiick

brosario nawson (m bison), Friday, 24 April 2015 04:20 (ten years ago)

you gotta be kiddinggggg

slothroprhymes, Friday, 24 April 2015 04:20 (ten years ago)

steph is good

Clay, Friday, 24 April 2015 04:20 (ten years ago)

HE GOT FOULED TOO

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:20 (ten years ago)

brb going to visit elizabeth

head clowning instructor (art), Friday, 24 April 2015 04:21 (ten years ago)

speights after having such a horrible game redeemed himself w one rebound and kickout

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:22 (ten years ago)

lol weak offensive foul call

slothroprhymes, Friday, 24 April 2015 04:24 (ten years ago)

that fucking shot by steph

k3vin k., Friday, 24 April 2015 04:26 (ten years ago)

bogut is very uncool

J0rdan S., Friday, 24 April 2015 04:28 (ten years ago)

he gets caught doing that stuff all the time

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:29 (ten years ago)

bogut w the lucky hold

head clowning instructor (art), Friday, 24 April 2015 04:29 (ten years ago)

very bad riffing this game both ways imo

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:29 (ten years ago)

reffing

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:29 (ten years ago)

seems like several odd calls indeed

head clowning instructor (art), Friday, 24 April 2015 04:30 (ten years ago)

warriors have the best team in the league imo, their lineup flexibility is unparalleled

J0rdan S., Friday, 24 April 2015 04:30 (ten years ago)

anyone who deprives us of anthony davis flying to the rim to block a crucial playoff overtime shot is an enemy

J0rdan S., Friday, 24 April 2015 04:31 (ten years ago)

there's some great stuff on twitter at the moment of that shot but my favorite thing is this cartoonist i follow who definitely does not know a thing about basketball:

some dude in my building is SCREAMING "ohhhh my god! OH MY GOD" and i really hope it's sex-related because: lmao

Clay, Friday, 24 April 2015 04:31 (ten years ago)

wow the one time that move isn't a travel, they call it

k3vin k., Friday, 24 April 2015 04:32 (ten years ago)

boooom!

slothroprhymes, Friday, 24 April 2015 04:32 (ten years ago)

warriors on a 35-15 run

Clay, Friday, 24 April 2015 04:33 (ten years ago)

jesus get a rebound ya goofballs

Clay, Friday, 24 April 2015 04:33 (ten years ago)

feel like anderson prob shouldn't have mysteriously disappeared for the last 4 mins of the 4th quarter

J0rdan S., Friday, 24 April 2015 04:34 (ten years ago)

HOOOOME COOKIN

slothroprhymes, Friday, 24 April 2015 04:35 (ten years ago)

man

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:35 (ten years ago)

monty prob planning early for his ot rotations

head clowning instructor (art), Friday, 24 April 2015 04:36 (ten years ago)

don't mind it tho lol I want AD to have this idc how

slothroprhymes, Friday, 24 April 2015 04:36 (ten years ago)

wow horrendous call

k3vin k., Friday, 24 April 2015 04:36 (ten years ago)

lol draymond :---------D

J0rdan S., Friday, 24 April 2015 04:36 (ten years ago)

that gordon shot just what are you doing

Clay, Friday, 24 April 2015 04:37 (ten years ago)

lol at not fouling or trapping

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:37 (ten years ago)

monty bro

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:37 (ten years ago)

i know the ball leaving steph curry's hands from any point on the court is good offense but those last two shots were high difficulty looks

J0rdan S., Friday, 24 April 2015 04:37 (ten years ago)

all gordon had to do was swing the pass to AD

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:37 (ten years ago)

curry been forcing it all night

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:37 (ten years ago)

that was...not well executed no not at all

slothroprhymes, Friday, 24 April 2015 04:37 (ten years ago)

forget it clay, it's montyball

Clay, Friday, 24 April 2015 04:38 (ten years ago)

otm

slothroprhymes, Friday, 24 April 2015 04:38 (ten years ago)

wow at all these calls all night

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:40 (ten years ago)

this is a completely absurd rule

J0rdan S., Friday, 24 April 2015 04:41 (ten years ago)

so dumb

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:42 (ten years ago)

It's a fine rule, the only thing that stops hackashaq

Matt Armstrong, Friday, 24 April 2015 04:42 (ten years ago)

i need to admit to myself that my hair in the back looks like andrew bogut's and it's time for a haircut, but no, the admission will not come

Clay, Friday, 24 April 2015 04:42 (ten years ago)

wait is the rule any off-ball foul or does it have to be intentional?

k3vin k., Friday, 24 April 2015 04:42 (ten years ago)

karma for the harrison flop earlier i guess

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:42 (ten years ago)

because i thought it was the latter

k3vin k., Friday, 24 April 2015 04:42 (ten years ago)

off ball and within the last 2 minutes i think

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:43 (ten years ago)

Intentionality is irrelevant afaik, because officials can't determine that really

Matt Armstrong, Friday, 24 April 2015 04:44 (ten years ago)

wow dumb fans

#wegonnabechampionship (Spottie), Friday, 24 April 2015 04:44 (ten years ago)

nah they always remember that time they had slightly less traffic going home from a playoff game

A True White Kid that can Jump (Granny Dainger), Friday, 24 April 2015 04:46 (ten years ago)

gaaaawwwwwdddd

slothroprhymes, Friday, 24 April 2015 04:46 (ten years ago)

Intentionality is irrelevant afaik, because officials can't determine that really

― Matt Armstrong, Friday, April 24, 2015 12:44 AM (2 minutes ago)

well theoretically yes but i thought the rule was that it had to be intentional

k3vin k., Friday, 24 April 2015 04:46 (ten years ago)

there should be some leeway honestly

J0rdan S., Friday, 24 April 2015 04:47 (ten years ago)

fucking dubs man. cold blooded killers.

head clowning instructor (art), Friday, 24 April 2015 04:49 (ten years ago)

is it just on a dead ball? couldn't you still hack a shaq immediately after inbounds?

A True White Kid that can Jump (Granny Dainger), Friday, 24 April 2015 04:50 (ten years ago)

Warriors improve to 1-356 in games when down at least 20 in the 4th

tsrobodo, Friday, 24 April 2015 04:50 (ten years ago)

is it just on a dead ball? couldn't you still hack a shaq immediately after inbounds?

― A True White Kid that can Jump (Granny Dainger), Friday, April 24, 2015 12:50 AM (28 seconds ago)

hackashaq in the last 2 minutes is 2 shots and the ball

k3vin k., Friday, 24 April 2015 04:51 (ten years ago)

or is it 1 shot and the ball

k3vin k., Friday, 24 April 2015 04:52 (ten years ago)

there's very little grey area in terms of intentional fouls in the NBA. it's usually really obvious.

J0rdan S., Friday, 24 April 2015 04:52 (ten years ago)

i'm confused now

k3vin k., Friday, 24 April 2015 04:52 (ten years ago)

watching the replay again, curry got fouled by davis on that game-tying 3

k3vin k., Friday, 24 April 2015 04:54 (ten years ago)

so any off ball foul in last 2 mins?? that doesn't make sense

A True White Kid that can Jump (Granny Dainger), Friday, 24 April 2015 04:56 (ten years ago)

is it just on a dead ball? couldn't you still hack a shaq immediately after inbounds?

― A True White Kid that can Jump (Granny Dainger), Friday, April 24, 2015 12:50 AM (28 seconds ago)

hackashaq in the last 2 minutes is 2 shots and the ball

2 shots in the ball is when you foul before the ball is unfounded IIRC

Matt Armstrong, Friday, 24 April 2015 04:57 (ten years ago)

*and the ball

Matt Armstrong, Friday, 24 April 2015 04:57 (ten years ago)

Those easy offensive rebounds off of those curry misses were a great example of Iverson Value

Matt Armstrong, Friday, 24 April 2015 04:58 (ten years ago)

Whoa and I said unfounded instead of inbounded too, major zing fails sorry

Matt Armstrong, Friday, 24 April 2015 05:03 (ten years ago)

@scottcacciola Monty Williams: "We were supposed to foul" in the final seconds of regulation.

whoopsy

Clay, Friday, 24 April 2015 05:13 (ten years ago)

Well they did in a way

Matt Armstrong, Friday, 24 April 2015 05:26 (ten years ago)

shaq, chuck making me uncomfortable

A True White Kid that can Jump (Granny Dainger), Friday, 24 April 2015 05:30 (ten years ago)

up three with 8 seconds left consider fouling all im gonna say

lag∞n, Friday, 24 April 2015 05:50 (ten years ago)

also great comeback championship caliber truly the other thing im gonna say

lag∞n, Friday, 24 April 2015 05:50 (ten years ago)

feel like anderson prob shouldn't have mysteriously disappeared for the last 4 mins of the 4th quarter

― J0rdan S., Friday, April 24, 2015 12:34 AM (1 hour ago) Bookmark Flag Post Permalink

eh he took like every shot in the second half he was just gassed shdve prob gotten some rest at some point

lag∞n, Friday, 24 April 2015 05:51 (ten years ago)

he hit at least 6 impossible shots

#wegonnabechampionship (Spottie), Friday, 24 April 2015 05:56 (ten years ago)

nola up almost 20 in the third still not convinced they have this won

― head clowning instructor (art), Thursday, April 23, 2015 8:20 PM (2 hours ago) Bookmark Flag Post Permalink

#wegonnabechampionship (Spottie), Friday, 24 April 2015 06:01 (ten years ago)

was anyone

lag∞n, Friday, 24 April 2015 06:04 (ten years ago)

prob not

#wegonnabechampionship (Spottie), Friday, 24 April 2015 06:07 (ten years ago)

tom thibodeau looks like the penguin

― head clowning instructor (art), Thursday, April 23, 2015 8:44 PM (Yesterday) Bookmark

*looks both ways to see if deej is lurking* I've always thought Thibs kinda looks like middle aged deej lmao

, Friday, 24 April 2015 14:35 (ten years ago)

was anyone

Me. -__-

I checked the score in the third quarter and was all, "Whew! Don't have to tune into this one."

A-Hanisi Coates (Leee), Friday, 24 April 2015 17:03 (ten years ago)

i put 10 bucks on GS +1200 when they were down like 17 with about 10 minutes left :)

k3vin k., Friday, 24 April 2015 17:05 (ten years ago)

wow excellent foresight man

I can't do math/only barely understand betting lines how much of a payoff is that?

slothroprhymes, Friday, 24 April 2015 17:07 (ten years ago)

$120 right?

J0rdan S., Friday, 24 April 2015 17:29 (ten years ago)

+1200 means if you put down $100 you'd win win $1,200 (i think), so at $10 the win would be $120

J0rdan S., Friday, 24 April 2015 17:30 (ten years ago)

yes

k3vin k., Friday, 24 April 2015 17:53 (ten years ago)

good move kev

#wegonnabechampionship (Spottie), Friday, 24 April 2015 17:55 (ten years ago)

ha i wasn't gonna miss the 10 bucks and those odds looked nuts, figured if any team could put together a 10-minute run like that it'd be them

def made the ending even more fun lol

k3vin k., Friday, 24 April 2015 17:56 (ten years ago)

Well played k3v

I watched the first half of this game last night and thought ehh I guess I'll zip through it on the dvr early this morning and was rewarded with crazy draymond antics Steph going nuts and Monty blowing a 20 point lead and overtime at home

If they get swept Nola should really just say look I know we promised to keep you if you made the playoffs but you weren't really in the playoffs if u know what we mean and just fire him anyway

juice college (agent hibachi), Friday, 24 April 2015 18:13 (ten years ago)

Btw draymond with the push that got him fouled out just zipping across the court and into the tunnel without stopping was hysterical

Would have been even better if he just kept going thru the locker room, grabbed a bag or something and just jogged right out of the arena

juice college (agent hibachi), Friday, 24 April 2015 18:14 (ten years ago)

that was an awful call tho tbf

k3vin k., Friday, 24 April 2015 18:17 (ten years ago)

https://twitter.com/RickWelts/status/591680527561666561

polyphonic, Friday, 24 April 2015 19:22 (ten years ago)

interesting this trend continued somewhat even into the nba draft curry going 5 spots behind the legendary thabeet https://sports.yahoo.com/news/how-stephen-curry-went-from-ignored-college-recruit-to-possible-nba-mvp-011555328.html

lag∞n, Friday, 24 April 2015 19:33 (ten years ago)

it is so crazy that no one wanted him in college tho i mean he can shoot like crazy shdnt that have been enough

lag∞n, Friday, 24 April 2015 19:35 (ten years ago)

one of the ultimate examples of size bias

J0rdan S., Friday, 24 April 2015 19:56 (ten years ago)

yeah but he's not even that short. he's 6'3"!

polyphonic, Friday, 24 April 2015 20:04 (ten years ago)

looks 12 years old bias

lag∞n, Friday, 24 April 2015 20:08 (ten years ago)

hot mom bias

A-Hanisi Coates (Leee), Friday, 24 April 2015 21:01 (ten years ago)

not height, but weight

J0rdan S., Friday, 24 April 2015 22:08 (ten years ago)

in this case

J0rdan S., Friday, 24 April 2015 22:09 (ten years ago)

he is quite slight

lag∞n, Friday, 24 April 2015 22:31 (ten years ago)

have been a number of great college shooters who floundered as pros. I thought he'd be good but goddamn he is a 1st ballot HOFer, didn't see that coming.

A True White Kid that can Jump (Granny Dainger), Friday, 24 April 2015 22:37 (ten years ago)

i was very amped on him but def wld never have suspected hed win an mvp

lag∞n, Friday, 24 April 2015 22:46 (ten years ago)

tho i did repeatedly call him the next steve nash on this website iirc

lag∞n, Friday, 24 April 2015 22:47 (ten years ago)

god save antawn jamison -- 2010 regular season thread

A-Hanisi Coates (Leee), Friday, 24 April 2015 23:07 (ten years ago)

B-)

lag∞n, Friday, 24 April 2015 23:11 (ten years ago)

dang felton was in and out quick, this is yr moment devin harris

slothroprhymes, Friday, 24 April 2015 23:18 (ten years ago)

League agreed with us that curry got fouled on the game tying three last night, good job board

juice college (agent hibachi), Friday, 24 April 2015 23:32 (ten years ago)

ya that was obvs i liked that they didnt call it tho

lag∞n, Friday, 24 April 2015 23:33 (ten years ago)

I'd bet they call it super late if he missed tho

Clay, Friday, 24 April 2015 23:35 (ten years ago)

jeeesus rox shooting 71% and up 37-30 in q1

slothroprhymes, Friday, 24 April 2015 23:38 (ten years ago)

lol tru xp

lag∞n, Friday, 24 April 2015 23:40 (ten years ago)

starting to get some momentum back but dirk staaaaay missing shots :/

slothroprhymes, Friday, 24 April 2015 23:41 (ten years ago)

42 in the first and they have a six point lead wow

Clay, Friday, 24 April 2015 23:42 (ten years ago)

ya that was obvs i liked that they didnt call it tho

― lag∞n, Friday, April 24, 2015 4:33 PM (8 minutes ago) Bookmark Flag Post Permalink

agree with this even as a homer

#wegonnabechampionship (Spottie), Friday, 24 April 2015 23:44 (ten years ago)

media pushing this dwight-smith friendship on us hard since that woj column ugh can they like not

slothroprhymes, Friday, 24 April 2015 23:48 (ten years ago)

oh i didn't even know there was a clips spurs tonight excellent thank you

Clay, Friday, 24 April 2015 23:50 (ten years ago)

this got exciting in a hurry!

slothroprhymes, Friday, 24 April 2015 23:57 (ten years ago)

hubie totally pulling for the mavs like not even hiding it lol, can't blame him for supporting the heavy underdog

slothroprhymes, Friday, 24 April 2015 23:57 (ten years ago)

love jj & monta relentlessness

lag∞n, Saturday, 25 April 2015 00:06 (ten years ago)

curry going 5 spots behind the legendary thabeet

everyone seems to be forgetting that curry had glass ankles for his first several seasons w/ gsw and he looked like a talented guy who'd never survive the beating of an nba season. it is still not well-explained how he has overcome those weak ankles or if they are still lurking and ready to take him down.

Giant Purple Wakerobin (Aimless), Saturday, 25 April 2015 00:21 (ten years ago)

curry only missed significant time from the ankles in one season

lag∞n, Saturday, 25 April 2015 00:23 (ten years ago)

also not unusual for young players to grow out of non structural chronic injuries as they adjust to the league

lag∞n, Saturday, 25 April 2015 00:25 (ten years ago)

and not sure how injuries curry suffered in the nba relates to his draft placement

lag∞n, Saturday, 25 April 2015 00:27 (ten years ago)

Yeah. It only seemed like several seasons' worth of ankle/foot injuries. Here's Wikipedia on Curry's 2011-2012 season:

"In May 2011, Curry had surgery on his right ankle to repair torn ligaments he got from multiple sprains during the 2010-11 season. Curry was ready to play by the start of the lockout-shortened season with his new head coach Mark Jackson but he sprained his surgically repaired right ankle during an exhibition game at Sacramento just days before the season started. He still started the season opener vs. the Clippers, but only had 4 points on 2-12 shooting. The next game vs. the Chicago Bulls, Curry had 21 points and 10 assists to lead the Warriors to a 99-91 victory, but rolled his right ankle and missed the next game. He came back for 3 games and sprained his right ankle yet again on January 4. He returned January 20 for the next 16 games before he strained a tendon in his right foot in a game vs. the Phoenix Suns on February 22. On March 5, Curry returned vs. the Washington Wizards for 4 games before he had season ending arthroscopic surgery on his right ankle."

Giant Purple Wakerobin (Aimless), Saturday, 25 April 2015 00:31 (ten years ago)

the only interesting thing to come out of this raptors-wizards series is that otto porter has looked halfway decent and potentially like an asset

J0rdan S., Saturday, 25 April 2015 00:33 (ten years ago)

and now he's dead RIP

J0rdan S., Saturday, 25 April 2015 00:33 (ten years ago)

o well

lag∞n, Saturday, 25 April 2015 00:35 (ten years ago)

not sure how injuries curry suffered in the nba relates to his draft placement

it doesn't. the quote was more to indicate I was changing the subject back to curry's development. it wasn't well-chosen to illustrate my point, as you noted.

Giant Purple Wakerobin (Aimless), Saturday, 25 April 2015 00:38 (ten years ago)

it is still not well-explained how he has overcome those weak ankles

Obviously Steph is the Juiceman.

A-Hanisi Coates (Leee), Saturday, 25 April 2015 00:39 (ten years ago)

how dare you impugn the reputation of my baby faced dream

Clay, Saturday, 25 April 2015 00:42 (ten years ago)

monta, man. monta.

Allen (etaeoe), Saturday, 25 April 2015 00:49 (ten years ago)

meanwhile:

http://espn.go.com/nba/story/_/id/12759337/commissioner-adam-silver-expects-nba-explore-possible-rule-change-eliminate-hack-shaq-strategy

Silver acknowledged the strategy of intentionally fouling poor free throw shooters -- which originally started against retired superstar center Shaquille O'Neal -- is not enjoyable to watch. However, he expressed the need for caution when considering changing the rules of the game.

this is dumb. make your free throws.

Allen (etaeoe), Saturday, 25 April 2015 00:52 (ten years ago)

or make every game a dunk contest. either way.

Allen (etaeoe), Saturday, 25 April 2015 00:53 (ten years ago)

between the 05-06 and 13-14 seasons golden state was 29th in the league for total games lost to injury

thats bad

http://instreetclothes.com/nba-injury-analysis/golden-state-warriors/

micah, Saturday, 25 April 2015 00:54 (ten years ago)

though obvs with these things theres a lot going on

micah, Saturday, 25 April 2015 00:55 (ten years ago)

nba is for entertainment purposes and free throws are not entertaining imo nba shd changing the rules to reduce ft shooting altogether, fts also are just generally antithetical to the free flowing beautiful nature of the game

lag∞n, Saturday, 25 April 2015 00:58 (ten years ago)

ok how about before every game every player shoots 10 free throws, if they miss more than 5 they dont play that night

micah, Saturday, 25 April 2015 00:59 (ten years ago)

Eliminate all fouls.

Jeff, Saturday, 25 April 2015 01:00 (ten years ago)

id be fine w eliminating fts altogether and just giving players the points on a foul

lag∞n, Saturday, 25 April 2015 01:01 (ten years ago)

if i wanted to watch guys standing around preparing to throw a ball id watch baseball

lag∞n, Saturday, 25 April 2015 01:02 (ten years ago)

make andy cohen commissioner

Allen (etaeoe), Saturday, 25 April 2015 01:04 (ten years ago)

id be fine w eliminating fts altogether and just giving players the points on a foul

― lag∞n, Friday, April 24, 2015 6:01 PM (1 minute ago) Bookmark Flag Post Permalink

wonder how this would effect the value balance of big guys vs little guys

Clay, Saturday, 25 April 2015 01:06 (ten years ago)

id be fine w eliminating fts altogether and just giving players the points on a foul

i like this. or running clock with stoppage time per quarter.

Allen (etaeoe), Saturday, 25 April 2015 01:07 (ten years ago)

If intentionally fouled off the ball, get a choice between getting 1pt for free or take 2 ft.

Jeff, Saturday, 25 April 2015 01:10 (ten years ago)

ugh fuck off corey brewer

slothroprhymes, Saturday, 25 April 2015 01:11 (ten years ago)

wonder how this would effect the value balance of big guys vs little guys

― Clay, Friday, April 24, 2015 9:06 PM (4 minutes ago) Bookmark Flag Post Permalink

obv most bad ft shooters are big men but there is the occasional rondo out there

lag∞n, Saturday, 25 April 2015 01:12 (ten years ago)

that was a p amazing missed call w dwight throwing harris to the floor btw

lag∞n, Saturday, 25 April 2015 01:12 (ten years ago)

lots of pushing, hate the rox

Clay, Saturday, 25 April 2015 01:13 (ten years ago)

i like this. or running clock with stoppage time per quarter.

― Allen (etaeoe), Friday, April 24, 2015 9:07 PM (7 minutes ago) Bookmark Flag Post Permalink

ya id def be cool w eliminating the need for whistles and checking the ball w the refs etc on out of bounds etc and then u can revert to the old system in the last min + stoppage time or w/e

lag∞n, Saturday, 25 April 2015 01:16 (ten years ago)

think it's prob time to put harden back in

k3vin k., Saturday, 25 April 2015 01:22 (ten years ago)

wow awful charge call tho

k3vin k., Saturday, 25 April 2015 01:22 (ten years ago)

"heres smith this wld be big" air ball 3

lag∞n, Saturday, 25 April 2015 01:23 (ten years ago)

feel like carlisle should discontinue hack a dwight bc dwight keeps making most of his free throws

slothroprhymes, Saturday, 25 April 2015 01:30 (ten years ago)

obligatory: goddamn you to hell dwight

slothroprhymes, Saturday, 25 April 2015 01:30 (ten years ago)

why is dwight rejuvenated just now idgi bad timing imo

lag∞n, Saturday, 25 April 2015 01:31 (ten years ago)

the worst timing god this team is serious cockroach territory

slothroprhymes, Saturday, 25 April 2015 01:32 (ten years ago)

dwight was huge in the first round last year after a pretty mediocre reg season, might just be his way now

Clay, Saturday, 25 April 2015 01:36 (ten years ago)

why does ariza hate wide open 3s

k3vin k., Saturday, 25 April 2015 01:37 (ten years ago)

harden caught tyson leaning

lag∞n, Saturday, 25 April 2015 01:40 (ten years ago)

oh harden u r dumb sometimes

Clay, Saturday, 25 April 2015 01:41 (ten years ago)

oh that's a joke

k3vin k., Saturday, 25 April 2015 01:41 (ten years ago)

he pushed him and he did it on purpose too!

lag∞n, Saturday, 25 April 2015 01:41 (ten years ago)

it wasn't much contact but he got caught trying to be sneaky

Clay, Saturday, 25 April 2015 01:42 (ten years ago)

ahahahaha harden you fuckin moron

slothroprhymes, Saturday, 25 April 2015 01:42 (ten years ago)

tryin to get away w stuff that sneaky fr

lag∞n, Saturday, 25 April 2015 01:42 (ten years ago)

been nice to see ol' dirk dirkin again even if just for a game

Clay, Saturday, 25 April 2015 01:43 (ten years ago)

lol they literally show him making the contact then jerking his hand back like a kid hiding his hand after pulling the fire alarm and then making loud phony denials about it

slothroprhymes, Saturday, 25 April 2015 01:43 (ten years ago)

for sure xp

lag∞n, Saturday, 25 April 2015 01:43 (ten years ago)

harden took a midrange shot... and it went in

lag∞n, Saturday, 25 April 2015 01:46 (ten years ago)

smh

lag∞n, Saturday, 25 April 2015 01:46 (ten years ago)

classic harden rope a dope boringball

Clay, Saturday, 25 April 2015 01:46 (ten years ago)

aaaaaaghhhhhhhhhhhh

slothroprhymes, Saturday, 25 April 2015 01:47 (ten years ago)

that harden shot was so easy

J0rdan S., Saturday, 25 April 2015 01:48 (ten years ago)

you can't switch him

J0rdan S., Saturday, 25 April 2015 01:48 (ten years ago)

i wish brandon roy hadn't died and we could've had the two of them in entire game stand-offs where they traded possessions standing around dribbling it between the legs for 20 secs and then popping stepbacks

Clay, Saturday, 25 April 2015 01:49 (ten years ago)

u gotta be fuckin kidding me monta

slothroprhymes, Saturday, 25 April 2015 01:50 (ten years ago)

if you take out the abberation that is clips/spurs this is the worst first round i can remember

Clay, Saturday, 25 April 2015 01:51 (ten years ago)

god damn it why cant these teams just win

lag∞n, Saturday, 25 April 2015 01:51 (ten years ago)

is every series 3-0 now

lag∞n, Saturday, 25 April 2015 01:51 (ten years ago)

was that a pass?

johnny crunch, Saturday, 25 April 2015 01:51 (ten years ago)

xps clay it's p bad although the rose-surgence has been enjoyable & those games were entertaining but yea otherwise agree

slothroprhymes, Saturday, 25 April 2015 01:52 (ten years ago)

like it's not just one-sided, it's largely joylessly one-sided

Clay, Saturday, 25 April 2015 01:52 (ten years ago)

yeah rose thing is cool hope he holds up

Clay, Saturday, 25 April 2015 01:53 (ten years ago)

the dubs game last night was tight but the other two were m/l foregone conclusions even with brow's fourth quarter blitz in game 1

slothroprhymes, Saturday, 25 April 2015 01:54 (ten years ago)

NBA on ESPN ‏@ESPNNBA 40s41 seconds ago
This is the highest scoring regulation playoff game since 1995 when Rockets & Jazz played (140-126).

lag∞n, Saturday, 25 April 2015 01:54 (ten years ago)

yeah that was a good game last night actually for sure

but last year every game was completely amazing maybe i am just a spoiled brat

nah it's mostly been pretty bad

Clay, Saturday, 25 April 2015 01:55 (ten years ago)

yea even the east series were good last year except miami vs horcats

slothroprhymes, Saturday, 25 April 2015 01:56 (ten years ago)

ok...pacers wasn't good either but it was fun to see the underdog hawks almost knock em out

slothroprhymes, Saturday, 25 April 2015 02:00 (ten years ago)

dunno about clearing the bench this early

k3vin k., Saturday, 25 April 2015 02:06 (ten years ago)

kawhi on the attack early :D

slothroprhymes, Saturday, 25 April 2015 02:11 (ten years ago)

clips xtremely flat

lag∞n, Saturday, 25 April 2015 02:12 (ten years ago)

both teams

lag∞n, Saturday, 25 April 2015 02:19 (ten years ago)

injuries have been awful this season.

micah, Saturday, 25 April 2015 02:19 (ten years ago)

why do the tv guys keep calling it hack a shaq dre jordan is not shaq

lag∞n, Saturday, 25 April 2015 02:22 (ten years ago)

it's catchy man it rhymes

slothroprhymes, Saturday, 25 April 2015 02:23 (ten years ago)

imagine if shaq had never been historically, epically bad at FTs he would have one less major punchline on his resume

slothroprhymes, Saturday, 25 April 2015 02:24 (ten years ago)

but still like 10 others so still a walking very-good-at-basketball punchline

slothroprhymes, Saturday, 25 April 2015 02:25 (ten years ago)

cp needs to take this game over

lag∞n, Saturday, 25 April 2015 02:25 (ten years ago)

diaw straight up refusing to take wide open threes

lag∞n, Saturday, 25 April 2015 02:31 (ten years ago)

yeah boris just gotta shoot those

k3vin k., Saturday, 25 April 2015 02:33 (ten years ago)

OMG KAWHI

k3vin k., Saturday, 25 April 2015 02:34 (ten years ago)

My ft idea is no hi fives no dilly dallying u get five seconds to get to the line and get ready and once the ref check u the ball for the second u get a three count, step off the line or anything and you forfeit the free throw and the ball boom partially solved

juice college (agent hibachi), Saturday, 25 April 2015 02:34 (ten years ago)

Bogut may continue high fiving the air between attempts tho

juice college (agent hibachi), Saturday, 25 April 2015 02:35 (ten years ago)

Jesus kawhi that was ridic

juice college (agent hibachi), Saturday, 25 April 2015 02:37 (ten years ago)

wait how did tim duncan just veto that jump ball? he can do that?

k3vin k., Saturday, 25 April 2015 02:39 (ten years ago)

lol big baby jumping

lag∞n, Saturday, 25 April 2015 02:41 (ten years ago)

nice chop block by CP3

Matt Armstrong, Saturday, 25 April 2015 02:41 (ten years ago)

wow cp3 footspeed, i didn't know he still had that

k3vin k., Saturday, 25 April 2015 02:42 (ten years ago)

clips giving up so many wide open threes theyre lucky theyre not down 18 rn

lag∞n, Saturday, 25 April 2015 02:43 (ten years ago)

yup

k3vin k., Saturday, 25 April 2015 02:44 (ten years ago)

Kawhi The GOAT dunker in spurs history

brosario nawson (m bison), Saturday, 25 April 2015 02:50 (ten years ago)

gotta rename my cat katwhi leonard

slothroprhymes, Saturday, 25 April 2015 02:56 (ten years ago)

how was that blake drive not a shooting foul

k3vin k., Saturday, 25 April 2015 03:07 (ten years ago)

Amazing block from Manu. This team is amazing.

Allen (etaeoe), Saturday, 25 April 2015 03:23 (ten years ago)

clips are wilting like an undernourished plant it's great

slothroprhymes, Saturday, 25 April 2015 03:29 (ten years ago)

Um. We are working hard. I guess.

Allen (etaeoe), Saturday, 25 April 2015 03:32 (ten years ago)

pop really wanted to talk abt how poorly the clippers are playing

lag∞n, Saturday, 25 April 2015 03:33 (ten years ago)

refs need to call this one

lag∞n, Saturday, 25 April 2015 03:35 (ten years ago)

however this series goes, it was a valuable learning experience for Austin Rivers and I look forward to CP3 handing him the reins next season

Matt Armstrong, Saturday, 25 April 2015 03:37 (ten years ago)

i guess i just really hope the clips get their bench situation fixed in the offseason

k3vin k., Saturday, 25 April 2015 03:38 (ten years ago)

with Doc Rivers at the helm I'm sure they'll find a bunch of solid names that he remembers coaching against on nights they played well

Matt Armstrong, Saturday, 25 April 2015 03:40 (ten years ago)

We the best

brosario nawson (m bison), Saturday, 25 April 2015 03:42 (ten years ago)

what sport are the clippers playing

Clay, Saturday, 25 April 2015 03:43 (ten years ago)

Kawhi is that dude, I'm just SMH at lagoon and Barkley for pinking the clips in this series because y'all are misguided contrariwise and I suspect are unhappy in your lives to adopt such a position

brosario nawson (m bison), Saturday, 25 April 2015 03:47 (ten years ago)

Picking
Contrarians

brosario nawson (m bison), Saturday, 25 April 2015 03:48 (ten years ago)

xp its true my hate for the spurs is really a manifestation of my unfulfilled hopes and dreams

head clowning instructor (art), Saturday, 25 April 2015 03:54 (ten years ago)

~~healing process~~

brosario nawson (m bison), Saturday, 25 April 2015 03:56 (ten years ago)

wow kawhi career high dude is scary rn

Clay, Saturday, 25 April 2015 04:01 (ten years ago)

brosario nawson (m bison)
Posted: April 24, 2015 at 11:47:37 PM
Kawhi is that dude, I'm just SMH at lagoon and Barkley for pinking the clips in this series because y'all are misguided contrariwise and I suspect are unhappy in your lives to adopt such a position

omg the spurs just cant win every time ok its against the law someone had to day it its against the law

lag∞n, Saturday, 25 April 2015 04:02 (ten years ago)

Clay
Posted: April 25, 2015 at 12:01:13 AM
wow kawhi career high dude is scary rn

...32pts

lag∞n, Saturday, 25 April 2015 04:03 (ten years ago)

i was abt to make a joke abt his career high being 32 then i was like what if he scored 45 i better check but it was 32

lag∞n, Saturday, 25 April 2015 04:06 (ten years ago)

spurs will lose eventually but it will not be to the fuckin clips not at this rate lol

slothroprhymes, Saturday, 25 April 2015 04:06 (ten years ago)

not should it be

slothroprhymes, Saturday, 25 April 2015 04:06 (ten years ago)

but if the clips win the next game then they will be at the rate to tie

lag∞n, Saturday, 25 April 2015 04:07 (ten years ago)

numerous possible opponents would be an honorable death for the spurs but not the clips or the rockets idk I don't make the rules, it's gotta be the warriors, like some student becoming the teacher type ish

slothroprhymes, Saturday, 25 April 2015 04:08 (ten years ago)

ha i did not see the 32 thing, just the career high guess i should do my diligence b4 posting

Clay, Saturday, 25 April 2015 04:12 (ten years ago)

still he is good and i support him

Clay, Saturday, 25 April 2015 04:12 (ten years ago)

They're 10-0 when he scores over 25 pts

tsrobodo, Saturday, 25 April 2015 04:15 (ten years ago)

maybe cliff paul is actually playing instead of chris I dunno

slothroprhymes, Saturday, 25 April 2015 04:16 (ten years ago)

prob what happened

lag∞n, Saturday, 25 April 2015 04:17 (ten years ago)

Clay
Posted: April 25, 2015 at 12:12:14 AM
still he is good and i support him

yeah hes great obvs im just feeling a little persecuted by the spurs and kawhi being the latest object of worship for the church of play the right way and meaningless awards, makes me want to run with the devil (clippers)

lag∞n, Saturday, 25 April 2015 04:20 (ten years ago)

i don't feel like recent spurs are nearly as play the right way as they've been meme-ified to be idk

slothroprhymes, Saturday, 25 April 2015 04:29 (ten years ago)

idk when I think play the right way I think slowass pacers type teams or like the boring ass utah jazz but such a notion is obviously subjective

slothroprhymes, Saturday, 25 April 2015 04:30 (ten years ago)

i mean the spurs objectively do play the right way and i enjoy watching (they were better last year tho)

lag∞n, Saturday, 25 April 2015 04:32 (ten years ago)

shit like this shd be against the law

http://i.imgur.com/vHQ1tJj.jpg

lag∞n, Saturday, 25 April 2015 04:33 (ten years ago)

right I guess I mean how ppl interpret "the right way" is subjective and in all sports but especially hoops my interp. of that has been "it's boring but it works!" so basically many NCAA teams and shit like that

slothroprhymes, Saturday, 25 April 2015 04:36 (ten years ago)

the spurs are def getting a lot of "the right way" love right now

lag∞n, Saturday, 25 April 2015 04:37 (ten years ago)

they always have and always will, of course, but I think they're dynamic and fun to watch in a way that belies such a loaded description and all the easy jokes resulting from it

slothroprhymes, Saturday, 25 April 2015 04:42 (ten years ago)

i most strongly associate "play the right way" with larry brown and those mid-00's pistons teams, brown repeated it like a mantra

Clay, Saturday, 25 April 2015 04:42 (ten years ago)

Glad to see pop rock the beard again

brimstead, Saturday, 25 April 2015 04:44 (ten years ago)

re: FT rule change...what about allowing any player on the court to take any FT?

A True White Kid that can Jump (Granny Dainger), Saturday, 25 April 2015 04:45 (ten years ago)

xxp exactly! shit like that.

I swear if I see another fuckin sports blogger or avid fan, etc. (most likely those under 30, and I'm under 30 so I can say jfc we're awful sometimes) tweet another fuckin tired joke about the spurs being old or boring or whatever, ugghhhh like get new material or actually idk watch fucking basketball games

slothroprhymes, Saturday, 25 April 2015 04:46 (ten years ago)

Cp3 too old, lost that quick first step years ago, too bad they don't have a decent backup pg anymore, this has been your quarterly brimstead hot take, sb away

brimstead, Saturday, 25 April 2015 04:49 (ten years ago)

that's a pretty non-hot/reasonable take tbh

slothroprhymes, Saturday, 25 April 2015 04:50 (ten years ago)

the playoffs are cool http://www.nba.com/2015/news/features/john_schuhmann/04/25/wizards-go-small-ball-comes-up-big/index.html

lag∞n, Saturday, 25 April 2015 06:14 (ten years ago)

Whittman coty

#wegonnabechampionship (Spottie), Saturday, 25 April 2015 06:47 (ten years ago)

Whoa what happened Spurs vs clips? Did doc just start the bench or what?

#wegonnabechampionship (Spottie), Saturday, 25 April 2015 06:48 (ten years ago)

clips forgot how to shoot and some other stuff

micah, Saturday, 25 April 2015 07:26 (ten years ago)

the playoffs are cool http://www.nba.com/2015/news/features/john_schuhmann/04/25/wizards-go-small-ball-comes-up-big/index.html
--lag∞n

lol I love this. "this thing we tried just a few times during the regular season totally worked, so we said fuck it! but back's against the wall and my job is on the line so maybe I should so this smart lineup switch!"

slothroprhymes, Saturday, 25 April 2015 13:11 (ten years ago)

*do

obviously truth's age means you can't run it every single game/gotta give your other starters rest too AND raps defense means it has its best chance of success in series against bad defenders but there are y'know a lot of minutes during the regular season and 156 minutes seems like a notably small chunk of time for a lineup that's notably effective

slothroprhymes, Saturday, 25 April 2015 13:15 (ten years ago)

https://twitter.com/SheaSerrano/status/592002414728728576

, Saturday, 25 April 2015 16:34 (ten years ago)

lol

lag∞n, Saturday, 25 April 2015 16:46 (ten years ago)

hb to one of the alltime alltimers

lag∞n, Saturday, 25 April 2015 16:46 (ten years ago)

lol

k3vin k., Saturday, 25 April 2015 17:38 (ten years ago)

I still say the wiz small ball thing wouldn't go so well if the raps player James Johnson

Matt Armstrong, Saturday, 25 April 2015 18:02 (ten years ago)

*played

Matt Armstrong, Saturday, 25 April 2015 18:02 (ten years ago)

http://i.imgur.com/pnxcbrT.jpg

lol

lag∞n, Saturday, 25 April 2015 18:23 (ten years ago)

I don't think the goonie Kawhi doubt crusade is gonna go so well

Matt Armstrong, Saturday, 25 April 2015 18:27 (ten years ago)

probably will go better than the Ryan Hollins 2.0 thing tho

Matt Armstrong, Saturday, 25 April 2015 18:27 (ten years ago)

Dennis Johnson probably should have been DPOY and Finals MVP for the Sonics btw

Matt Armstrong, Saturday, 25 April 2015 18:28 (ten years ago)

xps wow carlisle, maybe it's you man

slothroprhymes, Saturday, 25 April 2015 18:28 (ten years ago)

I don't think the goonie Kawhi doubt crusade is gonna go so well

― Matt Armstrong, Saturday, April 25, 2015 2:27 PM (1 minute ago) Bookmark Flag Post Permalink

um kawhi has played exactly as ive described

lag∞n, Saturday, 25 April 2015 18:29 (ten years ago)

that said he can't be the only coach to have done that publicly and they can't all have been fined right?

slothroprhymes, Saturday, 25 April 2015 18:29 (ten years ago)

um kawhi has played exactly as ive described

― lag∞n, Saturday, April 25, 2015 6:29 PM (1 minute ago) Bookmark Flag Post Permalink

lol

Matt Armstrong, Saturday, 25 April 2015 18:30 (ten years ago)

ilx: kawhi is as good as pippin
me: naw
matt "archivist" armstrong: u doubted kawhi

lag∞n, Saturday, 25 April 2015 18:32 (ten years ago)

suuuuuure man that's what's happening here

Matt Armstrong, Saturday, 25 April 2015 18:34 (ten years ago)

shouldnt u bee searching the archives to pull a single post out you can misconstrue

lag∞n, Saturday, 25 April 2015 18:35 (ten years ago)

nursing weird grudges about foreign big men

lag∞n, Saturday, 25 April 2015 18:35 (ten years ago)

haha come on no one said kawhi was as good as pippen

k3vin k., Saturday, 25 April 2015 18:36 (ten years ago)

Pippen also set a career high in points at 32 in the playoffs, when he was a year older than Kawhi btw.

Matt Armstrong, Saturday, 25 April 2015 18:37 (ten years ago)

WELL IN THAT CASE

lag∞n, Saturday, 25 April 2015 18:38 (ten years ago)

I lol at pippen for that. it's very funny that that's all he did, he is overrated

Matt Armstrong, Saturday, 25 April 2015 18:38 (ten years ago)

nice job only scoring 32 in the playoffs, Pippen guy.

Matt Armstrong, Saturday, 25 April 2015 18:39 (ten years ago)

haha come on no one said kawhi was as good as pippen

― k3vin k., Saturday, April 25, 2015 2:36 PM (2 minutes ago) Bookmark Flag Post Permalink

not yet

lag∞n, Saturday, 25 April 2015 18:39 (ten years ago)

ilx: kawhi is as good as pippin
me: naw
matt "archivist" armstrong: u doubted kawhi

― lag∞n, Saturday, April 25, 2015 6:32 PM (8 minutes ago) Bookmark Flag Post Permalink

kev we misconstrued this we should apologize

Matt Armstrong, Saturday, 25 April 2015 18:41 (ten years ago)

literally my entire argument with ilx abt kawhi is regarding whether he is a great scorer/creator and i am being persecuted by this board for insulting their boyfriend

lag∞n, Saturday, 25 April 2015 18:41 (ten years ago)

like i have complimented him as a great all around player a million times and then said i dont think he will be as good as pippin <<<which someone did say and was agreed with

lag∞n, Saturday, 25 April 2015 18:42 (ten years ago)

kev we misconstrued this we should apologize

― Matt Armstrong, Saturday, April 25, 2015 2:41 PM (1 minute ago) Bookmark Flag Post Permalink

ha ur doing it right now

lag∞n, Saturday, 25 April 2015 18:42 (ten years ago)

You think he's overhyped and that's fine but I also think it's not gonna work out for you dude

Matt Armstrong, Saturday, 25 April 2015 18:44 (ten years ago)

I mean there's only so many things like pointing out that his career high of 32 isn't impressive before you're just the Kawhi doubter guy, sorry

Matt Armstrong, Saturday, 25 April 2015 18:44 (ten years ago)

matt plz mention this every day going forward it will be very enjoyable for everyone

lag∞n, Saturday, 25 April 2015 18:45 (ten years ago)

probably will go better than the Ryan Hollins 2.0 thing tho

― Matt Armstrong, Saturday, April 25, 2015 2:27 PM (17 minutes ago) Bookmark Flag Post Permalink

but not if it take the place of this because its also very good

lag∞n, Saturday, 25 April 2015 18:45 (ten years ago)

you're just the Kawhi doubter guy, sorry

― Matt Armstrong, Saturday, April 25, 2015 2:44 PM (51 seconds ago) Bookmark Flag Post Permalink

matt armstong ladies and gentlemen

lag∞n, Saturday, 25 April 2015 18:46 (ten years ago)

Kev will concede the point soon, like Jord did with the 2011 draft. But you, you have the long term potential to find a problem with a Kawhi MVP season or something.

Matt Armstrong, Saturday, 25 April 2015 18:47 (ten years ago)

ilx: i see kawhi developing into scottie pippin
me: i dont think he has the distributing skills of pippin who was the defacto point guard for one of the all time great teams
matt armstrong: UR THE KAWHI H8R SRY

lag∞n, Saturday, 25 April 2015 18:48 (ten years ago)

Kev will concede the point soon, like Jord did with the 2011 draft. But you, you have the long term potential to find a problem with a Kawhi MVP season or something.

― Matt Armstrong, Saturday, April 25, 2015 2:47 PM (2 minutes ago) Bookmark Flag Post Permalink

jfc man

lag∞n, Saturday, 25 April 2015 18:49 (ten years ago)

that was all fine and I didn't say anything but now you're doing stuff like

...32pts

― lag∞n, Saturday, April 25, 2015 4:03 AM (14 hours ago) Bookmark Flag Post Permalink

i was abt to make a joke abt his career high being 32 then i was like what if he scored 45 i better check but it was 32

― lag∞n, Saturday, April 25, 2015 4:06 AM (14 hours ago) Bookmark Flag Post Permalink

Matt Armstrong, Saturday, 25 April 2015 18:53 (ten years ago)

MATT SAID KAWHI WILL WIN AN MVP AND I WILL TELL HIM HE IS BAD AND WRONG EVERY DAY

lag∞n, Saturday, 25 April 2015 18:54 (ten years ago)

xp dude you have no chill whatsoever this is getting ridiculous

slothroprhymes, Saturday, 25 April 2015 18:54 (ten years ago)

32pts is not a very high career high for a 4th year player are you disputing this!

lag∞n, Saturday, 25 April 2015 18:55 (ten years ago)

this is why I have no opinions

Clay, Saturday, 25 April 2015 19:00 (ten years ago)

you SEEM to think Kawhi is overhyped in general, otherwise you wouldn't focus on things that have nothing to do with him being like or unlike Pippen. Same with the nba twitter account posting that picture.

And it's not like people said he'd be exactly like Pippen anyway, just that he'll fill that role in the NBA tapestry which it looks like he's on his way to doing tbf. Pippen was more of a point forward it's true but he also posted up a lot like Kawhi does and had a lot of athletic physical similarities.

Matt Armstrong, Saturday, 25 April 2015 19:01 (ten years ago)

tbh I've probably moved on from Ryan Hollins 2.0 and will go with "curio big man with obvious limitations" next year

Matt Armstrong, Saturday, 25 April 2015 19:03 (ten years ago)

the similarities to pip are obvs but when someone mentions that its also perfectly normal to also discuss the ways he is different, also that pip was an alltime great, this is called a discussion, which becomes way less enjoyable when someone files it away for future reductive point scoring

lag∞n, Saturday, 25 April 2015 19:06 (ten years ago)

i mean occasional reductive point scoring is fine dont get me wrong

lag∞n, Saturday, 25 April 2015 19:08 (ten years ago)

but its better to not score too many points... just like kawhi :)

lag∞n, Saturday, 25 April 2015 19:08 (ten years ago)

the similarities to pip are obvs but when someone mentions that its also perfectly normal to also discuss the ways he is different, also that pip was an alltime great, this is called a discussion, which becomes way less enjoyable when someone files it away for future reductive point scoring

― lag∞n, Saturday, April 25, 2015 7:06 PM (6 minutes ago) Bookmark Flag Post Permalink

I haven't brought up anything from the discussion and had no problem with it at the time. You've moved on to taking potshots at him and saying he's overhyped in general which is very different.

Maybe because that stuff is somewhat whimsical for you you think it shouldn't matter in terms of reductive point scoring idk

Matt Armstrong, Saturday, 25 April 2015 19:15 (ten years ago)

hes a lil bit overhyped rn, he fits the profile too

lag∞n, Saturday, 25 April 2015 19:18 (ten years ago)

All he does is fucking beast in the playoffs goonie g, what more do you wannnnnnnt

brosario nawson (m bison), Saturday, 25 April 2015 19:20 (ten years ago)

and will go with "curio big man with obvious limitations" next year

matt the fact that in the midst of a completely different debate you're managing to bring up something i typed a. while half-drunk b. almost a week ago and c. more as a troll than anything else is pretty absurd

slothroprhymes, Saturday, 25 April 2015 19:20 (ten years ago)

but generally i wld say my criticism of his over hypedness has been pretty measured and reasoned and paired with assurances that he is great or very good

lag∞n, Saturday, 25 April 2015 19:21 (ten years ago)

All he does is fucking beast in the playoffs goonie g, what more do you wannnnnnnt

― brosario nawson (m bison), Saturday, April 25, 2015 3:20 PM (42 seconds ago) Bookmark Flag Post Permalink

hes great dont get me wrong hes really good any team wld be overjoyed to have him

lag∞n, Saturday, 25 April 2015 19:21 (ten years ago)

matt the fact that in the midst of a completely different debate you're managing to bring up something i typed a. while half-drunk b. almost a week ago and c. more as a troll than anything else is pretty absurd

― slothroprhymes, Saturday, April 25, 2015 7:20 PM (28 seconds ago) Bookmark Flag Post Permalink

hmmm yeah cuz you really stayed out of it lol

Matt Armstrong, Saturday, 25 April 2015 19:22 (ten years ago)

almost a week ago

Matt Armstrong, Saturday, 25 April 2015 19:22 (ten years ago)

I'm basically dissatisfied by any prognosis that says kawhi isn't a future HOFer

brosario nawson (m bison), Saturday, 25 April 2015 19:22 (ten years ago)

http://bkref.com/tiny/NZw5J

:)

Matt Armstrong, Saturday, 25 April 2015 19:23 (ten years ago)

the spurs future is very interesting btw and prob dependent on them landing one big free agent which theyve never been able to do before but maybe the landscape has changed

lag∞n, Saturday, 25 April 2015 19:23 (ten years ago)

http://bkref.com/tiny/c0LmL

:)

lag∞n, Saturday, 25 April 2015 19:24 (ten years ago)

PIPPEN IS COMPLETELY UNIQUE

Matt Armstrong, Saturday, 25 April 2015 19:25 (ten years ago)

we haaaaaave all-caps liftoff!

slothroprhymes, Saturday, 25 April 2015 19:26 (ten years ago)

WELL IN THAT CASE

― lag∞n, Saturday, April 25, 2015 6:38 PM (48 minutes ago) Bookmark Flag Post Permalink

Matt Armstrong, Saturday, 25 April 2015 19:27 (ten years ago)

Look I think we can all agree that kawhi will win MVP next year and will supplant scottie pippen in our collective memories and will retire with the steals record and will win three straight titles ok

brosario nawson (m bison), Saturday, 25 April 2015 19:29 (ten years ago)

I think we're just squabbling over details and that's just not what we do here

brosario nawson (m bison), Saturday, 25 April 2015 19:30 (ten years ago)

http://bkref.com/tiny/lPw0V

Matt Armstrong, Saturday, 25 April 2015 19:30 (ten years ago)

it wld be maybe more interesting to talk abt the development of kawhis game heres what im seeing on the offensive end he had a base of a D and 3 + great transition finisher style and to that hes added a really good ability to attack the closeout and a post game and he makes the good instant simple pass when necessary as is the spurs way, he sometimes attacks his man off the dribble iso style but that seems like more of an occasional opportunistic thing, i dont have a good sense for how he functions in the pnr shd watch for that more

lag∞n, Saturday, 25 April 2015 19:31 (ten years ago)

http://bkref.com/tiny/DMoDs

lag∞n, Saturday, 25 April 2015 19:31 (ten years ago)

We should have a goon v Armstrong fite thread over the summer wld be good entertainment for the offseason

juice college (agent hibachi), Saturday, 25 April 2015 19:34 (ten years ago)

Btw that Tim Duncan coaching Etan Thomas story moullet posted is hilarious

Reminds me of the clips of Andrew luck telling guys who just sacked him "nice job" and "good hit"

juice college (agent hibachi), Saturday, 25 April 2015 19:35 (ten years ago)

he is pippenesque but he's not quite as good as pippen yet but he's only 23 hey guys it's saturday ur wasting ur lives

A True White Kid that can Jump (Granny Dainger), Saturday, 25 April 2015 19:36 (ten years ago)

bout to picnic B-)

lag∞n, Saturday, 25 April 2015 19:39 (ten years ago)

I love you goonie, enjoy the picnic.

Matt Armstrong, Saturday, 25 April 2015 19:41 (ten years ago)

thank u friend xo i am at the deli buying tacos now

lag∞n, Saturday, 25 April 2015 19:52 (ten years ago)

whoa whoa whoa tacos are not picnic food this is the real fight

Clay, Saturday, 25 April 2015 20:16 (ten years ago)

tacos are anytime food bc theyre great

slothroprhymes, Saturday, 25 April 2015 20:27 (ten years ago)

man, Kris Humphries wtf dude

Matt Armstrong, Saturday, 25 April 2015 20:49 (ten years ago)

ugh, schroeder is killing us, korver is cold, alison brie is at the game w/ her franco bf, this game is painful to watch

balls, Saturday, 25 April 2015 21:01 (ten years ago)

Brooklyn really isn't that bad with the rejuvenated Bropez

Matt Armstrong, Saturday, 25 April 2015 21:07 (ten years ago)

yeah that's what i'm telling myself, 'thad young's really working out for them' etc.

we're fucked.

balls, Saturday, 25 April 2015 21:13 (ten years ago)

i've been telling myself that the hawks are just warming themselves up again, but i'm starting to wonder. maybe this loss will shake em up

Heez, Saturday, 25 April 2015 21:34 (ten years ago)

I would say there are some similarities between that game and the spurs' first game, as in hawks missed a bunch of shots they usually make and I wouldn't predict that to happen two games in a row

slothroprhymes, Saturday, 25 April 2015 21:41 (ten years ago)

bulls bucks already getting back into the chippiness

slothroprhymes, Saturday, 25 April 2015 21:55 (ten years ago)

I would say there are some similarities between that game and the spurs' first game, as in hawks missed a bunch of shots they usually make and I wouldn't predict that to happen two games in a row

― slothroprhymes, Saturday, April 25, 2015 9:41 PM (18 minutes ago) Bookmark Flag Post Permalink

Deron had that shot to tie game 2 with like 10 seconds left tho, this series has been close.

Matt Armstrong, Saturday, 25 April 2015 22:00 (ten years ago)

it's entirely possible that the dude doing play by play for the bulls-bucks series has not seen an entire NBA game this year

Matt Armstrong, Saturday, 25 April 2015 22:32 (ten years ago)

Kev will concede the point soon, like Jord did with the 2011 draft. But you, you have the long term potential to find a problem with a Kawhi MVP season or something.

― Matt Armstrong, Saturday, April 25, 2015 2:47 PM (32 minutes ago) Bookmark Flag Post Permalink

ha i have long conceded that gobert is not actually a rich man's ryan hollins, but it does still make me chuckle to think about it, i mean at heart the guy is an overathletic spaz

k3vin k., Saturday, 25 April 2015 22:39 (ten years ago)

the bucks are playing the right way so far

Matt Armstrong, Saturday, 25 April 2015 22:43 (ten years ago)

if gobert had Hollins' hops we'd have to change the name of the sport to Gobertball or something

Matt Armstrong, Saturday, 25 April 2015 22:46 (ten years ago)

Jimmy butler just personally decided this game should be tied by halftime and made it happen

juice college (agent hibachi), Saturday, 25 April 2015 22:56 (ten years ago)

bulls with home court advantage in milwaukie a lil sad

Clay, Saturday, 25 April 2015 22:57 (ten years ago)

Also these couple of minutes for the bucks are a good argument for having a veteran point somewhere on the bench for a young team

juice college (agent hibachi), Saturday, 25 April 2015 22:57 (ten years ago)

i didn't think cliff paul ish could get cornier but this identity theft one where it's like "do you get it, it's chris paul, but he's wearing a fake mustache and glasses, that is the hilarious joke" has me like @statefarm delete your account

Clay, Saturday, 25 April 2015 22:58 (ten years ago)

such an underrated dunk here

https://www.youtube.com/watch?v=DHMO1XBxc9Q

Matt Armstrong, Saturday, 25 April 2015 23:02 (ten years ago)

bulls with home court advantage in milwaukie a lil sad
--Clay

yea lol close city proximity will do that

slothroprhymes, Saturday, 25 April 2015 23:03 (ten years ago)

milwaukee pro teams have always been happy to tap into that home away from home market for chicago sports fans. selig actually moved the brewers from the american league to the national league so they could have the cubs in the same division.

balls, Saturday, 25 April 2015 23:05 (ten years ago)

given how many minutes jimmy buckets will inevitably play he's gotta be on track to score like 50 or some shit

slothroprhymes, Saturday, 25 April 2015 23:19 (ten years ago)

greek freak fired the fuck up!

slothroprhymes, Saturday, 25 April 2015 23:29 (ten years ago)

https://vine.co/v/eWhhnDI21zZ

Clay, Saturday, 25 April 2015 23:58 (ten years ago)

I hate that Minnesota isn't in the same conference/division as Milwaukee major Matt Armstrong pet peeve

Matt Armstrong, Saturday, 25 April 2015 23:59 (ten years ago)

other than the literal geographical issue, whys that

slothroprhymes, Sunday, 26 April 2015 00:04 (ten years ago)

fun ending so far

polyphonic, Sunday, 26 April 2015 00:06 (ten years ago)

yeah, like i'll daydream of ways to move new orleans and memphis to the east and then i'm like who can i move to the west and the only plausible team really is milwaukee and there's no way in hell they're gonna let themselves be in a different conference from chicago and moving chicago to the west almost definitely just exacerbates imbalance issues longterm irregardless of how good that team is right now. basically just do away w/ conferences, go to that weird four or five mega divisions thing someone proposed, accept you can't have truly balanced schedules for every team plus teams don't want it - the bucks want to play the bulls more than they play the suns and the suns want to play the lakers more than they play the bucks - and just do it 1-16 and any inequalities or unfairness in the system will be weeded out by having seven game series. baseball and football don't rig their playoffs to have some sort of geographical balance in the finals, maybe when there were really good odds the finals were going to be lakers-celtics and lakers-celtics was a really optimal scenario for a league that wasn't as established or strong as mlb it made sense to have a system that funneled things to that matchup but it's 2015.

balls, Sunday, 26 April 2015 00:13 (ten years ago)

I think Steph just phase shifted wow I've never seen that move before

, Sunday, 26 April 2015 00:17 (ten years ago)

Quick reaction by Kidd and Dudley calling timeout!

Also stupid hero ball by rose trying to split a triple team with a behind the back dribble

juice college (agent hibachi), Sunday, 26 April 2015 00:18 (ten years ago)

Also never passing on a full possession to win the game

juice college (agent hibachi), Sunday, 26 April 2015 00:19 (ten years ago)

jared dudley, heroballer

slothroprhymes, Sunday, 26 April 2015 00:19 (ten years ago)

wow nice

Clay, Sunday, 26 April 2015 00:20 (ten years ago)

Lol Bayless knew rose can't make that Manu style back cut fast enough and burned him

juice college (agent hibachi), Sunday, 26 April 2015 00:20 (ten years ago)

or wait nvm bayless stupid similar names and matching headbands

slothroprhymes, Sunday, 26 April 2015 00:21 (ten years ago)

Dudley threw a great pass tho

juice college (agent hibachi), Sunday, 26 April 2015 00:30 (ten years ago)

there's probably several reasons this couldn't happen beyond logistics and inertia but maybe you could do away w/ divisions and then for scheduling since not everyone can play everyone else an equal amount of times you do it that every team has a home and home w/ every other team in the league and then the rest of the schedule is purely determined by previous year's record a la the nfl (sorta, only like two or three games are determined that way in the nfl schedule). this would 1) increase number of holy shit amazing matchup games every season 2) generate more out of nowhere cinderella teams 3) incentivize winning and create something as close to relegation as could be possible in american professional sports since bottom dwelling teams either thru incompetence or design would lose out on revenue. this might solve the tanking issue since it's really hard to deliberately construct a team that can put up one of the worst records in the league playing a disproportionate number of its games against equally awful teams several years in a row.

balls, Sunday, 26 April 2015 00:30 (ten years ago)

wow norris cole doin some dumb shit out here

aka why you never trust ex-heatles

slothroprhymes, Sunday, 26 April 2015 00:35 (ten years ago)

other than the literal geographical issue, whys that

Man you go either place and all you hear is badger this and gopher that, natural rivalry

Matt Armstrong, Sunday, 26 April 2015 00:44 (ten years ago)

Uh oh klay alert

juice college (agent hibachi), Sunday, 26 April 2015 01:04 (ten years ago)

Oops he missed the heat check 3

juice college (agent hibachi), Sunday, 26 April 2015 01:04 (ten years ago)

man brooms should be on deck in NOLA

slothroprhymes, Sunday, 26 April 2015 01:16 (ten years ago)

kevin love has a national tv commercial in which rebounding is a metaphor for the restorative qualities of... chocolate milk #branding

Clay, Sunday, 26 April 2015 01:31 (ten years ago)

but he duz not rebound much no mo commercial inaccurate

slothroprhymes, Sunday, 26 April 2015 01:32 (ten years ago)

if this was minny love the offensive boards alone would do it tho

I have not seen this commercial is it on ESPN or TNT?

slothroprhymes, Sunday, 26 April 2015 01:32 (ten years ago)

just ran during the last dubs & pelis break

Clay, Sunday, 26 April 2015 01:34 (ten years ago)

wow can't believe i just outed myself as an official member of the chocolate milk street team

Clay, Sunday, 26 April 2015 01:36 (ten years ago)

there are better ways to make chocolate milk

http://fandbnews.com/wp-content/uploads/2013/12/64790-Cocoa-Pebbles-Kyrie-original.jpg

balls, Sunday, 26 April 2015 01:37 (ten years ago)

Chocolayte Milk

Wow

, Sunday, 26 April 2015 01:38 (ten years ago)

now write it in wingdings and really have yr eyes opened

balls, Sunday, 26 April 2015 01:39 (ten years ago)

haha nbd man your secret's safe with ILH

I must've missed it I'm at a bar and the hoops are only on one televisions as opposes to the basedball and white ppl with sticks bullshit on many televisions

slothroprhymes, Sunday, 26 April 2015 01:39 (ten years ago)

(xps clay)

slothroprhymes, Sunday, 26 April 2015 01:40 (ten years ago)

lol dayo

Clay, Sunday, 26 April 2015 01:41 (ten years ago)

o man ESPN cameras just had the long painful "life comes at you fast" close up on monty's face

slothroprhymes, Sunday, 26 April 2015 01:43 (ten years ago)

AD chipping away single handed tho

slothroprhymes, Sunday, 26 April 2015 02:13 (ten years ago)

i love the harden taco bell commercial for real, like the director was all "james just be you, just say your thoughts and feelings about breakfast, about fashion, really just say whatever. we love you here at the bell."

Clay, Sunday, 26 April 2015 02:15 (ten years ago)

davis is for real beasting rn

Clay, Sunday, 26 April 2015 02:17 (ten years ago)

rip to the brow c u in october

Clay, Sunday, 26 April 2015 02:33 (ten years ago)

also rip to the rest of the pelicans, for whom i do not really care

Clay, Sunday, 26 April 2015 02:34 (ten years ago)

go blazermen

slothroprhymes, Sunday, 26 April 2015 02:43 (ten years ago)

I support anyone in the same underdog boat as my team

slothroprhymes, Sunday, 26 April 2015 02:43 (ten years ago)

what the heck

http://i.imgur.com/qDlktU6.png

lag∞n, Sunday, 26 April 2015 02:44 (ten years ago)

wes has been calling himself "ironman" for a few years bc he plays through injuries or something. like when he scores the gameops guys play the riff to the sabbath song and stuff. it is silly.

Clay, Sunday, 26 April 2015 02:46 (ten years ago)

is harvey firestein doing color on this game wth

Clay, Sunday, 26 April 2015 02:47 (ten years ago)

is por cooked? abtum looks injured

moullet, Sunday, 26 April 2015 03:05 (ten years ago)

everyone is injured and they are bad

Clay, Sunday, 26 April 2015 03:06 (ten years ago)

but i mean portland isn't really like suddenly cooked so much as they've been a sub .500 team since the all-star break and memphis is maybe the worst matchup in the west for them other than gsw

Clay, Sunday, 26 April 2015 03:10 (ten years ago)

https://pbs.twimg.com/media/CDfKFZJUEAEHp42.jpg

found my new fave hashtag

Clay, Sunday, 26 April 2015 03:44 (ten years ago)

but legit none of these make sense bc none of them are kevin love or rajon rondo or juiceman

slothroprhymes, Sunday, 26 April 2015 03:49 (ten years ago)

*those

slothroprhymes, Sunday, 26 April 2015 03:49 (ten years ago)

from what i can tell #futurelaker is a good way to find what young players are doing well at the moment in a nationally broadcast game

Clay, Sunday, 26 April 2015 03:53 (ten years ago)

this is why lakers fans are the actual worst people who have ever existed in the history of ever

slothroprhymes, Sunday, 26 April 2015 04:00 (ten years ago)

brow averaged 31-11-3blk for that series

lag∞n, Sunday, 26 April 2015 04:15 (ten years ago)

He was so good and it still felt like they didn't use him enough on offense. His midrange game is already top notch.

#wegonnabechampionship (Spottie), Sunday, 26 April 2015 04:22 (ten years ago)

hate how the playoffs bring out that "oh good for me, a guy on the other team got hurt" impulses

Clay, Sunday, 26 April 2015 04:28 (ten years ago)

yea man at one point I was like "yo if irving got whomped hard or something" then I felt kinda ill

slothroprhymes, Sunday, 26 April 2015 04:44 (ten years ago)

oh cmon plz let this get a lil interesting

Clay, Sunday, 26 April 2015 05:00 (ten years ago)

damn tony allen just curbstomped this maybe getting interesting

Clay, Sunday, 26 April 2015 05:08 (ten years ago)

ah well, rip to portland being b-level title contenders, it was a nice year and a half.

Clay, Sunday, 26 April 2015 05:22 (ten years ago)

RIP

#wegonnabechampionship (Spottie), Sunday, 26 April 2015 05:35 (ten years ago)

offensive rebounds, plz get some celtics, just maybe it'd be nice

slothroprhymes, Sunday, 26 April 2015 17:07 (ten years ago)

plz don't allow them as well

brother brad just shouted it on national TV maybe it'll work

slothroprhymes, Sunday, 26 April 2015 17:08 (ten years ago)

OH JEEZUS LOVE'S ARM/SHOULDER JUST POPPED OUT

slothroprhymes, Sunday, 26 April 2015 17:16 (ten years ago)

maybe this could be th-

god forgive me :/

slothroprhymes, Sunday, 26 April 2015 17:16 (ten years ago)

Remember that time Marcus Smart overslept?

Allen (etaeoe), Sunday, 26 April 2015 18:01 (ten years ago)

Yah go get perk crowder! Do it do it

juice college (agent hibachi), Sunday, 26 April 2015 18:03 (ten years ago)

perk gonna perk

circles, Sunday, 26 April 2015 18:04 (ten years ago)

lol perk is easily the most unlikable player in the league

k3vin k., Sunday, 26 April 2015 18:04 (ten years ago)

We loved u perk but you're shaming yourself nowadays

juice college (agent hibachi), Sunday, 26 April 2015 18:04 (ten years ago)

ah jeez jae

slothroprhymes, Sunday, 26 April 2015 18:08 (ten years ago)

that double technical was disgraceful

k3vin k., Sunday, 26 April 2015 18:17 (ten years ago)

olynyk is a punk for that WWE move he put on love too

k3vin k., Sunday, 26 April 2015 18:23 (ten years ago)

its cool soon he will be traded for him (via karma)

lag∞n, Sunday, 26 April 2015 18:36 (ten years ago)

this is getting real crazy

slothroprhymes, Sunday, 26 April 2015 18:39 (ten years ago)

assertive bass!

slothroprhymes, Sunday, 26 April 2015 18:39 (ten years ago)

cavs frustrated, aware they dont have the juice/arent going anywhere

lag∞n, Sunday, 26 April 2015 18:42 (ten years ago)

series v bulls cld get pleasantly chippy

lag∞n, Sunday, 26 April 2015 18:44 (ten years ago)

Thomas is having one of the worst games I've ever seen

juice college (agent hibachi), Sunday, 26 April 2015 18:45 (ten years ago)

i just turned it on but thomas def has the sort of game that can be stopped if u focus on it via hes over agressive

lag∞n, Sunday, 26 April 2015 18:46 (ten years ago)

refs shd call this game before everyone dies

lag∞n, Sunday, 26 April 2015 18:48 (ten years ago)

lol https://vine.co/v/eW6tZBmvE2l

lag∞n, Sunday, 26 April 2015 18:54 (ten years ago)

Brian Robb ‏@CelticsHub 44s45 seconds ago
Celtics shooting 1-of-14 from downtown and 11-of-21 from FT line.

lag∞n, Sunday, 26 April 2015 18:56 (ten years ago)

i love how hubie is always so supportive and encouraging of the underdog

lag∞n, Sunday, 26 April 2015 18:57 (ten years ago)

"there u go!" when isaiah finally makes a play

lag∞n, Sunday, 26 April 2015 18:57 (ten years ago)

https://twitter.com/SadderDre/status/592397962615136256

, Sunday, 26 April 2015 18:59 (ten years ago)

there's some life left in these yung celtics

slothroprhymes, Sunday, 26 April 2015 19:06 (ten years ago)

they legit cannot buy a shot tho

slothroprhymes, Sunday, 26 April 2015 19:11 (ten years ago)

blatt giving bron no rest even tho theyre up 3-0 and 20pts?

lag∞n, Sunday, 26 April 2015 19:13 (ten years ago)

cavs should tank the rest of this game to avoid JR's inevitable suspension falling in the bulls series

k3vin k., Sunday, 26 April 2015 19:22 (ten years ago)

the free throw probs seem like some delayed reaction vestigial rondo curse

slothroprhymes, Sunday, 26 April 2015 19:24 (ten years ago)

blatt giving bron no rest even tho theyre up 3-0 and 20pts?

― lag∞n, Sunday, April 26, 2015 3:13 PM (26 minutes ago) Bookmark

Why is he still in

, Sunday, 26 April 2015 19:39 (ten years ago)

hubie so pro-boston it's insane

Mr. Snrub, Sunday, 26 April 2015 19:46 (ten years ago)

EFF OFF WE AINT GOT MUCH LET US HAVE THAT

slothroprhymes, Sunday, 26 April 2015 19:49 (ten years ago)

he was also hella pro mavs vs the rockets he's just an underdog lover

slothroprhymes, Sunday, 26 April 2015 19:49 (ten years ago)

well that's that folks, but I thought it would be an interminable slog and it ended up being a lot of fun more often than not.

slothroprhymes, Sunday, 26 April 2015 19:59 (ten years ago)

Heh jvg just called Boris "well-rounded"

juice college (agent hibachi), Sunday, 26 April 2015 20:02 (ten years ago)

slothroprhymes
Posted: April 26, 2015 at 3:49:46 PM
he was also hella pro mavs vs the rockets he's just an underdog lover

ya feel like its just his coaching instinct to encourage guys who r doing bad

lag∞n, Sunday, 26 April 2015 20:05 (ten years ago)

worst first round

Clay, Sunday, 26 April 2015 20:05 (ten years ago)

ya wld been a lil better if a few close game threes went to the challenger

lag∞n, Sunday, 26 April 2015 20:06 (ten years ago)

sours clips still has potential tho! (missing this game tho

lag∞n, Sunday, 26 April 2015 20:08 (ten years ago)

this spurs clips series has yet to disappoint tho aside from I guess the second half of game 3

slothroprhymes, Sunday, 26 April 2015 20:08 (ten years ago)

lol jinx xp

slothroprhymes, Sunday, 26 April 2015 20:09 (ten years ago)

Hedo playing in the 2015 offs is something I cannot imagine

, Sunday, 26 April 2015 20:14 (ten years ago)

Austin rivers 🔥🔥🔥

, Sunday, 26 April 2015 20:18 (ten years ago)

in deep with my bookee and loan shark just sold everything i had and put in on mavs pulling this series out, pray for me

rip van wanko, Sunday, 26 April 2015 20:19 (ten years ago)

I just bet Matt Armstrong money on Austin rivers

, Sunday, 26 April 2015 20:20 (ten years ago)

in deep with my bookee and loan shark just sold everything i had and put in on mavs pulling this series out, pray for me
--rip van wanko

please tell us you're joking

slothroprhymes, Sunday, 26 April 2015 20:22 (ten years ago)

lol omg I can't believe I knee jerk reacted to that w/o reading in full to see the obvious OTT joke parts

slothroprhymes, Sunday, 26 April 2015 20:22 (ten years ago)

DUNCAN oh man

slothroprhymes, Sunday, 26 April 2015 20:23 (ten years ago)

"Kevin Love says he dislocated his left shoulder and will be reevaluated in Cleveland. Says he thinks Kelly Olynyk did it on purpose."

Clay, Sunday, 26 April 2015 20:24 (ten years ago)

um does he know literally anything about kelly O

slothroprhymes, Sunday, 26 April 2015 20:32 (ten years ago)

kelly is such a spaz he barely has the wherewithal to stay on D in transition let alone intentionally pull on an arm

slothroprhymes, Sunday, 26 April 2015 20:33 (ten years ago)

Migos ginobili same foot layup in the face of Jordan is a savvy vet move

, Sunday, 26 April 2015 20:33 (ten years ago)

kelly is such a spaz he barely has the wherewithal to stay on D in transition let alone intentionally pull on an arm

http://t.co/k9F9P3fXBT

Clay, Sunday, 26 April 2015 20:38 (ten years ago)

Truffle butter is a little too inappropriate for the Spurs pa

, Sunday, 26 April 2015 20:38 (ten years ago)

What the hell kind of broom is jalen holding

, Sunday, 26 April 2015 20:54 (ten years ago)

what is jalen's thing with holding intimidating objects

Clay, Sunday, 26 April 2015 20:57 (ten years ago)

they are heaping praise on austin rivers

slothroprhymes, Sunday, 26 April 2015 21:41 (ten years ago)

this game is horrifying

J0rdan S., Sunday, 26 April 2015 21:42 (ten years ago)

in the rules it says if you get dominated in a playoff game by austin rivers you have to relinquish one past championship

J0rdan S., Sunday, 26 April 2015 22:04 (ten years ago)

kelly is such a spaz he barely has the wherewithal to stay on D in transition let alone intentionally pull on an arm

this. he is one of the worst defenders I've seen play heavy playoff minutes. the idea that he intentional made that move is crazy. love sucks.

jr smith is done.

Allen (etaeoe), Sunday, 26 April 2015 22:30 (ten years ago)

Intentionally

Allen (etaeoe), Sunday, 26 April 2015 22:31 (ten years ago)

celtics should have played komomo when he walked off.

Allen (etaeoe), Sunday, 26 April 2015 22:32 (ten years ago)

tbf rivers looked solid. shrug.

Allen (etaeoe), Sunday, 26 April 2015 22:33 (ten years ago)

hey guys i just got home, been gone for basically the entire 'offs so far, doesn't seem like i missed much?

call all destroyer, Sunday, 26 April 2015 22:35 (ten years ago)

anyway, feel good about my bulls prediction. B-)

Allen (etaeoe), Sunday, 26 April 2015 22:35 (ten years ago)

lol some austin rivers action on #futurelaker

Clay, Sunday, 26 April 2015 23:01 (ten years ago)

can totes see the buss family making that decision

slothroprhymes, Sunday, 26 April 2015 23:06 (ten years ago)

this version of playoff wizards is...kinda entertaining?

slothroprhymes, Sunday, 26 April 2015 23:15 (ten years ago)

damn mike conley having face surgery :(

Clay, Sunday, 26 April 2015 23:19 (ten years ago)

https://pbs.twimg.com/media/CDjmLrHWIAA1M-d.jpg

Clay, Sunday, 26 April 2015 23:57 (ten years ago)

I just turned this game on and the raptors are already on a plane to Aruba apparently

juice college (agent hibachi), Monday, 27 April 2015 00:12 (ten years ago)

lol some austin rivers action on #futurelaker

― Clay, Sunday, April 26, 2015 7:01 PM (1 hour ago) Bookmark Flag Post Permalink

Omg this is gonna be the gift that keeps on giving thru the offs

juice college (agent hibachi), Monday, 27 April 2015 00:12 (ten years ago)

the raptors are complete and utter trash tonight

Clay, Monday, 27 April 2015 00:16 (ten years ago)

gave up on it at the half *checks score* o wow that's a deep hole

slothroprhymes, Monday, 27 April 2015 01:02 (ten years ago)

guess hawks and wiz will... be a thing that happens.

Clay, Monday, 27 April 2015 01:10 (ten years ago)

love out min 2 weeks, bulls in 6.

Clay, Monday, 27 April 2015 01:16 (ten years ago)

that could actually be sorta dece if hawks get turned back on and wiz stays at this pace

slothroprhymes, Monday, 27 April 2015 01:21 (ten years ago)

(xp)

slothroprhymes, Monday, 27 April 2015 01:21 (ten years ago)

first four game sweep for the wiz/bullets franchise apparently. damn.

balls, Monday, 27 April 2015 01:24 (ten years ago)

i mean i get the first round only went to best of seven in 03 but that's an old franchise.

balls, Monday, 27 April 2015 01:25 (ten years ago)

Just watched the Olynyk play, looks like he was trying to pull Love back to stop him getting the rebound but whatever his intent that was a dirty ass play and he probably should be punished for it.

tsrobodo, Monday, 27 April 2015 02:40 (ten years ago)

yeah that looked dirty as hell

Nhex, Monday, 27 April 2015 02:45 (ten years ago)

here's video of the olynyk and love tangle it def looks pretty dirty but it also looks like the kinda dirt that every big guy in the league does 10 times a game, just went bad this time

Clay, Monday, 27 April 2015 02:59 (ten years ago)

oh that'll download as an mp4, ignore that link. deadspin has it here http://screengrabber.deadspin.com/kevin-love-races-to-locker-room-after-dislocating-shoul-1700267145

Clay, Monday, 27 April 2015 03:00 (ten years ago)

like kg has 5k less career rebounds if he doesn't get away with that 82 games a year

Clay, Monday, 27 April 2015 03:02 (ten years ago)

jose barrea #futurelaker btw dude is killin it

Clay, Monday, 27 April 2015 03:02 (ten years ago)

nah it starts out like that but Olynyk keeps goin at it well after it stopped being anything close to a typical basketball play, it's a dirty play of the "ok dude is not trying to even do anything basketball-related at this point, lost his wits and his mind basically thinks he's in a fight" variety.

A True White Kid that can Jump (Granny Dainger), Monday, 27 April 2015 03:14 (ten years ago)

yeah i meant more how it started than how it ended, olynyk def took it a step too far

Clay, Monday, 27 April 2015 03:16 (ten years ago)

the whole thing lasted like 1.5 seconds, he was def messing w love but like not trying to pull his arm out of the socket, i mean maybe he was but seems unlikely someone shd check to see if he ever took jujitsu tho

lag∞n, Monday, 27 April 2015 03:32 (ten years ago)

that was prob like the 10th most physical play in that game

lag∞n, Monday, 27 April 2015 03:33 (ten years ago)

http://i.kinja-img.com/gawker-media/image/upload/s--jWxzFNuw--/iddzzx2azumnte5gj4wm.jpg

tsrobodo, Monday, 27 April 2015 03:38 (ten years ago)

yeah i mean he was pulling on his arm in a non basketball manner that happens literally every game

lag∞n, Monday, 27 April 2015 03:39 (ten years ago)

woj wrote a screeching column saying this incident will cost the celtics a chance at signing love

Clay, Monday, 27 April 2015 03:39 (ten years ago)

it was for instance not nearly egregious as this play from later in the very same game

https://www.youtube.com/watch?v=KmzbZpdl6hI

lag∞n, Monday, 27 April 2015 03:41 (ten years ago)

How hard do you have to pull on somebodies arm to pull it out of its socket?
I mean its not like that happens often.

tsrobodo, Monday, 27 April 2015 03:42 (ten years ago)

richard jefferson shd be forced off earth in a rocket fire straight at the sun

head clowning instructor (art), Monday, 27 April 2015 03:43 (ten years ago)

speaking as someone who has had his arm pulled out of the socket its just like an odd thing where u get the right angle or leverage or something its not necessarily dependent on exceptional force

lag∞n, Monday, 27 April 2015 03:44 (ten years ago)

fired*

head clowning instructor (art), Monday, 27 April 2015 03:45 (ten years ago)

RJ's attached lobes bother me.

Jeff, Monday, 27 April 2015 03:45 (ten years ago)

chris paul is shooting like 10 million percent with ten million points for that series btw even tho he didnt show up for one of the four games

lag∞n, Monday, 27 April 2015 03:47 (ten years ago)

Marc Stein @ESPNSteinLine · 15m 15 minutes ago
Dwane Casey ... highest winning percentage of any coach in Raptors HISTORY at .494 (154-158)

lol

lag∞n, Monday, 27 April 2015 03:50 (ten years ago)

p shocked at the wiz sweep did not think them capable of sweeping a single nba team much less a playoff team they looked like a smoldering trash heap at the end of the season

lag∞n, Monday, 27 April 2015 03:51 (ten years ago)

aminu had a big night, he might be the bright side of this season

head clowning instructor (art), Monday, 27 April 2015 03:54 (ten years ago)

that and not getting swept.

good enough

head clowning instructor (art), Monday, 27 April 2015 03:58 (ten years ago)

http://i.imgur.com/LxdsJKA.png

lag∞n, Monday, 27 April 2015 04:19 (ten years ago)

Lmao

#wegonnabechampionship (Spottie), Monday, 27 April 2015 04:47 (ten years ago)

Jr should get 3-5 games imo

#wegonnabechampionship (Spottie), Monday, 27 April 2015 04:47 (ten years ago)

That's like a concussion / torn acl on one punch

#wegonnabechampionship (Spottie), Monday, 27 April 2015 04:48 (ten years ago)

looked to me like crowder briefly lost consciousness, he doesn't brace himself for the fall in the slightest

Clay, Monday, 27 April 2015 04:50 (ten years ago)

Def got knocked out. Direct chin/jaw shots like that rattles the brain more than any other angle.

#wegonnabechampionship (Spottie), Monday, 27 April 2015 04:51 (ten years ago)

Can we talk about whatever harden was wearing on the walk into the stadium?

#wegonnabechampionship (Spottie), Monday, 27 April 2015 04:53 (ten years ago)

looks like chris paul is very conscious that this might be his last chance at a title

micah, Monday, 27 April 2015 06:09 (ten years ago)

also just realised that roy hibberts agent is david falk and hes falks only max player. that gives some background to larry bird going hard already and threatening to not play roy next season haha

micah, Monday, 27 April 2015 06:32 (ten years ago)

p shocked at the wiz sweep did not think them capable of sweeping a single nba team much less a playoff team they looked like a smoldering trash heap at the end of the season

― lag∞n, Sunday, April 26, 2015 11:51 PM (Yesterday) Bookmark Flag Post Permalink

My theory is that Wittman has turned the locker room coaching for the playoffs entirely over to THE TRUTH

juice college (agent hibachi), Monday, 27 April 2015 11:22 (ten years ago)

that would make sense and be awesome

slothroprhymes, Monday, 27 April 2015 13:21 (ten years ago)

Couple sweet moves from the weekend:

Montas spin moves at :50 and 1:10
https://www.youtube.com/watch?v=8dTv8-mnAK0

Currys move to get that layup up at :40
https://www.youtube.com/watch?v=qJyyHIu0wBc

#wegonnabechampionship (Spottie), Monday, 27 April 2015 18:31 (ten years ago)

Feeling very forlorn over the half-blazers getting crushed by the memphis ursines. I may not recover until the second round starts to heat up.

Giant Purple Wakerobin (Aimless), Monday, 27 April 2015 18:32 (ten years ago)

cavs/bulls almost assuredly will get chippy

A True White Kid that can Jump (Granny Dainger), Monday, 27 April 2015 20:44 (ten years ago)

yeah should be good!

#wegonnabechampionship (Spottie), Monday, 27 April 2015 20:47 (ten years ago)

http://www.youtube.com/watch?t=184&v=kr_Z1J0LE-s

Premise ridiculous. Who have two potato? (forksclovetofu), Monday, 27 April 2015 21:05 (ten years ago)

Jr smith got 2 games and the guy who yanked love's arm gets one next year?!?!!?!!????!?????!?????!!!!?!!!?!

Mr. Snrub, Monday, 27 April 2015 23:15 (ten years ago)

there was nothing suspension worthy about olynyk's play

J0rdan S., Monday, 27 April 2015 23:23 (ten years ago)

https://twitter.com/RickFox/status/592493646156591106

Bookmark No Bingus Permalink (Sufjan Grafton), Monday, 27 April 2015 23:34 (ten years ago)

otm, even if he could never get it done in the championship at Oz

Bookmark No Bingus Permalink (Sufjan Grafton), Monday, 27 April 2015 23:34 (ten years ago)

bucks bulls still really close - intriguing

nets hawks also v close - uuggghhhh go away nets

slothroprhymes, Tuesday, 28 April 2015 00:55 (ten years ago)

lol who gave d-will some dexies for this run he's on

slothroprhymes, Tuesday, 28 April 2015 01:06 (ten years ago)

not believing this game.

moullet, Tuesday, 28 April 2015 01:37 (ten years ago)

aaahahahahahahahaa

slothroprhymes, Tuesday, 28 April 2015 01:42 (ten years ago)

i think i'm going to vomit

balls, Tuesday, 28 April 2015 01:43 (ten years ago)

meanwhile in chitown zaza pachulia is taking it to the mighty bull. weird shit

slothroprhymes, Tuesday, 28 April 2015 01:43 (ten years ago)

future celtic khris middleton also shooting like mad

slothroprhymes, Tuesday, 28 April 2015 01:44 (ten years ago)

wow giannis with an uncharacteristic unprovoked trip move

slothroprhymes, Tuesday, 28 April 2015 01:49 (ten years ago)

https://twitter.com/RickFox/status/592493646156591106

― Bookmark No Bingus Permalink (Sufjan Grafton), Monday, April 27, 2015 7:34 PM (2 hours ago) Bookmark Flag Post Permalink

lmao he was literally retaliating

lag∞n, Tuesday, 28 April 2015 01:52 (ten years ago)

yeah he threw his hand up pretty deliberately but Butler had to sell it really hard, IMO it kinda looks like he didn't even touch him

frogbs, Tuesday, 28 April 2015 01:53 (ten years ago)

oh yeah jimmy buckets def fell on his sword to make it look worse. but damn I guess #darkgiannis isn't entirely a meme creation but might actually be a thing

slothroprhymes, Tuesday, 28 April 2015 02:05 (ten years ago)

Jimmy butler is really good. We should all appreciate him before thibs grinds him into dust playing him 47 minutes a night

juice college (agent hibachi), Tuesday, 28 April 2015 02:09 (ten years ago)

word on the street is thibs might not have too many games left to grind him into dust

lag∞n, Tuesday, 28 April 2015 02:12 (ten years ago)

yeah honestly the only thing I could see keeping thibs employed is a championship and that's not gon' happen

slothroprhymes, Tuesday, 28 April 2015 02:16 (ten years ago)

if he won the east itd prob be pretty hard to fire him but maybe they hate him that much who knows

lag∞n, Tuesday, 28 April 2015 02:18 (ten years ago)

Oh ya totally forgot they're hot to get rid of the best coach they've had since Phil

juice college (agent hibachi), Tuesday, 28 April 2015 02:18 (ten years ago)

"Love, Rondo, Aldridge #FutureLaker"

god i love this hashtag so much in all its ignorant glory, imagine how weird that team would be

Clay, Tuesday, 28 April 2015 02:19 (ten years ago)

It would be crazy if no one hired him right away and he spent a season assisting doc again and turned the clippers into a defensive juggernaut

juice college (agent hibachi), Tuesday, 28 April 2015 02:20 (ten years ago)

firing thibs would be crazy. but the bulls will totally fire him. shrug. they are still the best team in the east.

Allen (etaeoe), Tuesday, 28 April 2015 02:20 (ten years ago)

Quick clay search for oj mayo #futurelaker

juice college (agent hibachi), Tuesday, 28 April 2015 02:21 (ten years ago)

Raymond ‏@rayjr0834
Bron opting out too #FutureLaker

KrankU.com @Johnny_Blaz3
JR Smith bout to be suspended at least 3 games too...Cavs done

lag∞n, Tuesday, 28 April 2015 02:21 (ten years ago)

Juan Columbie ‏@skippedwords 4h4 hours ago
Klove has a labrum tear. Hes done for the whole post season IMO #futurelaker

lag∞n, Tuesday, 28 April 2015 02:21 (ten years ago)

lots of jimmy butler #futurelaker action, think i was right when i just said it is a hashtag that marks guys in nationally televised games who are currently doing well

Clay, Tuesday, 28 April 2015 02:22 (ten years ago)

@ef3jotv @H4rryL_4 @jo3v4n24 OJ MAYO #FutureLaker

(googleproofed that just cuz oh lord what if they came here)

Clay, Tuesday, 28 April 2015 02:23 (ten years ago)

thibs is a very good coach but the minutes thing and level of injuries theyve had is insane, idk how much hes actually responsible and how much of its random and how much of it is the organization/training staff but it really does not look good

lag∞n, Tuesday, 28 April 2015 02:23 (ten years ago)

like...I know there are people that dumb in this world but it's still jarring xp

slothroprhymes, Tuesday, 28 April 2015 02:24 (ten years ago)

lots of jimmy butler #futurelaker action, think i was right when i just said it is a hashtag that marks guys in nationally televised games who are currently doing well

― Clay, Monday, April 27, 2015 10:22 PM (1 minute ago) Bookmark Flag Post Permalink

seems like most of the #FutureLaker ppl are joking, or like thats just their way of saying someone is playing well

lag∞n, Tuesday, 28 April 2015 02:24 (ten years ago)

i do not presume irony leaking into the world of lakers fans on twitter

Clay, Tuesday, 28 April 2015 02:25 (ten years ago)

lol yea these ppl don't joke remember how meet me in temecula was A Thing

slothroprhymes, Tuesday, 28 April 2015 02:26 (ten years ago)

i think it might be a meme

lag∞n, Tuesday, 28 April 2015 02:26 (ten years ago)

Ya given what I know about yr generic Laker fan plus cross referencing active twitters...I must conclude all #futurelaker business is serious

juice college (agent hibachi), Tuesday, 28 April 2015 02:27 (ten years ago)

sometimes giannis' whole not knowing how to play basketball thing is a problem

Clay, Tuesday, 28 April 2015 02:29 (ten years ago)

He thoroughly panicked on that possession, mirotic bailed him out for a bit by poking the ball away

juice college (agent hibachi), Tuesday, 28 April 2015 02:31 (ten years ago)

lakers fans are legit on another planet of delusion after these two years and they didn't have much chill before that in my experience

slothroprhymes, Tuesday, 28 April 2015 02:31 (ten years ago)

looks like they goin back to cheeseland tho xp

slothroprhymes, Tuesday, 28 April 2015 02:32 (ten years ago)

omg jason kidd that was adorbale

Clay, Tuesday, 28 April 2015 02:33 (ten years ago)

These bucks are super intriguing imagine if Giannis learns more stuff or if mcw learns to shoot or Parker is good or all three

juice college (agent hibachi), Tuesday, 28 April 2015 02:34 (ten years ago)

Haha Kidd did a Crawford dance for Joey

juice college (agent hibachi), Tuesday, 28 April 2015 02:34 (ten years ago)

"timeout... timeout! timeout! TIMEOUT, JOEY, TIMEOUT!!!!"

moullet, Tuesday, 28 April 2015 02:35 (ten years ago)

i'd love to become a Jason Kidd The Coach fan but it's pretty hard to forgive pretty much everything about his personal life

Clay, Tuesday, 28 April 2015 02:36 (ten years ago)

These bucks are super intriguing imagine if Giannis learns more stuff or if mcw learns to shoot or Parker is good or all three

― juice college (agent hibachi)

totally. i might be going in on a flex package next year and bucks are very likely to be one of the games i pick.

balls, Tuesday, 28 April 2015 02:37 (ten years ago)

two of those three things are likely the other not imo

lag∞n, Tuesday, 28 April 2015 02:39 (ten years ago)

yeah options a and c i'd feel good about, not so much b

balls, Tuesday, 28 April 2015 02:41 (ten years ago)

bucks have a bright future for sure

lag∞n, Tuesday, 28 April 2015 02:41 (ten years ago)

pr sure mcw is a rondo yeah

Clay, Tuesday, 28 April 2015 02:42 (ten years ago)

i'd love to become a Jason Kidd The Coach fan but it's pretty hard to forgive pretty much everything about his personal life
--Clay

this has been my main struggle with having the bucks as a sidepiece team

slothroprhymes, Tuesday, 28 April 2015 02:43 (ten years ago)

but they've been fun to watch all year and a lot of that has to do with how ingeniously he coaches them

slothroprhymes, Tuesday, 28 April 2015 02:44 (ten years ago)

there's gonna be some long, pale faces at the moda tonight

Clay, Tuesday, 28 April 2015 02:46 (ten years ago)

These bucks are super intriguing imagine if Giannis learns more stuff or if mcw learns to shoot or Parker is good or all three

I'm not super hopeful about that middle one but still, 2017 season could be huge for Milwaukee. I was really against the Kidd signing/trade but man am I eating those words

frogbs, Tuesday, 28 April 2015 02:47 (ten years ago)

that last 30 seconds was pretty weird but also very satisfying for those of us who took under 188

k3vin k., Tuesday, 28 April 2015 02:47 (ten years ago)

betting on games is the only way to make this first round interesting :/

k3vin k., Tuesday, 28 April 2015 02:47 (ten years ago)

are the nets really going to look put the hawks down like how is that possible

head clowning instructor (art), Tuesday, 28 April 2015 02:49 (ten years ago)

can u imagine another series having to watch brooklyn play basketball it would be awful

head clowning instructor (art), Tuesday, 28 April 2015 02:50 (ten years ago)

Bucks/nets ECF

Jeff, Tuesday, 28 April 2015 02:53 (ten years ago)

if aldridge leaves that afflalo trade is going to be catastrophic in retrospect

Clay, Tuesday, 28 April 2015 02:59 (ten years ago)

2015-16 is the year of meyers leonard btw

Clay, Tuesday, 28 April 2015 03:05 (ten years ago)

if aldridge leaves...

...it will mean he decided he wasn't appreciated enough by the organization, that they promoted lillard too much when he obviously is the pillar who holds that team up. if he does decide that, he'd have an honest case. Aldridge is THE MAN on these blazers and anyone who misses that stark fact is just blind or kidding himself. take him away and the team falls by 10 wins and lands squarely into irrelevance in one swoop.

Giant Purple Wakerobin (Aimless), Tuesday, 28 April 2015 03:14 (ten years ago)

MEYERS

k3vin k., Tuesday, 28 April 2015 03:17 (ten years ago)

if aldridge leaves...

...it will mean he decided he wasn't appreciated enough by the organization

or bc he wants to win and doesn't see portland trending up, or he's homesick and wants to go back to texas, or

Clay, Tuesday, 28 April 2015 03:20 (ten years ago)

tony allen is ingenious sometimes https://twitter.com/bballbreakdown/status/592892080323694592

lag∞n, Tuesday, 28 April 2015 03:28 (ten years ago)

ya that was cray

k3vin k., Tuesday, 28 April 2015 03:29 (ten years ago)

go blaze!

slothroprhymes, Tuesday, 28 April 2015 03:39 (ten years ago)

meyers leonard >>>>>> michael jordan

Clay, Tuesday, 28 April 2015 03:40 (ten years ago)

WOW that lillard 2 for 1

k3vin k., Tuesday, 28 April 2015 03:41 (ten years ago)

dame u guys

Clay, Tuesday, 28 April 2015 03:41 (ten years ago)

I support all underdogs now except for the nets man it's gonna be a long night

slothroprhymes, Tuesday, 28 April 2015 03:43 (ten years ago)

prime dame https://twitter.com/bballbreakdown/status/592897661965053952

lag∞n, Tuesday, 28 April 2015 03:48 (ten years ago)

shaq has thoroughly redeemed himself by praising the god meyers leonard

Clay, Tuesday, 28 April 2015 03:49 (ten years ago)

j/k i will still murder shaq

Clay, Tuesday, 28 April 2015 03:50 (ten years ago)

haha TA with the first emphatic possession arrow of the night

k3vin k., Tuesday, 28 April 2015 04:05 (ten years ago)

dame defense vines are the new harden defense youtubes https://vine.co/v/eWxQO5HmU6P

lag∞n, Tuesday, 28 April 2015 04:09 (ten years ago)

he's so bad at that shit

Clay, Tuesday, 28 April 2015 04:14 (ten years ago)

o damn getting close up in here

slothroprhymes, Tuesday, 28 April 2015 04:40 (ten years ago)

I honestly don't think LMA leaves regardless of what happens but I guess I could be wrong

slothroprhymes, Tuesday, 28 April 2015 04:49 (ten years ago)

WOW

slothroprhymes, Tuesday, 28 April 2015 04:50 (ten years ago)

cj is such a chucker but i guess sometimes it goes in

Clay, Tuesday, 28 April 2015 04:50 (ten years ago)

damian is defending p&rs competetently what in the world

Clay, Tuesday, 28 April 2015 04:50 (ten years ago)

really feels like this is LA's last game in rip city. he's been giving basically the most alarming quotes possible.

J0rdan S., Tuesday, 28 April 2015 04:53 (ten years ago)

you cannot hack a gasol tho what the heck

slothroprhymes, Tuesday, 28 April 2015 04:53 (ten years ago)

wow how does TA go under that screen

k3vin k., Tuesday, 28 April 2015 04:54 (ten years ago)

jesus damian

Clay, Tuesday, 28 April 2015 04:54 (ten years ago)

xps I've heard some of them and I sorta understand the argument but idk where he goes & thinks he's more likely to stay v competitive?

slothroprhymes, Tuesday, 28 April 2015 04:55 (ten years ago)

daaaaaame

slothroprhymes, Tuesday, 28 April 2015 04:55 (ten years ago)

spurs courting him as the duncan replacement is intriguing even tho he'd basically have to completely alter his game

J0rdan S., Tuesday, 28 April 2015 04:56 (ten years ago)

also houston maybe

J0rdan S., Tuesday, 28 April 2015 04:56 (ten years ago)

that's a goaltend

k3vin k., Tuesday, 28 April 2015 04:56 (ten years ago)

really feels like this is LA's last game in rip city. he's been giving basically the most alarming quotes possible.

― J0rdan S., Monday, April 27, 2015 9:53 PM (1 minute ago) Bookmark Flag Post Permalink

yeah i agree. tho in fairness he's never been a good talker and speaks ambivalently about everything

Clay, Tuesday, 28 April 2015 04:56 (ten years ago)

ah the quenching pride of not getting swept

Clay, Tuesday, 28 April 2015 04:57 (ten years ago)

spurs is certainly plausible although I don't think duncan is retiring just yet (he's playing better than most ppl 12 years younger why not give it one last go)

slothroprhymes, Tuesday, 28 April 2015 04:58 (ten years ago)

don't know why j0rdan thinks lamarcus won't be playing in game 6 tho

Clay, Tuesday, 28 April 2015 04:58 (ten years ago)

mavs would also be in play I imagine if they lose some cap space (which they prob will)

slothroprhymes, Tuesday, 28 April 2015 04:59 (ten years ago)

wow didn't realize dallas had 44m coming off the books this summer, but they'll have to resign chandler and idk how you play dirk and lamarcus together for 3 years

Clay, Tuesday, 28 April 2015 05:02 (ten years ago)

tru it would be a #toomanybigs sitch

slothroprhymes, Tuesday, 28 April 2015 05:03 (ten years ago)

dirk and lamarcus would set an unbreakable record for long 2's attempted in a season

Clay, Tuesday, 28 April 2015 05:05 (ten years ago)

I mean I'd be borderline shocked if he went to one of The Status Quo Big Destinations because ok let's say he wants a 5 year max...is LA gonna get a title by then? is NY? is miami? uhhh, lol. no.

slothroprhymes, Tuesday, 28 April 2015 05:05 (ten years ago)

ok actually I can't write off LA much as I want to, not in any full stop way, but the other two...yea sure. I would aggressively court if I'm any western contender with cap space tho.

slothroprhymes, Tuesday, 28 April 2015 05:06 (ten years ago)

well damnit now that the blazers won i am slightly emotionally invested in this series that they are def gonna win historically

Clay, Tuesday, 28 April 2015 05:07 (ten years ago)

i'm pretty sure that lamarcus wouldn't break portland's heart by leaving *and* going to the lakers, like that would be The Decision x 100, he would be the greatest villain in blazers history.

Clay, Tuesday, 28 April 2015 05:08 (ten years ago)

he's not gonna go to the lakers

he's from texas, the spurs need to set the franchise for the future, the rockets went all in for bosh last year, feel like the dots on this one are pretty easy to connect (if he leaves)

J0rdan S., Tuesday, 28 April 2015 13:56 (ten years ago)

he seems like a perfect fit disposition wise for the spurs, wld be very interesting if a premiere free agent finally picked them right at their moment of need, dont think anyone wld have any doubt that they cld figure out how to fill out the roster around a aldridge/kawhi core

lag∞n, Tuesday, 28 April 2015 14:01 (ten years ago)

feel like this lowe fragment is relevant and basically otm to our ongoing discussion re green kawhi max contracts and so forth

WINNER: The Situational Superstar

We have one conception of a superstar max player — the guy who gets the ball, stops the offense, and gets you buckets. Michael Jordan, basically. Draymond Green is not that sort of player, and an astonishing number of fans seem to find him laughably unworthy of a max-level deal as a free agent this summer.

In the new NBA — the NBA of motion offenses and speeding defenses — Green is a max guy. There are still players who can produce baskets from nothing, and they are massively valuable. But rule changes have made one-on-one creation harder than it used to be, from the post and the perimeter.

Good offenses move the ball continuously, and to do that, you need as many players as possible who can shoot, dribble, and pass. Find one at the power forward spot, and you’ve really got something — a guy who can stretch the defense, suck one big-man defender away from the rim, and plug holes all over the court on defense. A guy who does everything at a B-plus level is relatively more valuable today, because the game requires everyone to do everything.

Paying anyone the max carries an opportunity cost; it might limit Golden State’s ability to snag another free agent down the road. You can scan the league and find guys who can replicate Green’s skill set at a fraction of the max salary: Patrick Patterson, Boris Diaw, Josh McRoberts, Markieff Morris, and others.

But they all lack something. None are near Green’s level as defenders or on the glass. Patterson is a better long-range shooter, but he can’t sniff Green’s passing, dribbling, or ability to push off a defensive rebound.

Green’s only major negative is an inability to hit contested jumpers, but that’s not a huge deal as long as he can hit open triples. Teams in the hothouse of the playoffs exploit every liability that goes unnoticed during the regular-season slog. If you can’t guard the post, teams will bully you. If you can’t hit open 3s, they’ll ignore you. If you can’t dribble or pass, they’ll run you off the arc, force you into the lane, and take the ball from you. Players without holes in their games become even more valuable in that environment.

You can’t run an offense through Draymond Green, but you also can’t exploit him in any way. He can keep the machine moving on offense, and he’s one of the half-dozen best defenders in the league. He’s a max player this summer, especially since any long-term max contract signed in July will only take up something like 15 percent of the cap once it leaps into the $100 million range in two years.

One thing Green can’t do: play center. The Warriors will always need a bigger guy next to him, and they’ll eventually have to pay Andrew Bogut’s successor. But their cap sheet is structured so that every time someone is due a raise, another big deal comes off the books. The Dubs can max out Green this summer, re-sign Stephen Curry to a $30 million mega-max deal in two years, and — if they play their cards right — still have enough money to nab a big free agent at some point during that process. It may cost them Harrison Barnes, but that’s a trade-off the Warriors will make if they have to.

Green just finished putting up 16 points, 13 rebounds, six assists, and 2.5 steals per game against New Orleans, with all-world defense and acceptable long-range shooting from a big-man position — a position that defines the spacing of the floor. Where do I sign the paperwork?

All of this applies to Jimmy Butler and Kawhi Leonard as well. As wing players, they fit the traditional image of a max-level star. They can take the ball and create their own shot. But that isn’t quite their bread-and-butter, and it doesn’t matter. Pay ’em.

lag∞n, Tuesday, 28 April 2015 14:02 (ten years ago)

tho while i agree that its a no brainer for the warriors to max green out i dont think it wld be true for most teams, its more situational to their team and salary set up, whereas any team shd max out kawhi

lag∞n, Tuesday, 28 April 2015 14:05 (ten years ago)

if green cld play center hed be a lot more valuable

lag∞n, Tuesday, 28 April 2015 15:56 (ten years ago)

yeah kawhi and butler can get buckets on their own

#wegonnabechampionship (Spottie), Tuesday, 28 April 2015 15:57 (ten years ago)

they can but theyre not l33t shot creators/defense benders

lag∞n, Tuesday, 28 April 2015 16:00 (ten years ago)

if green cld play center hed be a lot more valuable

― lag∞n, Tuesday, April 28, 2015 11:56 AM (3 minutes ago) Bookmark

if every power forward could play center they'd be a lot more valuable

J0rdan S., Tuesday, 28 April 2015 16:00 (ten years ago)

grantland had a lengthy piece on the Spurs that focuses on Green:

The 2016 Spurs could open up about $22 million in cap room, but to do it, they’d have to renounce every outgoing free agent other than Leonard — including Green. Green is perhaps the most divisive free agent of the summer in league circles. Lots of execs would scoff at giving him a deal in the $10 million range; the phrase “product of the Spurs system” is thrown around a lot. It’s an accidental bonus of San Antonio’s selfless motion offense: People have never seen some Spurs exist outside that paradise, and that knowledge gap might depress those players’ value in free agency. The freaking Spurs win both ways.

But Green is no longer just a system player who mooches wide-open 3s. He takes hard 3s, with defenders right in his jersey, and he takes them from all areas of the floor. He has mastered little pump-fake/sidestep combinations that come in handy when defenders rush out at him. Green can’t cover ground as fast as Leonard or Tony Allen, but he has built himself into an elite defender who can hound multiple positions. He’s always well balanced, he’s long, and he just gets the game — how opposing plays unfold, when and where to shift around the floor, and how to use his size to bother smaller players who can out-quick him. He happens to be one of the most fearsome transition defenders alive. Some “3-and-D” guys barely meet half of the 3-and-D equation. Green is legit.

It’s popular to suggest he can’t dribble, but that’s not really true. Green can do just enough to keep the offense moving when he catches it against a rotating defense. He just can’t do much more than that, and at 27, he’s unlikely to add off-the-bounce oomph. He’s not explosive enough to get to the rim, and he has to settle for awkward midrange shots that often miss badly. He’s not a great passer, and he can’t get deep enough inside defenses to open up the most productive passes; Green has dished just 2.5 assists per 36 minutes, the lowest figure among the seven Spurs players who have logged at least 1,400 minutes this season.

There might be some truth to the notion that Green is a “system” player. He’d be lost without teammates to create shots for him. He’s lucky that everyone on his team is a willing passer, and that with Leonard around, he never absolutely has to defend the best opposing perimeter player. But any functional system should produce good jumpers; Green could spot up for open 3s in Detroit around Reggie Jackson–Andre Drummond pick-and-rolls, or in Charlotte around Al Jefferson post-ups. If you pay Green $10 million per season to score 18 points per game and dribble a lot, you’ll be disappointed. If you value his skills properly, you’ll be content. I’d pay him $10 million per season now, especially with the cap set to jump into the $100 million–plus range in two years. Ten percent of the cap for Danny Green? Sign me up.

Everyone likes to say that you can find functional wing players anywhere, but you can’t find a lot of wings who play All-NBA-level defense, crack 40 percent from deep every year, and continue to do both in the hothouse of the playoffs — where guys with glaring holes in their games suddenly can’t even get on the floor. (Just ask the 2011-12 version of Danny Green.) It would be classic Spurs to replace Green now, just as they dealt away George Hill when Hill became expensive. Green should be done taking discounts for the cause. But there are nights — and this sounds crazy, but I swear it’s true — when the Green/Leonard combination feels almost like the foundation of the Spurs. Leonard is the star, as he was when the two combined for 44 points in the Spurs’ shellacking of Golden State earlier this month, but their singular powers combine into something greater — an NBA wing Voltron. All that shooting and defense at positions (especially in Green’s case) where talent is scarce — you don’t trifle with that.

“Danny and Kawhi have played well together,” Buford says, “and the results that they have been a part of speak for themselves.”

Premise ridiculous. Who have two potato? (forksclovetofu), Tuesday, 28 April 2015 16:01 (ten years ago)

if every power forward could play center they'd be a lot more valuable

― J0rdan S., Tuesday, April 28, 2015 12:00 PM (11 seconds ago) Bookmark Flag Post Permalink

many of them can!

lag∞n, Tuesday, 28 April 2015 16:01 (ten years ago)

Jason Lloyd ‏@JasonLloydABJ 3m3 minutes ago
#Cavs GM David Griffin says he doesn't believe Kevin Love will play again this postseason, surgery is an option

J0rdan S., Tuesday, 28 April 2015 16:11 (ten years ago)

life comes at you fast

J0rdan S., Tuesday, 28 April 2015 16:12 (ten years ago)

perfectly capping off loves nightmare season

lag∞n, Tuesday, 28 April 2015 16:13 (ten years ago)

offseason trade is prob the best course of action for both parties

lag∞n, Tuesday, 28 April 2015 16:14 (ten years ago)

im mad that this prevents my love prophecy -- that he would be run out of town as the scapegoat of a playoff loss -- from coming true

J0rdan S., Tuesday, 28 April 2015 16:15 (ten years ago)

specifically because of bad defense

J0rdan S., Tuesday, 28 April 2015 16:15 (ten years ago)

ya that had abt 99% chance of coming true before he got injured

lag∞n, Tuesday, 28 April 2015 16:17 (ten years ago)

http://i.imgur.com/e5UiAyj.png

lag∞n, Tuesday, 28 April 2015 16:17 (ten years ago)

i was gonna say kelly O's murder of his arm would prevent that but obv a trade would make sense

slothroprhymes, Tuesday, 28 April 2015 16:18 (ten years ago)

yeah and it makes a lot more sense for love to demand a trade rather than opt out cause then his new team retains his bird rights just in time for the salary cap hike

lag∞n, Tuesday, 28 April 2015 16:19 (ten years ago)

hed prob come around to playing w kelly if nessisary tho he was just upset

lag∞n, Tuesday, 28 April 2015 16:19 (ten years ago)

do we think cleve's dumb enough to take turner tho? they just saw him go back to looking like 2014 pacers turner as opposed to significantly improved brad-coached turner

slothroprhymes, Tuesday, 28 April 2015 16:20 (ten years ago)

who knows imo hed be a fine backup for a team lacking depth

lag∞n, Tuesday, 28 April 2015 16:20 (ten years ago)

throw in a draft pick u know

lag∞n, Tuesday, 28 April 2015 16:21 (ten years ago)

its not quite andrew wiggins lol but circumstances are a lil diff now

lag∞n, Tuesday, 28 April 2015 16:21 (ten years ago)

true

kelly O is young and can get better so he's def valuable, wallace is what he is but for one year w/ the cap going up thats a suitable cost-of-doing-business expiring

slothroprhymes, Tuesday, 28 April 2015 16:22 (ten years ago)

and he honestly might be a more valuable bench vet than perk, marion or miller

slothroprhymes, Tuesday, 28 April 2015 16:23 (ten years ago)

oh yeah hes easily better than those guys which is only to say he is better than totally useless

lag∞n, Tuesday, 28 April 2015 16:24 (ten years ago)

i mean i really have no idea what the market for love is, one year left on his deal, injured, coming off a truly terrible season

lag∞n, Tuesday, 28 April 2015 16:24 (ten years ago)

xp exactly!

trade also works with phil pressey if danny decided in this scenario that turner was worth one more shot

slothroprhymes, Tuesday, 28 April 2015 16:25 (ten years ago)

that's not a serious trade

J0rdan S., Tuesday, 28 April 2015 16:26 (ten years ago)

i assume

J0rdan S., Tuesday, 28 April 2015 16:26 (ten years ago)

it wld be p hilarious if both kelly and turner went to cleve as kelly effectively ended cleves title chase and bron made such a point of humiliating turner

lag∞n, Tuesday, 28 April 2015 16:26 (ten years ago)

that's not a serious trade

― J0rdan S., Tuesday, April 28, 2015 12:26 PM (15 seconds ago) Bookmark Flag Post Permalink

naw

lag∞n, Tuesday, 28 April 2015 16:27 (ten years ago)

i mean it cld be with a couple draft picks thrown in and i guess a third team as cleve prob doesnt want any draft picks

lag∞n, Tuesday, 28 April 2015 16:28 (ten years ago)

any trade would have to be a three team deal because i don't see what the lakers have that would entice the cavs

J0rdan S., Tuesday, 28 April 2015 16:28 (ten years ago)

how much of a reach/longshot is boston taking a run at LMA if he were to leave? that said as i type this, i'm aware it's potentially almost as ridiculous as the #futurelaker stuff...

slothroprhymes, Tuesday, 28 April 2015 16:29 (ten years ago)

why do you guys think people want to play for the celtics

J0rdan S., Tuesday, 28 April 2015 16:30 (ten years ago)

i kinda doubt cleve will be seeing any really game changing players coming in a love trade but they shd prob be just looking to add as many solid players as they can around bron and kyrie anyway

lag∞n, Tuesday, 28 April 2015 16:30 (ten years ago)

just love because its his destiny xp

lag∞n, Tuesday, 28 April 2015 16:31 (ten years ago)

wow slander

slothroprhymes, Tuesday, 28 April 2015 16:32 (ten years ago)

also think brad is developing a rep for a guy who knows how to get the most out of players, cld be enticing to love after what went down this year

lag∞n, Tuesday, 28 April 2015 16:32 (ten years ago)

but who knows maybe he just wants to go to la and shoot a bunch of threes for a shitty team

lag∞n, Tuesday, 28 April 2015 16:32 (ten years ago)

i still feel like the rockets are a fit for love and maybe there's a deal with terence jones and some other pieces that works

J0rdan S., Tuesday, 28 April 2015 16:33 (ten years ago)

love has a weird white destiny with boston but he's unique, shoutout to brad stevens but i don't think he's a free agent draw just yet

J0rdan S., Tuesday, 28 April 2015 16:33 (ten years ago)

the celtics have a legitimately top 5 coach and a potentially high ceiling for the future considering the conference they're in, they're not gonna attract kevin durant but neither are a lot of teams whose fans seem to think they might

slothroprhymes, Tuesday, 28 April 2015 16:34 (ten years ago)

depends if love has his heart set on being the 1st option or not re houston, def some similarities w cleve in that line up

lag∞n, Tuesday, 28 April 2015 16:35 (ten years ago)

dream celtics offseason wld be imo trading for love and singing hibbert or lopez

lag∞n, Tuesday, 28 April 2015 16:36 (ten years ago)

shoutout to brad stevens but i don't think he's a free agent draw just yet

and sock fisher/doddering phil is? and byron scott is?

slothroprhymes, Tuesday, 28 April 2015 16:36 (ten years ago)

xp which lopez

slothroprhymes, Tuesday, 28 April 2015 16:37 (ten years ago)

the good one of course

lag∞n, Tuesday, 28 April 2015 16:37 (ten years ago)

prokhorov sez he willing to break records for luxury tax excess, i think bropez might just take the cash but who knows

slothroprhymes, Tuesday, 28 April 2015 16:39 (ten years ago)

prokhorov shd just sell that team idk whats wrong w him

lag∞n, Tuesday, 28 April 2015 16:39 (ten years ago)

I don't see why Love would opt out and not wait it out for the new cap and if that I don't know why teams wouldn't wait a year to avoid losing him for nothing.

Cleveland for another year still feels most likely.

tsrobodo, Tuesday, 28 April 2015 16:40 (ten years ago)

xp reading a forbes article rn that implies he tried real hard to do so and failed in spectacular fashion

slothroprhymes, Tuesday, 28 April 2015 16:42 (ten years ago)

he wldnt opt out he wld demand a trade meaning his new team wld retain his bird rights allowing them to sign him to bigger contract when the salary cap goes up than if he left cleveland as a free agent, this is the path to the most possible money if he doesnt want to stay in cleveland xp

lag∞n, Tuesday, 28 April 2015 16:43 (ten years ago)

xp to self er, not implies, just says:

The main problem is that Prokhorov has not committed to selling a majority of the Nets and no one is apparently crazy enough to pay big money for a minority stake in a money-losing team. Such a deal would mean the new investor would have no say in how the Nets are run but would likely have to make cash payments to make up for the team’s red ink. As one banker who traded candor for anonymity put it, “No one knew what the deal was.” Apparently Evercore grew frustrated spending time and effort dealing with Prokhorov’s fishing expedition for a minority investor.

slothroprhymes, Tuesday, 28 April 2015 16:43 (ten years ago)

one wld suspect the new team wld demand certain assurance re loves desire to stay, either that or they get such a good deal they cant pass it up, either way they have an advantage in resigning him via being able to pay more

lag∞n, Tuesday, 28 April 2015 16:44 (ten years ago)

that actually says he does not want to sell the team lol

lag∞n, Tuesday, 28 April 2015 16:46 (ten years ago)

and sock fisher/doddering phil is? and byron scott is?

― slothroprhymes, Tuesday, April 28, 2015 12:36 PM (13 minutes ago) Bookmark

you're assuming that any coach is a free agent draw

J0rdan S., Tuesday, 28 April 2015 16:51 (ten years ago)

some def are but idk if its a huge % of the equation, im sure theres been a free agent who just loves one coach before but prob a lot who dont care that much

lag∞n, Tuesday, 28 April 2015 16:52 (ten years ago)

def riley seemed like a factor in the decision

lag∞n, Tuesday, 28 April 2015 16:53 (ten years ago)

if every power forward could play center they'd be a lot more valuable

― J0rdan S., Tuesday, April 28, 2015 12:00 PM (11 seconds ago) Bookmark Flag Post Permalink

many of them can!

― lag∞n, Tuesday, April 28, 2015 12:01 PM (49 minutes ago) Bookmark Flag Post Permalink

green is more than capable of playing small ball 5 btw, has done it a lot this year and their defense did not suffer. obv he can't guard the gasols or howards for 40 minutes tho

k3vin k., Tuesday, 28 April 2015 16:55 (ten years ago)

i mostly think any city that has a real winter is gonna have a hard time being a free agent draw except in unique situations

J0rdan S., Tuesday, 28 April 2015 16:56 (ten years ago)

its weird how the media always assumes players want to go home to play, seems like it wldnt actually be the best situation, lot of added pressure/distractions, tho on the other hand its cool to have yr people around, assume players have varying opinions on that

lag∞n, Tuesday, 28 April 2015 16:57 (ten years ago)

new york has winter

lag∞n, Tuesday, 28 April 2015 16:57 (ten years ago)

green is more than capable of playing small ball 5 btw, has done it a lot this year and their defense did not suffer. obv he can't guard the gasols or howards for 40 minutes tho

― k3vin k., Tuesday, April 28, 2015 12:55 PM (2 minutes ago) Bookmark Flag Post Permalink

ya this is highly situational

lag∞n, Tuesday, 28 April 2015 16:58 (ten years ago)

chicago has winter

lag∞n, Tuesday, 28 April 2015 16:58 (ten years ago)

lol yea quite a few cities with good teams have winter. chicago is by far colder than boston

slothroprhymes, Tuesday, 28 April 2015 17:01 (ten years ago)

I know love is good and getting him would be a classic buy low strategy but I've definitely soured on the dude after his crummy season and whining after spending a year whining about minny

Plus I'm not that psyched about a guy whose arms pop off like a Lego man when a reedy goofball tugs on them

juice college (agent hibachi), Tuesday, 28 April 2015 17:01 (ten years ago)

Obv I will wholeheartedly support him as a Celtic but I actually think hi s destiny is to do another year in Cleveland end that year with a bunch of passive aggressive quotes when they flame out and go hoist threes for an awful lakers team with Russell the following year

juice college (agent hibachi), Tuesday, 28 April 2015 17:03 (ten years ago)

Uh oh I just had a vision of him putting on 50 lbs by the 2017 season and lightly jogging from three line to three line and putting up shots...aka Rasheed 2.0

juice college (agent hibachi), Tuesday, 28 April 2015 17:04 (ten years ago)

ya cld be, p sad story tho lol

lag∞n, Tuesday, 28 April 2015 17:04 (ten years ago)

tho loves trajectory til now def involved a ton of hard work, much more likely he works to continue to improve his game than just lazes out imo, not sure he can really do that in cleve tho

lag∞n, Tuesday, 28 April 2015 17:06 (ten years ago)

the bulls are an exemption because chicago is a cool city

the knicks don't have a winter problem but they have other problems that the franchise and its fans continually overlook (celtics fans beware)

J0rdan S., Tuesday, 28 April 2015 17:10 (ten years ago)

cool city seems to be a bigger draw than warm weather

lag∞n, Tuesday, 28 April 2015 17:13 (ten years ago)

like what big recent free agent has gone to a non cool warm city, only dwight?

lag∞n, Tuesday, 28 April 2015 17:14 (ten years ago)

and he prob thinks houston is super cool anyway

lag∞n, Tuesday, 28 April 2015 17:15 (ten years ago)

which brings us to loves opinion of boston

http://i.imgur.com/sPDa688.jpg

lag∞n, Tuesday, 28 April 2015 17:15 (ten years ago)

if kelly olynyk saved boston from themselves by not getting love, they should retire his jersey.

Allen (etaeoe), Tuesday, 28 April 2015 17:22 (ten years ago)

i think boston is a cool city. :(

well ... i think somerville is a cool city.

Allen (etaeoe), Tuesday, 28 April 2015 17:22 (ten years ago)

lol

deadspin would have a 6-day circle jerk if love came here based on the amount of boston witeness jokes they'd be able to deploy

slothroprhymes, Tuesday, 28 April 2015 17:23 (ten years ago)

Plus I'm not that psyched about a guy whose arms pop off like a Lego man when a reedy goofball tugs on them

― juice college (agent hibachi), Tuesday, April 28, 2015 1:01 PM (24 minutes ago) Bookmark Flag Post Permalink

will imagine love as a lego man going forward, i think it works on many levels.

call all destroyer, Tuesday, 28 April 2015 17:35 (ten years ago)

lol

lag∞n, Tuesday, 28 April 2015 17:36 (ten years ago)

if kelly olynyk saved boston from themselves by not getting love, they should retire his jersey.

― Allen (etaeoe), Tuesday, April 28, 2015 1:22 PM (14 minutes ago) Bookmark Flag Post Permalink

love imo has proven over his career that he can be very effective if you use him the right way, what weve seen in cleveland is that hes not very versatile, which def is a problem and makes him less valuable than yr average player who has put up mvp level scoring/rebounding numbers, but if you can accommodate his game then hes a rare ptalent and the celtics wld be crazy not to get him if they have the opportunity imho, its not often you have the chance to pick a player with his abilities, and in fact prob the only reason they have even the hypothetical chance is because he was so miscast in cleveland

lag∞n, Tuesday, 28 April 2015 17:41 (ten years ago)

now if he can just get his defense to the generally in the right area level lol

lag∞n, Tuesday, 28 April 2015 17:42 (ten years ago)

goon put yr design skills to work, design lego kevin love

slothroprhymes, Tuesday, 28 April 2015 17:42 (ten years ago)

haha maybe later

lag∞n, Tuesday, 28 April 2015 17:43 (ten years ago)

ESPN Stats & Info ‏@ESPNStatsInfo 11s12 seconds ago
Spurs-Clippers Game 5 tonight
Chris Paul in wins this series: 33.0 PPG, 62 FG%
Chris Paul in losses this series: 14.0 PPG, 42 FG%

lag∞n, Tuesday, 28 April 2015 21:45 (ten years ago)

keep an eye on this guy chris paul folks im not personally too familiar with his work but some say he was the best player in the nba this year

lag∞n, Tuesday, 28 April 2015 21:52 (ten years ago)

its a shame for him & his savvy vet foul-draws that they will lose and he will not score as many buckets

slothroprhymes, Tuesday, 28 April 2015 21:58 (ten years ago)

it depends if he scores 33 points while shooting 62% then they will win but if he score 14 points while shooting 42% they will lose

lag∞n, Tuesday, 28 April 2015 21:59 (ten years ago)

either way itll be a wild game, im excited

god help us tho if it's rox-clips in round 2

slothroprhymes, Tuesday, 28 April 2015 22:06 (ten years ago)

http://bkref.com/tiny/jiqMo

3 minutes per game in the playoffs.

Matt Armstrong, Tuesday, 28 April 2015 22:24 (ten years ago)

ESPN Stats & Info ‏@ESPNStatsInfo 11s12 seconds ago
Spurs-Clippers Game 5 tonight
Chris Paul in wins this series: 33.0 PPG, 62 FG%
Chris Paul in losses this series: 14.0 PPG, 42 FG%

― lag∞n, Tuesday, April 28, 2015 5:45 PM (1 hour ago)

lol so dumb

k3vin k., Tuesday, 28 April 2015 22:57 (ten years ago)

who the heck is gonna come out of the east now, they're all so flawed

Clay, Tuesday, 28 April 2015 23:04 (ten years ago)

i mean my gut says chicago but... does it even matter?

Clay, Tuesday, 28 April 2015 23:04 (ten years ago)

only to your gastroenterologist

A True White Kid that can Jump (Granny Dainger), Tuesday, 28 April 2015 23:21 (ten years ago)

The Cavs are, duh.

Mr. Snrub, Tuesday, 28 April 2015 23:31 (ten years ago)

what's happened to the hawks?

was thabo the MVP after all?

#wegonnabechampionship (Spottie), Tuesday, 28 April 2015 23:36 (ten years ago)

lebron's usage rate in games w/o kevin love is ~40%

Clay, Tuesday, 28 April 2015 23:55 (ten years ago)

yea mileage is a concern especially after brilliant blatt has already overused him in the first round shutting down evan turner or jae crowder for 39 minutes a game

slothroprhymes, Wednesday, 29 April 2015 00:03 (ten years ago)

cavs are fucked imo

call all destroyer, Wednesday, 29 April 2015 00:05 (ten years ago)

Dubs/Wizards is gonna be great

polyphonic, Wednesday, 29 April 2015 00:06 (ten years ago)

brian windbaghorst on BS report was saying that mike miller & shawn marion & james jones could all be good for like 1 good game each and hit some big shots and simmons was more or less like "lol sure"

slothroprhymes, Wednesday, 29 April 2015 00:07 (ten years ago)

cavs are fucked imo

― call all destroyer, Tuesday, April 28, 2015 5:05 PM (2 minutes ago) Bookmark Flag Post Permalink

Clay, Wednesday, 29 April 2015 00:09 (ten years ago)

attn bise stylish brooklyn man at the gym tonight in a kawhi leonard tee u r trending

lag∞n, Wednesday, 29 April 2015 00:11 (ten years ago)

dont want to JINX ANYTHING but clearly it is a sign the spurs will def win tonight :)

lag∞n, Wednesday, 29 April 2015 00:11 (ten years ago)

alternate unis shd be illegal in the playoff u get arrested

lag∞n, Wednesday, 29 April 2015 00:13 (ten years ago)

my lawd the wiz offense with truth at 4 and porter at 3 is apparently the most efficient offense in the league by far in points per 100 poss.

slothroprhymes, Wednesday, 29 April 2015 00:13 (ten years ago)

aminu is playing p good huh?

lag∞n, Wednesday, 29 April 2015 00:13 (ten years ago)

pretty good double feature tonight huh

Clay, Wednesday, 29 April 2015 00:16 (ten years ago)

ya hope the mavs winnn

lag∞n, Wednesday, 29 April 2015 00:23 (ten years ago)

i think josh smith just hit a three

lag∞n, Wednesday, 29 April 2015 00:24 (ten years ago)

want to see monta go supernova rest of the series and mavs comeback from 0-3

lag∞n, Wednesday, 29 April 2015 00:25 (ten years ago)

want to see three teams come back from 0-3 why cause it wld be fun

lag∞n, Wednesday, 29 April 2015 00:29 (ten years ago)

its a wonder that a team starting dirk nowitzki and monta ellis doesnt give up 200 points every night

micah, Wednesday, 29 April 2015 00:37 (ten years ago)

not watching the game but it seems like every tweet and post is about how great the mavs are playing and...they're down 9 points

k3vin k., Wednesday, 29 April 2015 00:37 (ten years ago)

dont believe the tweets they lie

lag∞n, Wednesday, 29 April 2015 00:41 (ten years ago)

want to see three teams come back from 0-3 why cause it wld be fun

― lag∞n, Tuesday, April 28, 2015 5:29 PM (13 minutes ago) Bookmark Flag Post Permalink

portland is going to do this fyi i belieb

Clay, Wednesday, 29 April 2015 00:43 (ten years ago)

want to see three teams come back from 0-3 why cause it wld be fun
--lag∞n

I support this notion

slothroprhymes, Wednesday, 29 April 2015 00:44 (ten years ago)

after bucks/bulls this does not feel like a playoff game

micah, Wednesday, 29 April 2015 00:46 (ten years ago)

NBA on ESPN ‏@ESPNNBA 14s14 seconds ago
Dirk is 1-9 from the floor for the Mavericks. The rest of their starters are 12-23.

dirk got to be injured he has looked so off

lag∞n, Wednesday, 29 April 2015 00:59 (ten years ago)

he is old

Clay, Wednesday, 29 April 2015 01:01 (ten years ago)

same diff

lag∞n, Wednesday, 29 April 2015 01:01 (ten years ago)

i mean old just means u get injured a lot

lag∞n, Wednesday, 29 April 2015 01:01 (ten years ago)

yeah he looked good a couple days ago so who knows

Clay, Wednesday, 29 April 2015 01:02 (ten years ago)

i mean i have my off-days #midthirties

Clay, Wednesday, 29 April 2015 01:03 (ten years ago)

brian windbaghorst on BS report was saying that mike miller & shawn marion & james jones could all be good for like 1 good game each and hit some big shots and simmons was more or less like "lol sure"

― slothroprhymes, Tuesday, April 28, 2015 8:07 PM (52 minutes ago) Bookmark Flag Post Permalink

I listened to the first 20 min of this and for the first few minutes windhorst sounded like a guy who just heard his gf was in a car accident

The bench olds talk was totally the bargaining phase

juice college (agent hibachi), Wednesday, 29 April 2015 01:03 (ten years ago)

attn bise stylish brooklyn man at the gym tonight in a kawhi leonard tee u r trending

― lag∞n, Tuesday, April 28, 2015 8:11 PM (52 minutes ago) Bookmark Flag Post Permalink

Been seeing a lot of Spurs gear in bk over the last yr

juice college (agent hibachi), Wednesday, 29 April 2015 01:04 (ten years ago)

guh ellis just missed a point black fastbreak layup lead to a houston break

lag∞n, Wednesday, 29 April 2015 01:08 (ten years ago)

I refuse to watch the rockets triumph

Clay, Wednesday, 29 April 2015 01:11 (ten years ago)

its a 4 point game!

lag∞n, Wednesday, 29 April 2015 01:14 (ten years ago)

STOP GUILTING ME INTO PRACTICING FT'S CWEBB.

Jeff, Wednesday, 29 April 2015 01:20 (ten years ago)

fts are bad the players union shd mobilize to miss them all intentionally

lag∞n, Wednesday, 29 April 2015 01:21 (ten years ago)

this josh smith playing good nonsense is total nonsense

lag∞n, Wednesday, 29 April 2015 01:28 (ten years ago)

chris paul's pants and fedora are clashy as fuck, come on dude

call all destroyer, Wednesday, 29 April 2015 01:31 (ten years ago)

thats prob cliff paul the name of the guy who has only been scoring 14pts a game

lag∞n, Wednesday, 29 April 2015 01:32 (ten years ago)

what if cliff is the good one and original cp3 has become #old and #bad

slothroprhymes, Wednesday, 29 April 2015 01:39 (ten years ago)

too dark for me to consider

lag∞n, Wednesday, 29 April 2015 01:42 (ten years ago)

dirk gonna pass shaq on the all time scoring list next year :)

lag∞n, Wednesday, 29 April 2015 02:09 (ten years ago)

omg mavs have missed so many makable shots

lag∞n, Wednesday, 29 April 2015 02:10 (ten years ago)

yay dirk

corey brewer is ruining everything

slothroprhymes, Wednesday, 29 April 2015 02:26 (ten years ago)

why is brewer so good at fast breaking he needs to chill

lag∞n, Wednesday, 29 April 2015 02:28 (ten years ago)

marv taking the hubie tactic of pulling for the underdog

slothroprhymes, Wednesday, 29 April 2015 02:31 (ten years ago)

oh nooooo

slothroprhymes, Wednesday, 29 April 2015 02:32 (ten years ago)

wait nvm monta is ok :]

mavs really fighting for their lives this is so inspiring

slothroprhymes, Wednesday, 29 April 2015 02:40 (ten years ago)

they keep hanging around

lag∞n, Wednesday, 29 April 2015 02:40 (ten years ago)

classic case of just keeping hanging around

lag∞n, Wednesday, 29 April 2015 02:40 (ten years ago)

but oh crap now it's not inspiring

slothroprhymes, Wednesday, 29 April 2015 02:42 (ten years ago)

h8 rox

lag∞n, Wednesday, 29 April 2015 02:43 (ten years ago)

harden is that dude rn

brosario nawson (m bison), Wednesday, 29 April 2015 02:43 (ten years ago)

also if its rox clips r2, its clear the basketball lord has forsaken us

brosario nawson (m bison), Wednesday, 29 April 2015 02:44 (ten years ago)

UNCALLED FOUL AGAINST MONTA BURN IN HELL HOUSTON ROCKETS

slothroprhymes, Wednesday, 29 April 2015 02:44 (ten years ago)

mavs with a season-over possession despite only being down 6

call all destroyer, Wednesday, 29 April 2015 02:44 (ten years ago)

also if its rox clips r2, its clear the basketball lord has forsaken us

― brosario nawson (m bison), Tuesday, April 28, 2015 7:44 PM (21 seconds ago) Bookmark Flag Post Permalink

good won last year, it may just well be evil's turn

Clay, Wednesday, 29 April 2015 02:45 (ten years ago)

also if its rox clips r2, its clear the basketball lord has forsaken us
--brosario nawson (m bison)

otm

slothroprhymes, Wednesday, 29 April 2015 02:45 (ten years ago)

mavs cld just not do it

lag∞n, Wednesday, 29 April 2015 02:45 (ten years ago)

dirk is washhhhhhhed

brosario nawson (m bison), Wednesday, 29 April 2015 02:47 (ten years ago)

h-town acting like they won the chip rn

brosario nawson (m bison), Wednesday, 29 April 2015 02:47 (ten years ago)

yeah they're being very silly

call all destroyer, Wednesday, 29 April 2015 02:47 (ten years ago)

omg josh smith hittingkevin mchale

moullet, Wednesday, 29 April 2015 02:47 (ten years ago)

doesn't kevin mchale realize the evil he's unleashing :[ :[ how could the original 3 of the big 3 wreak this on us

slothroprhymes, Wednesday, 29 April 2015 02:48 (ten years ago)

looking forward to houston getting swept in rd2

head clowning instructor (art), Wednesday, 29 April 2015 02:48 (ten years ago)

rip dirk ;_;

Clay, Wednesday, 29 April 2015 02:49 (ten years ago)

honestly i wish i could summon up the hatred for the rockets that you guys possess but i just can't

call all destroyer, Wednesday, 29 April 2015 02:50 (ten years ago)

I mean I can understand appreciating the talent involved but idk what else is tolerable

slothroprhymes, Wednesday, 29 April 2015 02:51 (ten years ago)

o well rip dirk u r bad now, the real game is on

lag∞n, Wednesday, 29 April 2015 02:52 (ten years ago)

feeling the energy of this game both teams seem locked in

lag∞n, Wednesday, 29 April 2015 02:53 (ten years ago)

Blames baby euro step is so cute

, Wednesday, 29 April 2015 02:54 (ten years ago)

the rockets are fine. the mavericks have not been fun to watch in months so idk what everyone's problem is

k3vin k., Wednesday, 29 April 2015 02:56 (ten years ago)

i fucking love watching redick shoot

k3vin k., Wednesday, 29 April 2015 02:57 (ten years ago)

http://i.imgur.com/SiKkcym.png

lag∞n, Wednesday, 29 April 2015 02:57 (ten years ago)

tony parker is so fuckin washed

brosario nawson (m bison), Wednesday, 29 April 2015 02:58 (ten years ago)

blakes jumper wet 2nite

lag∞n, Wednesday, 29 April 2015 02:58 (ten years ago)

problem w rox is dwight & josh & beardo being gleeful little schoolyard bully shits and in dwight's case being a legit bad person and yeah you're not supposed to care about #likability but tbrr it's almost impossible not to.

slothroprhymes, Wednesday, 29 April 2015 03:00 (ten years ago)

almost never when im watching the rockets am i like this is fun to watch

lag∞n, Wednesday, 29 April 2015 03:01 (ten years ago)

i like brewer and beverly for being feisty weirdos but neither of them really have that much profile on that team

lag∞n, Wednesday, 29 April 2015 03:02 (ten years ago)

Oh my god splitters beard makes him look like a musketeer

, Wednesday, 29 April 2015 03:02 (ten years ago)

the rockets are fine. the mavericks have not been fun to watch in months so idk what everyone's problem is

― k3vin k., Tuesday, April 28, 2015 7:56 PM (5 minutes ago) Bookmark Flag Post Permalink

we love dirk he is a treasure he deserves more

Clay, Wednesday, 29 April 2015 03:03 (ten years ago)

like harden and dwight are prob the two least charismatic superstars of the last decade (not that dwight is that super anymore)

lag∞n, Wednesday, 29 April 2015 03:03 (ten years ago)

that rockets twitter post above is something else

Clay, Wednesday, 29 April 2015 03:04 (ten years ago)

ha yeah

lag∞n, Wednesday, 29 April 2015 03:04 (ten years ago)

free throws suck & harden can't stop himself from grinning like CAN YOU BELIEVE THEY BUY MY SHIT every time he get to the stripe, other players who draw fouls a lot as part of their game don't do that anywhere near as aggressively

fuck dwight

slothroprhymes, Wednesday, 29 April 2015 03:05 (ten years ago)

harden is kind of fascinating from a how the hell does he keep doing that pov but the things he does are often kinda dull to watch

lag∞n, Wednesday, 29 April 2015 03:06 (ten years ago)

harden's shit-eating grin is prob my most hated thing in the nba

like i prefer hearing about fave players needing knee surgery to harden's smile

Clay, Wednesday, 29 April 2015 03:07 (ten years ago)

wld read a 5000 word article explaining how harden scores all those points when he looks like hes moving at half the speed of everyone else tho

lag∞n, Wednesday, 29 April 2015 03:07 (ten years ago)

lol ilh is third result for james harden shit-eating grin

Clay, Wednesday, 29 April 2015 03:08 (ten years ago)

i dont hate harden i kind of like his deadpan smuging but his game is just not too exciting

lag∞n, Wednesday, 29 April 2015 03:09 (ten years ago)

his current taco bell comercial cracks me up he seems like he on pills

lag∞n, Wednesday, 29 April 2015 03:09 (ten years ago)

i love harden basically unconditionally, talk about someone who makes the game come to him

call all destroyer, Wednesday, 29 April 2015 03:09 (ten years ago)

that rockets twitter post above is something else

They shoot horses, don't they

, Wednesday, 29 April 2015 03:09 (ten years ago)

t/f harden is stoned approx 100% of hours he is not playing bball

Clay, Wednesday, 29 April 2015 03:10 (ten years ago)

if he was deadpan about it it'd be fine! cp3 is deadpan at the line when that happens and he draws a lot of fouls (his outbursts happen when not getting calls he's trying to fabricate tho)

slothroprhymes, Wednesday, 29 April 2015 03:10 (ten years ago)

also yes pills is otm, taco bell was an extremely logical endorsement for him

also that tweet is amazing

call all destroyer, Wednesday, 29 April 2015 03:10 (ten years ago)

o fuck that blake to dre oop

lag∞n, Wednesday, 29 April 2015 03:11 (ten years ago)

he went UP

lag∞n, Wednesday, 29 April 2015 03:11 (ten years ago)

Yooo

, Wednesday, 29 April 2015 03:12 (ten years ago)

Spurs look like they want to actively disappoint m bison

, Wednesday, 29 April 2015 03:12 (ten years ago)

/ballmer compulsively rubbing his gleaming scalp/

lag∞n, Wednesday, 29 April 2015 03:13 (ten years ago)

/ballmer compulsively rubbing his gleaming scalp/
--lag∞n

god help us all

slothroprhymes, Wednesday, 29 April 2015 03:13 (ten years ago)

i'm interested in the fact that there's the narrative that the spurs will get lma to be a successor to duncan when the ppl who actually need successors are parker and manu

call all destroyer, Wednesday, 29 April 2015 03:14 (ten years ago)

u just get the good players u can u know

lag∞n, Wednesday, 29 April 2015 03:15 (ten years ago)

what teh fuck happening here

slothroprhymes, Wednesday, 29 April 2015 03:16 (ten years ago)

def need to do something abt parker, he is so inconsistent and at best a tier 2 pg now

Clay, Wednesday, 29 April 2015 03:16 (ten years ago)

spurs done tho

brosario nawson (m bison), Wednesday, 29 April 2015 03:16 (ten years ago)

also duncan is a center an lma is a forward :)

lag∞n, Wednesday, 29 April 2015 03:16 (ten years ago)

and yeah, the spurs suddenly need a starting PG or at least a more reliable offense running backup

brosario nawson (m bison), Wednesday, 29 April 2015 03:16 (ten years ago)

i love patty thrills but he's a sg and cory is not enough of a credible scoring threat to lead the offense meaningfully

brosario nawson (m bison), Wednesday, 29 April 2015 03:17 (ten years ago)

lot of outrage on twitter about that rockets tweet, when did everyone become so touchy

k3vin k., Wednesday, 29 April 2015 03:17 (ten years ago)

dont worry spurs pop just took cp3 out the game will be tied in one min

lag∞n, Wednesday, 29 April 2015 03:18 (ten years ago)

when did everyone become so touchy

whoa check yr species privilege

Clay, Wednesday, 29 April 2015 03:18 (ten years ago)

i mean doc

lag∞n, Wednesday, 29 April 2015 03:18 (ten years ago)

you get the good players you can but if your backcourt is average at best that's gonna be a problem

call all destroyer, Wednesday, 29 April 2015 03:18 (ten years ago)

ayyyyyyyy spurs right there tho

brosario nawson (m bison), Wednesday, 29 April 2015 03:19 (ten years ago)

lot of outrage on twitter about that rockets tweet, when did everyone become so touchy

― k3vin k., Tuesday, April 28, 2015 11:17 PM (59 seconds ago) Bookmark Flag Post Permalink

smh

call all destroyer, Wednesday, 29 April 2015 03:19 (ten years ago)

well obvs they need to revamp the team at some point but lma & kawhi is not a bad place to start

lag∞n, Wednesday, 29 April 2015 03:19 (ten years ago)

Yo clipps... Here's a tip *the whole team leans in* Manus gonna go left

, Wednesday, 29 April 2015 03:19 (ten years ago)

dont worry spurs doc just took cp3 out the game will be tied in one min

― lag∞n, Tuesday, April 28, 2015 11:18 PM (1 minute ago) Bookmark Flag Post Permalink

:)

lag∞n, Wednesday, 29 April 2015 03:19 (ten years ago)

lma 100% needs a good p&r partner to play at a high level, kawhi aint that guy

Clay, Wednesday, 29 April 2015 03:20 (ten years ago)

chris paul comes out and the clippers manage to lose 7 points of their lead in 90 seconds...

k3vin k., Wednesday, 29 April 2015 03:21 (ten years ago)

lol guess i'm just casually posting abt lma on other teams now what's going on

Clay, Wednesday, 29 April 2015 03:21 (ten years ago)

lol, splitter def a musketeer

moullet, Wednesday, 29 April 2015 03:21 (ten years ago)

do ppl itt not trust the spurs to build around those two (clay gets a pass obvs)

lag∞n, Wednesday, 29 April 2015 03:21 (ten years ago)

2 point clipper lead

k3vin k., Wednesday, 29 April 2015 03:22 (ten years ago)

remember when the clippers were winning

J0rdan S., Wednesday, 29 April 2015 03:23 (ten years ago)

feel like the only person giving me credit for predicting perfectly that clips collapse is me which is just rude

lag∞n, Wednesday, 29 April 2015 03:23 (ten years ago)

i def would be intrigued by lma/kawhi but a.) aldridge is like 7 years older than kawhi which isn't ideal b.) trust me aldridge is really not great when he doesn't have an elite-level p&r partner c.f. the year the blazers played raymond felton 34 mpg

Clay, Wednesday, 29 April 2015 03:24 (ten years ago)

clips literally blew a 12 point lead in 2 minutes while cp3 sat, this is criminal

k3vin k., Wednesday, 29 April 2015 03:24 (ten years ago)

Spurs got the most boring kicks

, Wednesday, 29 April 2015 03:24 (ten years ago)

Spurs look like they shop at modells :(

, Wednesday, 29 April 2015 03:25 (ten years ago)

im gonna go ahead and order my lma spurs jersey and let pop figure out how to make that shit work

brosario nawson (m bison), Wednesday, 29 April 2015 03:25 (ten years ago)

prob the best course of action

lag∞n, Wednesday, 29 April 2015 03:25 (ten years ago)

do ppl itt not trust the spurs to build around those two (clay gets a pass obvs)

― lag∞n, Tuesday, April 28, 2015 11:21 PM (1 minute ago) Bookmark Flag Post Permalink

it's not that i don't trust them, i'm sure they're well aware of the trajectory of their backcourt. i just think the way that it's getting presented in the media doesn't make a ton of sense.

call all destroyer, Wednesday, 29 April 2015 03:26 (ten years ago)

like having two all star forwards on your team is a really good problem to have

brosario nawson (m bison), Wednesday, 29 April 2015 03:27 (ten years ago)

Manu just tried to do a shammgod let me leave this cursed earth without pain

, Wednesday, 29 April 2015 03:27 (ten years ago)

hattrick thrills reporting for duty

brosario nawson (m bison), Wednesday, 29 April 2015 03:27 (ten years ago)

it will honestly be hard for lma to leave portland after the emotional surge that comes along with being the first team to win a series after being down 0-3

Clay, Wednesday, 29 April 2015 03:27 (ten years ago)

patty mills the GOAT

J0rdan S., Wednesday, 29 April 2015 03:28 (ten years ago)

i pulled off a pretty nice semi-transition shammgod in a crunch time sitch in pickup today /braggin

k3vin k., Wednesday, 29 April 2015 03:28 (ten years ago)

austin rivers O_O

k3vin k., Wednesday, 29 April 2015 03:28 (ten years ago)

lol austin o mannnn

but jamal gonna jamal

slothroprhymes, Wednesday, 29 April 2015 03:29 (ten years ago)

i just don't get it. paul can't go 44 minutes?

k3vin k., Wednesday, 29 April 2015 03:29 (ten years ago)

he has commercials to film

Clay, Wednesday, 29 April 2015 03:29 (ten years ago)

i pulled off a pretty nice semi-transition shammgod in a crunch time sitch in pickup today /braggin

― k3vin k., Tuesday, April 28, 2015 11:28 PM (12 seconds ago) Bookmark Flag Post Permalink

doesnt count unless u yell SHAMGOD fyi

lag∞n, Wednesday, 29 April 2015 03:30 (ten years ago)

Farmer Jones ‏@thefarmerjones 45s46 seconds ago
This is messed up.
RT @spurs 🔌🛁💣🙌👵
Hey Clippers. We're gonna electrocute you in your bathtub & then bomb your grandma's house.

^^wow spurs wtf

k3vin k., Wednesday, 29 April 2015 03:30 (ten years ago)

lmao

lag∞n, Wednesday, 29 April 2015 03:31 (ten years ago)

theres a reasonable chance that paul cant go 44mins but id try it anyway

lag∞n, Wednesday, 29 April 2015 03:31 (ten years ago)

btw bise malik rose retweeted me yesterday

k3vin k., Wednesday, 29 April 2015 03:32 (ten years ago)

i hate malik rose tho tbh, at least his radio game

k3vin k., Wednesday, 29 April 2015 03:32 (ten years ago)

lol nice

lag∞n, Wednesday, 29 April 2015 03:32 (ten years ago)

irl dying at that fake tweet

slothroprhymes, Wednesday, 29 April 2015 03:33 (ten years ago)

i pulled off a pretty nice semi-transition shammgod in a crunch time sitch in pickup today /braggin

― k3vin k., Tuesday, April 28, 2015 11:28 PM (12 seconds ago) Bookmark Flag Post Permalink

doesnt count unless u yell SHAMGOD fyi

Uhmm excuse me its shammgod

, Wednesday, 29 April 2015 03:33 (ten years ago)

w/e man im 2 busy 2 spell

lag∞n, Wednesday, 29 April 2015 03:33 (ten years ago)

crazy how the clippers start to play better once paul checks back in

k3vin k., Wednesday, 29 April 2015 03:35 (ten years ago)

its weird

lag∞n, Wednesday, 29 April 2015 03:35 (ten years ago)

aw bad call

k3vin k., Wednesday, 29 April 2015 03:38 (ten years ago)

anyone ever done a "wow shammwow" dn?

brosario nawson (m bison), Wednesday, 29 April 2015 03:38 (ten years ago)

Wow investigate the refs

, Wednesday, 29 April 2015 03:38 (ten years ago)

srsly theyve called like 5 3sec violations on the clips

lag∞n, Wednesday, 29 April 2015 03:39 (ten years ago)

im ok wit this officiating

brosario nawson (m bison), Wednesday, 29 April 2015 03:39 (ten years ago)

anyone ever done a "wow shammwow" dn?

Don't do it

, Wednesday, 29 April 2015 03:40 (ten years ago)

man hasselhoff is at this game? cmon hoops god, are you there? its me m bison

brosario nawson (m bison), Wednesday, 29 April 2015 03:40 (ten years ago)

weak

http://i.imgur.com/f7Pg0fW.png

lag∞n, Wednesday, 29 April 2015 03:41 (ten years ago)

i think kawhi is my fav player of all time now???

brosario nawson (m bison), Wednesday, 29 April 2015 03:42 (ten years ago)

lol pop so sassy with bonner

k3vin k., Wednesday, 29 April 2015 03:43 (ten years ago)

hack a jordan starting early

slothroprhymes, Wednesday, 29 April 2015 03:45 (ten years ago)

IM ABOUT THIS GAME RN

brosario nawson (m bison), Wednesday, 29 April 2015 03:46 (ten years ago)

they have to take DAJ out

k3vin k., Wednesday, 29 April 2015 03:46 (ten years ago)

lol oh man bonner patting DAJ on the back like "you my dude I hate it have to be you"

slothroprhymes, Wednesday, 29 April 2015 03:46 (ten years ago)

wow why would you foul to take DAJ out....

k3vin k., Wednesday, 29 April 2015 03:47 (ten years ago)

honestly don't think the Spurs can beat the cp3/blake combo, feel like the game is gonna come down to whether doc realizes that too

J0rdan S., Wednesday, 29 April 2015 03:51 (ten years ago)

sounds abt right

lag∞n, Wednesday, 29 April 2015 03:51 (ten years ago)

i dunno if austin could just get the chance to show what he can do...

k3vin k., Wednesday, 29 April 2015 03:53 (ten years ago)

clips ignoring parker off the ball

k3vin k., Wednesday, 29 April 2015 03:54 (ten years ago)

reggie's ability to stick with his story even when the replay is clearly showing the opposite is amazing

k3vin k., Wednesday, 29 April 2015 03:55 (ten years ago)

ha yeah one of his hallmarks for sure

lag∞n, Wednesday, 29 April 2015 03:56 (ten years ago)

gotta have consistency.

duncan fired tf up against cp3, paul obv doesn't know he brought a knife to a tank fight there

slothroprhymes, Wednesday, 29 April 2015 03:57 (ten years ago)

this series is dooooope

lag∞n, Wednesday, 29 April 2015 03:58 (ten years ago)

i want more marco

oh and cory. cory is a serious guy none of this tony extravaganza

moullet, Wednesday, 29 April 2015 04:04 (ten years ago)

mills-manu backcourt is just so much more effective on offense than tp-danny green right now

brosario nawson (m bison), Wednesday, 29 April 2015 04:12 (ten years ago)

cp3 with 6 pts on 2-6 shooting at the half. good development

brosario nawson (m bison), Wednesday, 29 April 2015 04:14 (ten years ago)

lol barnes just called a kick ball on himself

lag∞n, Wednesday, 29 April 2015 04:20 (ten years ago)

clippers are playing great defense

k3vin k., Wednesday, 29 April 2015 04:20 (ten years ago)

yep

lag∞n, Wednesday, 29 April 2015 04:21 (ten years ago)

you know it's cool the nba is doing something for women by supporting lean in but i wish they were throwing their weight behind an org that isn't basically like "u kno what will fix the problems caused by patriarchy? more capitalism" bc i am doubtful of that

Clay, Wednesday, 29 April 2015 04:23 (ten years ago)

same

lag∞n, Wednesday, 29 April 2015 04:23 (ten years ago)

thirdedded

brosario nawson (m bison), Wednesday, 29 April 2015 04:24 (ten years ago)

clips have given up way too many offensive boards

k3vin k., Wednesday, 29 April 2015 04:27 (ten years ago)

tony showing some hustle finally

brosario nawson (m bison), Wednesday, 29 April 2015 04:27 (ten years ago)

jeez chris that was a stupid foul

k3vin k., Wednesday, 29 April 2015 04:28 (ten years ago)

man that duncan spin was so pretty so bummed the layup didn't go

slothroprhymes, Wednesday, 29 April 2015 04:28 (ten years ago)

lol tony cant even break down dre on the perimeter

lag∞n, Wednesday, 29 April 2015 04:28 (ten years ago)

yeah that was sad to see

brosario nawson (m bison), Wednesday, 29 April 2015 04:28 (ten years ago)

But he is a perennial DPOY candidate.

A-Hanisi Coates (Leee), Wednesday, 29 April 2015 04:33 (ten years ago)

maybe paul is tired. he's dying on these high screens

k3vin k., Wednesday, 29 April 2015 04:34 (ten years ago)

young tony blazes by a stranded C in the old days, tho

brosario nawson (m bison), Wednesday, 29 April 2015 04:35 (ten years ago)

dre doesnt have the quickest feet

lag∞n, Wednesday, 29 April 2015 04:36 (ten years ago)

good call tbh

k3vin k., Wednesday, 29 April 2015 04:37 (ten years ago)

this is a real damn series rn

Clay, Wednesday, 29 April 2015 04:37 (ten years ago)

jordan is changing like every shot

Clay, Wednesday, 29 April 2015 04:37 (ten years ago)

he's been huge in this series, he disrupts tony's ability to create

brosario nawson (m bison), Wednesday, 29 April 2015 04:40 (ten years ago)

hacka giving paul some nice rest

lag∞n, Wednesday, 29 April 2015 04:41 (ten years ago)

shhhh no it isnt he still has to stand and shit

brosario nawson (m bison), Wednesday, 29 April 2015 04:43 (ten years ago)

patty mills is built for that playoff life

brosario nawson (m bison), Wednesday, 29 April 2015 04:44 (ten years ago)

ooooooof damn

Clay, Wednesday, 29 April 2015 04:46 (ten years ago)

what if you could just decline shooting FTs, take the ball out on the side but it counts as a foul for the player and the team

A True White Kid that can Jump (Granny Dainger), Wednesday, 29 April 2015 04:46 (ten years ago)

oh nah that looked way worse than it was xp to me

Clay, Wednesday, 29 April 2015 04:47 (ten years ago)

good idea imo xp

lag∞n, Wednesday, 29 April 2015 04:47 (ten years ago)

fastbreak duncan is my fav duncan

brosario nawson (m bison), Wednesday, 29 April 2015 04:48 (ten years ago)

harlan seriously pissed at the ft situation!

Clay, Wednesday, 29 April 2015 04:52 (ten years ago)

omg tha paul fake shot dish

lag∞n, Wednesday, 29 April 2015 04:54 (ten years ago)

yooooo austin lol

lag∞n, Wednesday, 29 April 2015 04:57 (ten years ago)

double clang

polyphonic, Wednesday, 29 April 2015 05:01 (ten years ago)

danny green powers activate

brosario nawson (m bison), Wednesday, 29 April 2015 05:02 (ten years ago)

WOW CP3

k3vin k., Wednesday, 29 April 2015 05:05 (ten years ago)

cp3 jesus christ

lag∞n, Wednesday, 29 April 2015 05:06 (ten years ago)

shoooooooooooo

brosario nawson (m bison), Wednesday, 29 April 2015 05:08 (ten years ago)

man the refs are straight on the spurs payroll i'm sorry

k3vin k., Wednesday, 29 April 2015 05:10 (ten years ago)

how about the rim tho

slothroprhymes, Wednesday, 29 April 2015 05:11 (ten years ago)

idgaf, refs being on spurs side doing the hoops lord's work on earth

brosario nawson (m bison), Wednesday, 29 April 2015 05:12 (ten years ago)

k3vin k.
Posted: April 29, 2015 at 1:10:02 AM
man the refs are straight on the spurs payroll i'm sorry

srsly

lag∞n, Wednesday, 29 April 2015 05:20 (ten years ago)

that T on paul...

k3vin k., Wednesday, 29 April 2015 05:21 (ten years ago)

cp3 is in that do it al myself mode he gets in

Clay, Wednesday, 29 April 2015 05:22 (ten years ago)

wow fucking crawford lies on the ground and complains about a no-call while the spurs push the ball 5-on-4 and get a wide open 3, what a fucking asshole

k3vin k., Wednesday, 29 April 2015 05:23 (ten years ago)

i'm pissed lol

k3vin k., Wednesday, 29 April 2015 05:24 (ten years ago)

jamal has been awful no idea why hes in there

lag∞n, Wednesday, 29 April 2015 05:24 (ten years ago)

Diaw dagger

Premise ridiculous. Who have two potato? (forksclovetofu), Wednesday, 29 April 2015 05:24 (ten years ago)

doc has to yank crawford for barnes after that

k3vin k., Wednesday, 29 April 2015 05:25 (ten years ago)

or his kid lol

k3vin k., Wednesday, 29 April 2015 05:25 (ten years ago)

omg that diaw shot -_-

Clay, Wednesday, 29 April 2015 05:26 (ten years ago)

I SAID DIAW DAGGER

Premise ridiculous. Who have two potato? (forksclovetofu), Wednesday, 29 April 2015 05:26 (ten years ago)

the spurs have just won every 50/50 ball it's crazy

k3vin k., Wednesday, 29 April 2015 05:26 (ten years ago)

go away forks

lag∞n, Wednesday, 29 April 2015 05:27 (ten years ago)

ya nothing going the clips way this hame

lag∞n, Wednesday, 29 April 2015 05:27 (ten years ago)

cp3 tryina will them back in

brosario nawson (m bison), Wednesday, 29 April 2015 05:28 (ten years ago)

wow what a fucking play

k3vin k., Wednesday, 29 April 2015 05:29 (ten years ago)

blake has something like 28-13-8 this game, which is about what he is averaging for the series

k3vin k., Wednesday, 29 April 2015 05:30 (ten years ago)

yeah dang that play

lag∞n, Wednesday, 29 April 2015 05:30 (ten years ago)

Deandre kinda impossible to do anything against there

Premise ridiculous. Who have two potato? (forksclovetofu), Wednesday, 29 April 2015 05:30 (ten years ago)

clips really aren't getting ANY calls at all

Clay, Wednesday, 29 April 2015 05:32 (ten years ago)

omg f deez refs

lag∞n, Wednesday, 29 April 2015 05:32 (ten years ago)

there's no way blake isn't hacked like 4 times on that second shot

Clay, Wednesday, 29 April 2015 05:33 (ten years ago)

i mean there needs to be an apology from the NBA after this game about the officiating

k3vin k., Wednesday, 29 April 2015 05:33 (ten years ago)

i need to like call my HR and change my health insurance plan after this game

brosario nawson (m bison), Wednesday, 29 April 2015 05:33 (ten years ago)

meanwhile redick breathed on parker and immediate whistle

Clay, Wednesday, 29 April 2015 05:33 (ten years ago)

go crawford is back in

k3vin k., Wednesday, 29 April 2015 05:35 (ten years ago)

omg*

k3vin k., Wednesday, 29 April 2015 05:35 (ten years ago)

well jj fouled out not
much choice

lag∞n, Wednesday, 29 April 2015 05:36 (ten years ago)

fn hell this game

lag∞n, Wednesday, 29 April 2015 05:37 (ten years ago)

wow @ blake missing two big ones, but clips got a second and third chance

brosario nawson (m bison), Wednesday, 29 April 2015 05:37 (ten years ago)

oh jeez blake

k3vin k., Wednesday, 29 April 2015 05:37 (ten years ago)

oh didn't realize jj fouled out

k3vin k., Wednesday, 29 April 2015 05:37 (ten years ago)

austin rivers is in for defensive purposes

k3vin k., Wednesday, 29 April 2015 05:38 (ten years ago)

smh lol

lag∞n, Wednesday, 29 April 2015 05:38 (ten years ago)

if the clips pull this out, oh man

Clay, Wednesday, 29 April 2015 05:39 (ten years ago)

holy shit, rivers had one job not to lose danny green, and he falls asleep on him

k3vin k., Wednesday, 29 April 2015 05:39 (ten years ago)

follow your shot, danny

A True White Kid that can Jump (Granny Dainger), Wednesday, 29 April 2015 05:39 (ten years ago)

cant breathe

lag∞n, Wednesday, 29 April 2015 05:39 (ten years ago)

danny green powers deactivate

brosario nawson (m bison), Wednesday, 29 April 2015 05:39 (ten years ago)

Ballmer looking like a kid who has been told santa is on the roof

Premise ridiculous. Who have two potato? (forksclovetofu), Wednesday, 29 April 2015 05:40 (ten years ago)

wow deandre

k3vin k., Wednesday, 29 April 2015 05:41 (ten years ago)

ouch

Clay, Wednesday, 29 April 2015 05:41 (ten years ago)

HOOPS GOD SMILIN ON MEH

brosario nawson (m bison), Wednesday, 29 April 2015 05:41 (ten years ago)

did he even touch it?

k3vin k., Wednesday, 29 April 2015 05:41 (ten years ago)

fuck

lag∞n, Wednesday, 29 April 2015 05:42 (ten years ago)

he touched it

lag∞n, Wednesday, 29 April 2015 05:42 (ten years ago)

arghhhh

k3vin k., Wednesday, 29 April 2015 05:42 (ten years ago)

that completely goes in if deandre doesn't touch it

Clay, Wednesday, 29 April 2015 05:42 (ten years ago)

what is doc even arguing right now. coach your team

k3vin k., Wednesday, 29 April 2015 05:43 (ten years ago)

http://giant.gfycat.com/EsteemedInfantileEquestrian.gif

not the first game deandre cost the clippers

Clay, Wednesday, 29 April 2015 05:43 (ten years ago)

hahahaha ballmer has to explain to some other rich mfer what the rule is

k3vin k., Wednesday, 29 April 2015 05:43 (ten years ago)

wow can't get the rebound, amazing

k3vin k., Wednesday, 29 April 2015 05:46 (ten years ago)

KAWHI CLUTCH BOARD

brosario nawson (m bison), Wednesday, 29 April 2015 05:46 (ten years ago)

That'll do it. Good game.

Premise ridiculous. Who have two potato? (forksclovetofu), Wednesday, 29 April 2015 05:46 (ten years ago)

woulda got it if doc had coached them more

A True White Kid that can Jump (Granny Dainger), Wednesday, 29 April 2015 05:46 (ten years ago)

smh this game kicked the clips right in the nuts

lag∞n, Wednesday, 29 April 2015 05:46 (ten years ago)

GAME

brosario nawson (m bison), Wednesday, 29 April 2015 05:47 (ten years ago)

wow spurs missing free throws but actually boxing out. flip the narrative!

J0rdan S., Wednesday, 29 April 2015 05:47 (ten years ago)

WINNING TIME

brosario nawson (m bison), Wednesday, 29 April 2015 05:47 (ten years ago)

don't feel v good abt that win

Clay, Wednesday, 29 April 2015 05:48 (ten years ago)

feel like cp3 not taking any shots after that and 1 was perhaps unwise

J0rdan S., Wednesday, 29 April 2015 05:48 (ten years ago)

yo sorry lagoon and sorry bout yalls integrity of the game type of way but fuuuuuuuck everybody spurs por vida

brosario nawson (m bison), Wednesday, 29 April 2015 05:48 (ten years ago)

kawhi blatantly fouled cp3 right in front of the ref on that last inbound. culmination of an atrociously one-sided game

k3vin k., Wednesday, 29 April 2015 05:49 (ten years ago)

https://vine.co/v/e7u6mYDjDDm

watch austin rivers with the textbook example of how to box out the shooter on a crucial foul shot

k3vin k., Wednesday, 29 April 2015 05:51 (ten years ago)

people will forget that after cp's and 1 the spurs couldn't get a clean look in the final few possessions to save their lives.

J0rdan S., Wednesday, 29 April 2015 05:52 (ten years ago)

the had a basket waved off cause dre grazed it w his finger for no reason

lag∞n, Wednesday, 29 April 2015 05:53 (ten years ago)

the ball was rimming out

J0rdan S., Wednesday, 29 April 2015 05:54 (ten years ago)

maaybe

lag∞n, Wednesday, 29 April 2015 05:55 (ten years ago)

pop rn "i dont know how you describe a win. it's better than a loss."

Clay, Wednesday, 29 April 2015 05:55 (ten years ago)

lol

lag∞n, Wednesday, 29 April 2015 05:55 (ten years ago)

whether it was going in is irrelevant, he touched it in the cylinder. dumb play either way. not to mention kawhi getting away with tackling cp3 off the ball. and every other horrible call that went the spurs' way

k3vin k., Wednesday, 29 April 2015 05:55 (ten years ago)

the spurs trapped cp immediately in those final few possessions and i guess the clips were ok with letting blake make plays. it almost worked!

J0rdan S., Wednesday, 29 April 2015 05:55 (ten years ago)

not sure ive ever seen a game where everything went so throughly against one team and it still came down to the wire

lag∞n, Wednesday, 29 April 2015 05:56 (ten years ago)

whether it was going in is irrelevant

― k3vin k., Wednesday, April 29, 2015 1:55 AM (43 seconds ago) Bookmark Flag Post Permalink

its not irrelevant to the conversation we were having

lag∞n, Wednesday, 29 April 2015 05:56 (ten years ago)

timmy stuffing blake was the dopest thing i've ever seen

if the clips lose game 6 that second half is really gonna loom over blake's career for a while

J0rdan S., Wednesday, 29 April 2015 05:57 (ten years ago)

tough to fault DJ for trying to do what he's paid to do. if he touches it .1 seconds later, he's a hero.

A True White Kid that can Jump (Granny Dainger), Wednesday, 29 April 2015 05:57 (ten years ago)

autin rivers playing crunch time minutes in this series is killing me

Clay, Wednesday, 29 April 2015 05:57 (ten years ago)

i'm so angry right now i need to wake up for work in 5 hours i should really chill lol

k3vin k., Wednesday, 29 April 2015 05:57 (ten years ago)

if the clips lose game 6 that second half is really gonna loom over blake's career for a while

― J0rdan S., Wednesday, April 29, 2015 1:57 AM (5 seconds ago) Bookmark Flag Post Permalink

lol k

lag∞n, Wednesday, 29 April 2015 05:58 (ten years ago)

do u remember that game where u put up 30-14-7 yr second half was bad its looming

lag∞n, Wednesday, 29 April 2015 05:59 (ten years ago)

http://i.imgur.com/Zozf4Bk.png

lol

lag∞n, Wednesday, 29 April 2015 06:01 (ten years ago)

in gm 5 of 1st round tho

A True White Kid that can Jump (Granny Dainger), Wednesday, 29 April 2015 06:02 (ten years ago)

man watching that tap-in play again blake had a really easy situation to lob to DAJ for an alley-oop, obv it was a split-second decision, but tony parker was on DAJ

k3vin k., Wednesday, 29 April 2015 06:03 (ten years ago)

if the clips lose game 6 that second half is really gonna loom over blake's career for a while

― J0rdan S., Wednesday, April 29, 2015 1:57 AM (5 seconds ago) Bookmark Flag Post Permalink

lol k

he shot like 2-9 in the second half, gagged two huge free throws and got stuffed by a guy who's like 85 years old. it was really bad.

J0rdan S., Wednesday, 29 April 2015 06:03 (ten years ago)

in gm 5 of 1st round tho

― A True White Kid that can Jump (Granny Dainger), Wednesday, April 29, 2015 2:02 AM (21 seconds ago)

he's putting up a 30-13-7 against tim duncan and the defending champs, fuck does it matter which round it is

k3vin k., Wednesday, 29 April 2015 06:03 (ten years ago)

doc's presser is basically "we lost bc of the refs sorry"

Clay, Wednesday, 29 April 2015 06:04 (ten years ago)

i think the clippers would have gotten a worse shot anyway had cp gotten the ball on that last possession. he would've been moving away from the basket, catching the ball at like half court, with kawhi on him, with 4 seconds left.

J0rdan S., Wednesday, 29 April 2015 06:05 (ten years ago)

doc's presser is basically "we lost bc of the refs sorry"

― Clay, Wednesday, April 29, 2015 2:04 AM (44 seconds ago) Bookmark Flag Post Permalink

good as opportunity as any to just take the fine

lag∞n, Wednesday, 29 April 2015 06:05 (ten years ago)

well hopefully chris paul can find some balls to punch on the way home so he can sleep in peace

J0rdan S., Wednesday, 29 April 2015 06:06 (ten years ago)

yeah figured that's the strategy, i mean someone's gotta say something xp

Clay, Wednesday, 29 April 2015 06:06 (ten years ago)

go to bed jordan

lag∞n, Wednesday, 29 April 2015 06:07 (ten years ago)

i think the clippers would have gotten a worse shot anyway had cp gotten the ball on that last possession. he would've been moving away from the basket, catching the ball at like half court, with kawhi on him, with 4 seconds left.

― J0rdan S., Wednesday, April 29, 2015 2:05 AM (1 minute ago)

1) he was absolutely carving the spurs up with the high pick and roll
2) it was like 6.8 seconds
3) he was fouled off the ball

k3vin k., Wednesday, 29 April 2015 06:07 (ten years ago)

"I don't complain much but I think we got some really tough calls tonight"

This fucking guy lol

Matt Armstrong, Wednesday, 29 April 2015 06:07 (ten years ago)

his nba epitaph should read "here lies chris paul, a transcendent talent who will instead be remembered as a borderline cheat. he never made the conference finals."

― le goon (J0rdan S.), Tuesday, May 13, 2014 9:53 PM (11 months ago) Bookmark Flag Post Permalink

i think of this j0rdan post literally every time i watch cp3 play btw

Clay, Wednesday, 29 April 2015 06:08 (ten years ago)

>:{

k3vin k., Wednesday, 29 April 2015 06:09 (ten years ago)

he will be remembered as a board line cheat by like 3 strangely obsessed message board posters at least one of whom thinks kobe bryant is like omg the best

lag∞n, Wednesday, 29 April 2015 06:09 (ten years ago)

i mean blake with a clean run at the rim with deandre only having to box out a point guard is pretty good offense, they basically just caught a bad bounce off the rim

J0rdan S., Wednesday, 29 April 2015 06:10 (ten years ago)

one of the others just has a bad prediction stuck in his head for some reason

lag∞n, Wednesday, 29 April 2015 06:10 (ten years ago)

he won't be remembered as a borderline cheat but he will be remembered as a guy who could never get past the second round, that's not really a discussion

J0rdan S., Wednesday, 29 April 2015 06:11 (ten years ago)

ha I don't necessarily agree I just love that post for some reason, love scorched earth j0rdan basically

Clay, Wednesday, 29 April 2015 06:11 (ten years ago)

u realize he still plays in the nba right

lag∞n, Wednesday, 29 April 2015 06:12 (ten years ago)

Jord is right, b griff got stonewalled by old man river in the clutch. No one cares what Karl Malone did in the rest of game 6, they just remember MJ stripping the ball from him. This isn't an elimination game so it's a minor scale but that stat line he had doesn't mean shit.

Matt Armstrong, Wednesday, 29 April 2015 06:12 (ten years ago)

also like this guy will be remembered for a stupid thing that ppl who dont understand the game think is not a very impressive thing to gloat over!

lag∞n, Wednesday, 29 April 2015 06:13 (ten years ago)

he's putting up a 30-13-7 against tim duncan and the defending champs, fuck does it matter which round it is

was a joke chill

A True White Kid that can Jump (Granny Dainger), Wednesday, 29 April 2015 06:14 (ten years ago)

blake also got the ball back and was promptly fouled u guys r so dumb with yr instant mythologizing

lag∞n, Wednesday, 29 April 2015 06:14 (ten years ago)

uncalled foul btw, which fits the pattern of the actually most noteworthy thing abt this game

lag∞n, Wednesday, 29 April 2015 06:15 (ten years ago)

i mean cp is gonna be defined by what he didn't accomplish

also like /this guy will be remembered for a stupid thing that ppl who dont understand the game think/ is not a very impressive thing to gloat over!

there's many players across sports who didn't win titles and that ended up defining their careers to some extent and chris paul will be one of those players, if he doesn't. there are worse things, of course.

J0rdan S., Wednesday, 29 April 2015 06:15 (ten years ago)

haha blake was not fouled, he got the ball stripped before he went up

J0rdan S., Wednesday, 29 April 2015 06:16 (ten years ago)

JORDAN HIS CAREER HIS ONGOING DO U UNDERSTAND THE CONCEPT OF TIME

lag∞n, Wednesday, 29 April 2015 06:16 (ten years ago)

also u r straight up repping for one of the stupidest most pointless uninteresting things abt sports

lag∞n, Wednesday, 29 April 2015 06:17 (ten years ago)

i mean, obviously if chris paul wins something, what i'm saying will be irrelevant. i don't think i need to add a disclaimer..................

J0rdan S., Wednesday, 29 April 2015 06:17 (ten years ago)

does grantland have comments go post this garbage there

lag∞n, Wednesday, 29 April 2015 06:17 (ten years ago)

write bill simmons a letter

lag∞n, Wednesday, 29 April 2015 06:18 (ten years ago)

i didn't even bring it up!

J0rdan S., Wednesday, 29 April 2015 06:18 (ten years ago)

loll

lag∞n, Wednesday, 29 April 2015 06:18 (ten years ago)

"actually blake griffin scored 35 points" is a very interesting point though

J0rdan S., Wednesday, 29 April 2015 06:19 (ten years ago)

What was cwebb's line when he called the timeout when they didn't have one

Matt Armstrong, Wednesday, 29 April 2015 06:20 (ten years ago)

no one will remember he put up 35-14-7 all anyone can talk about is the incredibly looming second half

lag∞n, Wednesday, 29 April 2015 06:21 (ten years ago)

remember when lebron actually put up a triple double in game 6 of the 2010 eastern semis? this is the one thing people talk about from that game.

J0rdan S., Wednesday, 29 April 2015 06:24 (ten years ago)

Coming up on ESPN Classic, "the 35-14-7 game"

Matt Armstrong, Wednesday, 29 April 2015 06:26 (ten years ago)

its non elimination first round game played while most of the country was asleep that people will be talking about for decades

lag∞n, Wednesday, 29 April 2015 06:27 (ten years ago)

all i said was that if the clippers lose in game 6, that really bad second half and getting hilariously packed by an elderly person is going to loom over blake next year, which...... is true!

blake is in the "what have you won" stage of his career, so things like that matter. blake putting up 35 and 14 isn't news.

J0rdan S., Wednesday, 29 April 2015 06:31 (ten years ago)

Too bad for the clippers cp3 didn't get called for a violation on that danny green ft

Matt Armstrong, Wednesday, 29 April 2015 06:32 (ten years ago)

no one is ever going to remember or thinl about blakes second half of that game except now the readers of this message board

lag∞n, Wednesday, 29 April 2015 06:33 (ten years ago)

and thats final goodnight

lag∞n, Wednesday, 29 April 2015 06:34 (ten years ago)

The only things people will remember about this game are questionable calls and Blake getting blocked by a geriatric Duncan which is jord's point basically

Matt Armstrong, Wednesday, 29 April 2015 06:34 (ten years ago)

ppl will remember the dre basket interference actually if anything

lag∞n, Wednesday, 29 April 2015 06:35 (ten years ago)

but mostly not anything

lag∞n, Wednesday, 29 April 2015 06:36 (ten years ago)

if the clippers lose this series their whole offseason is gonna be about how their team has never won shit and if you think blake getting owned by duncan and missing the final shot is going to be forgotten in that discussion you are crazy

J0rdan S., Wednesday, 29 April 2015 06:37 (ten years ago)

this is the clippers set that griffin got blocked on

seems like normally he spaces out at the top of the key but tonight for some reason he decided to drive straight into duncan

https://www.youtube.com/watch?v=VkmEjBlTMpc

micah, Wednesday, 29 April 2015 07:23 (ten years ago)

just finished, my hot takes:

austin rivers played like austin rivers. jamal was shooting balls off the side of the rim he was so bad. hack a DJ kinda worked. chris paul stutter step move on d green was a thing of beauty. tech on paul was embarrassing. don't think blake was fouled on that second attempt after the GOAT blocked him, looked like he either just lost it on the way up or it got knocked out, great no call. clippers 3 point game disappeared. the travel on blake was a legit call he took two steps before he put the ball down.

i won't remember blake's not-that-great second half but what i will remember is that Boris step back.

#wegonnabechampionship (Spottie), Wednesday, 29 April 2015 07:45 (ten years ago)

also RIP dirk. every time i watched him this year he looked so labored and heavy footed, I guess he has one more year?

#wegonnabechampionship (Spottie), Wednesday, 29 April 2015 07:56 (ten years ago)

I passed out 2 mins into the 4th quarter and was woozy in the 3rd so I def missed some stuff but here's a hopefully evenhanded take:

blake played great in all of what I saw, I can't believe I missed him getting stuffed by the prophet duncan. anyway does that invalidate blake almost getting a triple double? of course not. how could it? will it be well remembered? well...yeah. largely as a result of media/fan perceptions about blake and his personality and the clips in general. is that fair? not really but it's definitely a factor, it's just something unavoidable about how the clips have developed in the past few years

slothroprhymes, Wednesday, 29 April 2015 11:23 (ten years ago)

not to mention it stems from the sports narrative/mythologizing stuff that goon is complaining about upthread. is that stuff kinda dumb? of course and it should never be seen as more important than actual performance but it's impossible to ignore it completely

slothroprhymes, Wednesday, 29 April 2015 11:28 (ten years ago)

if the clippers lose this series their whole offseason is gonna be about how their team has never won shit and if you think blake getting owned by duncan and missing the final shot is going to be forgotten in that discussion you are crazy

― J0rdan S., Wednesday, April 29, 2015 2:37 AM (4 hours ago)

their offseason should be about addressing the bench tbh

cp3 is under contract for 2 more seasons with the clips. if he can't get a ring there he can always go back to new orleans to play with the brow

k3vin k., Wednesday, 29 April 2015 11:37 (ten years ago)

if he can't get a ring there he can always go back to new orleans to play with the brow

i've never considered this, it would be amazing

J0rdan S., Wednesday, 29 April 2015 14:14 (ten years ago)

interesting, even with AD's forthcoming (and well-deserved) supermax contract, pelis will prob have a reasonable amount of cap space in 2017-18, the year of cp3's player option

slothroprhymes, Wednesday, 29 April 2015 14:36 (ten years ago)

blake scored 35 though https://twitter.com/tomhaberstroh/status/593421751473807360

J0rdan S., Wednesday, 29 April 2015 14:37 (ten years ago)

lol jordan i cant believe youre still quintupling down on that dumb thing u said last night

lag∞n, Wednesday, 29 April 2015 14:40 (ten years ago)

i mean like is anyone even talking abt blakes bad second half today

lag∞n, Wednesday, 29 April 2015 14:41 (ten years ago)

i was just annoyed at yr hyperbolic front running but its fine to just let it go

lag∞n, Wednesday, 29 April 2015 14:42 (ten years ago)

xp depends on who you consider anyone, him sorta losing his rhythm has been mentioned - directly and indirectly, respectively - in grantland and deadspin pieces summarizing the games

slothroprhymes, Wednesday, 29 April 2015 14:45 (ten years ago)

(in a way that wld loom over his career)

lag∞n, Wednesday, 29 April 2015 14:46 (ten years ago)

does grantland have comments go post this garbage there

― lag∞n, Wednesday, April 29, 2015 2:17 AM (8 hours ago) Bookmark Flag Post Permalink

lol they don't anymore! not that i think any of us would get embroiled in those sort of cesspools

slothroprhymes, Wednesday, 29 April 2015 14:46 (ten years ago)

this is the closest to A Grand Statement on Griffin's Career in the shootaround piece, and it sort of makes sense although no talk of looming specifically

When you search his name in the play-by-play of the final quarter, it reads like a thesaurus of unlucky basketball occurrences — misses, bad passes, turnovers, squandered opportunities. Griffin has made so many improvements to his game, but the one thing he can’t fix is the very thing that makes him so special. Blake is a high-performance sports car: If one thing goes wrong, nothing seems to run right.

slothroprhymes, Wednesday, 29 April 2015 14:51 (ten years ago)

[inserts jordans post in to jordans post translator]

...

blake had a bad second half

...

ok good i agree with jordan lets all move forward with our lives

lag∞n, Wednesday, 29 April 2015 14:53 (ten years ago)

i mean he also would've totally redeemed himself with a game winner and then deandre was like "better help out," whooooooooopsie

slothroprhymes, Wednesday, 29 April 2015 15:16 (ten years ago)

i actually feel sorry for DJ, like you said 0.01 seconds later and he's a hero

Nhex, Wednesday, 29 April 2015 15:18 (ten years ago)

They also called that matt barnes tip in a goaltend, terrible officiating

, Wednesday, 29 April 2015 15:19 (ten years ago)

that felt like one of those games that starts a curse

J0rdan S., Wednesday, 29 April 2015 15:19 (ten years ago)

the clippers are already cursed

lag∞n, Wednesday, 29 April 2015 15:27 (ten years ago)

i mean no one says theyre cursed but they are like the alltime worst team

lag∞n, Wednesday, 29 April 2015 15:27 (ten years ago)

true. this feels like a curse signpost then.

there were so many opportunities for them to win that game and yet

J0rdan S., Wednesday, 29 April 2015 15:31 (ten years ago)

second game too, tho in that case that was more a game they shouldve lost that they inexplicably had a chance to win

lag∞n, Wednesday, 29 April 2015 15:34 (ten years ago)

lol clips will never really be good. don't know why you guys always think for some reason they are going to be.

(•̪●) (carne asada), Wednesday, 29 April 2015 16:06 (ten years ago)

bunch of LA hoops newbs

(•̪●) (carne asada), Wednesday, 29 April 2015 16:07 (ten years ago)

XD

#wegonnabechampionship (Spottie), Wednesday, 29 April 2015 16:10 (ten years ago)

i believe ballmer can lift the curse players just need to rub his head 4 luck before each game

lag∞n, Wednesday, 29 April 2015 16:11 (ten years ago)

or maybe it will be lifted when he has a heart attack and dies on court one or the other

lag∞n, Wednesday, 29 April 2015 16:11 (ten years ago)

lolololollllllllllllllllllll

slothroprhymes, Wednesday, 29 April 2015 16:12 (ten years ago)

lol lakers will never really be good. don't know why you guys always think for some reason they are going to be.

― (•̪●) (carne asada), Wednesday, April 29, 2015 12:06 PM (5 minutes ago) Bookmark Flag Post Permalink

#fixed

slothroprhymes, Wednesday, 29 April 2015 16:12 (ten years ago)

ritually burn a copy of windows 95 in the locker room maybe idk

lag∞n, Wednesday, 29 April 2015 16:13 (ten years ago)

xp you can wish and hope for that but history shows that the lakers have never gone 10 years without a finals appearance . so save that shit for 2020 at least

(•̪●) (carne asada), Wednesday, 29 April 2015 16:20 (ten years ago)

Lakers fans gtfo here, no one likes your horrible ass team or the horrible ass people in charge of it

brosario nawson (m bison), Wednesday, 29 April 2015 16:25 (ten years ago)

xp that is true, they also have not missed the playoffs /and/ been under .500 for two consecutive seasons in the modern era (they've sneaked in under 500)...until they did

slothroprhymes, Wednesday, 29 April 2015 16:28 (ten years ago)

well, mid-70s was the last time, that is my arbitrary cutoff

slothroprhymes, Wednesday, 29 April 2015 16:29 (ten years ago)

wtf bison

(•̪●) (carne asada), Wednesday, 29 April 2015 16:30 (ten years ago)

lol bise in the full throws of playoff fever

lag∞n, Wednesday, 29 April 2015 16:31 (ten years ago)

i didn't even mention the lakers .
i don't have any hate for the clips. I've seen them break clipper fans hearts' all my life. I used to "sneak" into the Sports Arena and watch them along with the dozens of other people in attendance.

(•̪●) (carne asada), Wednesday, 29 April 2015 16:36 (ten years ago)

btw let's not forget blake got laid out by danny green in the second half and was getting attention (from a chiro, but still) on the sideline after. could have easily affected his game

k3vin k., Wednesday, 29 April 2015 17:08 (ten years ago)

that was a hard fall

#wegonnabechampionship (Spottie), Wednesday, 29 April 2015 17:09 (ten years ago)

ya was rough prob had something to do w it

lag∞n, Wednesday, 29 April 2015 17:11 (ten years ago)

that was so good

Nhex, Wednesday, 29 April 2015 18:54 (ten years ago)

he sees the shot clock going down to 0 on the other side of the court, shrugs, turns around and just tosses it in

Nhex, Wednesday, 29 April 2015 18:55 (ten years ago)

yeah that was ridic, horrible D by the clips too

lag∞n, Wednesday, 29 April 2015 19:00 (ten years ago)

also RIP dirk. every time i watched him this year he looked so labored and heavy footed, I guess he has one more year?

The defense is just so so bad. Has reached a level where it's hard to think he's that effective overall.

I do wonder if there's something he could do fitness wise because it does seem to be stamina driven.

Matt Armstrong, Wednesday, 29 April 2015 19:05 (ten years ago)

if the clippers lose this series their whole offseason is gonna be about how their team has never won shit and if you think blake getting owned by duncan and missing the final shot is going to be forgotten in that discussion you are crazy

― J0rdan S., Wednesday, April 29, 2015 2:37 AM (4 hours ago)

their offseason should be about addressing the bench tbh

cp3 is under contract for 2 more seasons with the clips. if he can't get a ring there he can always go back to new orleans to play with the brow

They should address their bench after they remove Doc Rivers' GM authority

Matt Armstrong, Wednesday, 29 April 2015 19:06 (ten years ago)

theres prob no way to really do that w/o firing him, they shd fire him

lag∞n, Wednesday, 29 April 2015 19:08 (ten years ago)

seems silly to pronounce within an hour of the game ending that a 1st round non elimination game will "loom" over anyone's career, but there is an urge amongst certain type to make these sort of pronouncements. people forget the pronouncements just like they forget the game that was supposed to loom. and yeah it's one of lamer parts of sports talk that people would go "hey that karl malone was pretty good but gm 6 1998 got it stripped *shakes head*"

A True White Kid that can Jump (Granny Dainger), Wednesday, 29 April 2015 19:10 (ten years ago)

lol yeah

Nhex, Wednesday, 29 April 2015 19:30 (ten years ago)

Tbf there's probably something to Blake doing spastic dumb shit in clutch situations, seems to happen lots. Probably too cranked up on special sauce

Matt Armstrong, Wednesday, 29 April 2015 19:36 (ten years ago)

Kevin Garnett was 27 the first time he sniffed the second round of the playoffs. Griffin is 25.

polyphonic, Wednesday, 29 April 2015 19:41 (ten years ago)

wtf bison
― (•̪●) (carne asada), Wednesday, April 29, 2015 11:30 AM (3 hours ago) Bookmark Flag Post Permalink

lol bise in the full throws of playoff fever
― lag∞n, Wednesday, April 29, 2015 11:31 AM (3 hours ago) Bookmark Flag Post Permalink

🔫🔫🔫💣💣💣⛄⛄⛄

brosario nawson (m bison), Wednesday, 29 April 2015 19:43 (ten years ago)

there was a sequence of six passes from inbounding to an open timmy lay-in that was as crisp as the spurs can be; they're not done just yet. shit like hack-a-deandre seems a bit beneath them but hey: it worked.

Premise ridiculous. Who have two potato? (forksclovetofu), Wednesday, 29 April 2015 19:51 (ten years ago)

Tbf there's probably something to Blake doing spastic dumb shit in clutch situations, seems to happen lots. Probably too cranked up on special sauce

― Matt Armstrong, Wednesday, April 29, 2015 3:36 PM (16 minutes ago) Bookmark Flag Post Permalink

who else is on yr juicer list matt (russ doesnt count bc we all sooorta leaned toward thinking that might be possible)

slothroprhymes, Wednesday, 29 April 2015 19:54 (ten years ago)

wait, you guys genuinely think Russ is juicing?

tsrobodo, Wednesday, 29 April 2015 20:08 (ten years ago)

he definitely has a vitamix

polyphonic, Wednesday, 29 April 2015 20:09 (ten years ago)

Don't we all?

tsrobodo, Wednesday, 29 April 2015 20:12 (ten years ago)

russ def juicin. other candidates: wade, lebro, barbosa

take it to the juice thread tho
how serious are you about the idea that lebron james has juiced or is juicing?

#wegonnabechampionship (Spottie), Wednesday, 29 April 2015 20:14 (ten years ago)

@espn_macmahon
Mavs opted not to give Rajon Rondo a playoff share, per a source.

polyphonic, Wednesday, 29 April 2015 20:24 (ten years ago)

damn

balls, Wednesday, 29 April 2015 21:18 (ten years ago)

he won't be getting one next year either lol

balls, Wednesday, 29 April 2015 21:19 (ten years ago)

can't wait for some scathing words from cuban like he did with d fish

#wegonnabechampionship (Spottie), Wednesday, 29 April 2015 21:19 (ten years ago)

Tbf there's probably something to Blake doing spastic dumb shit in clutch situations, seems to happen lots. Probably too cranked up on special sauce

― Matt Armstrong, Wednesday, April 29, 2015 3:36 PM (16 minutes ago) Bookmark Flag Post Permalink

who else is on yr juicer list matt (russ doesnt count bc we all sooorta leaned toward thinking that might be possible)

Boozer, Wade, Lebron, Pekovic.

Matt Armstrong, Wednesday, 29 April 2015 21:24 (ten years ago)

that body transformation kanter had a couple offseasons ago was pretty sketchy too

Matt Armstrong, Wednesday, 29 April 2015 21:29 (ten years ago)

if i was an out of shape baller i wld def juice in the offseason

lag∞n, Wednesday, 29 April 2015 21:30 (ten years ago)

but it's #impure goon and #wrong

slothroprhymes, Wednesday, 29 April 2015 21:34 (ten years ago)

jesus the rockets social media bro got fired for the gun/horse tweet, people truly are babies sometimes

call all destroyer, Wednesday, 29 April 2015 21:34 (ten years ago)

Marc J. Spears ‏@SpearsNBAYahoo 1m1 minute ago
Clippers coach Doc Rivers fined $25,000 by the NBA for public criticism of officiating postgame last night after loss to Spurs in Game 5.

carlisle LITERALLY JUST PAID THE SAME FINE DAYS AGO and doc still can't keep his mouth shut when it comes to calls he gets

slothroprhymes, Wednesday, 29 April 2015 21:35 (ten years ago)

i know $25k isn't a ton of money when yr salary is 10 mil a year but still lol

slothroprhymes, Wednesday, 29 April 2015 21:36 (ten years ago)

cost of doing business you cant just get worked by the refs like that and not saying anything

lag∞n, Wednesday, 29 April 2015 21:40 (ten years ago)

worth it if it makes the next games refs have to think twice about making a call; fair gamesmanship in today's nba

Premise ridiculous. Who have two potato? (forksclovetofu), Wednesday, 29 April 2015 21:42 (ten years ago)

jesus the rockets social media bro got fired for the gun/horse tweet, people truly are babies sometimes

― call all destroyer, Wednesday, April 29, 2015 9:34 PM (8 minutes ago) Bookmark Flag Post Permalink

some people think it's a rape joke, believe it or not

Matt Armstrong, Wednesday, 29 April 2015 21:44 (ten years ago)

powerful imaginations

lag∞n, Wednesday, 29 April 2015 21:45 (ten years ago)

Marc J. Spears ‏@SpearsNBAYahoo 1m1 minute ago
Clippers coach Doc Rivers fined $25,000 by the NBA for public criticism of officiating postgame last night after loss to Spurs in Game 5.

Should be double this for having the fuckin nerve to start his presser with "you know me I don't like to complain about refs"

pandemic, Wednesday, 29 April 2015 21:47 (ten years ago)

wow ever heard of free speech

lag∞n, Wednesday, 29 April 2015 21:49 (ten years ago)

I mean that's not free speech so much as it is "lying"

slothroprhymes, Wednesday, 29 April 2015 22:03 (ten years ago)

They should address their bench after they remove Doc Rivers' GM authority

― Matt Armstrong, Wednesday, April 29, 2015 3:06 PM (3 hours ago) Bookmark Flag Post Permalink

couldn't agree more. i truly don't understand how doc doesn't take more heat about his team-building. i mean i know ppl on the internet make fun of him, but no one around the league has the balls to call out trading for your own son as blatantly unprofessional?

k3vin k., Wednesday, 29 April 2015 23:00 (ten years ago)

he traded for him AND plays him too much!

Matt Armstrong, Wednesday, 29 April 2015 23:22 (ten years ago)

Rivers' GM record is very simply:

-awful FA signings
-trading for his son
-the dudley salary dump fiasco
-first round picks who never played/play
-the bledsoe trade

Matt Armstrong, Wednesday, 29 April 2015 23:23 (ten years ago)

talented GMs must shake their head at what he's done with 2 years to surround CP3/Griffin/Jordan. You could give Morey no money, no draft picks and he'd do a better job just with d-leaguers.

Matt Armstrong, Wednesday, 29 April 2015 23:25 (ten years ago)

not to mention letting nate robinson walk, one of the only kinda decent bench pieces he's ever had, after two 10 day contracts

slothroprhymes, Wednesday, 29 April 2015 23:32 (ten years ago)

tbf that's blatant nate robinson fandom on my part but ffs he would've done more now than spencer fucking hawes can/is!

slothroprhymes, Wednesday, 29 April 2015 23:33 (ten years ago)

have we talked abt this rondo not getting a playoff share thing? seems kinda dirty even if he did m/l quit on them.

Clay, Wednesday, 29 April 2015 23:34 (ten years ago)

it usually comes down to a vote ime

polyphonic, Wednesday, 29 April 2015 23:35 (ten years ago)

anyway it's only five games so i think he'll live

polyphonic, Wednesday, 29 April 2015 23:39 (ten years ago)

man there's great stuff about lebron and pierce in the simmons/windhorst podcast. did anyone know about how their feud started?

J0rdan S., Wednesday, 29 April 2015 23:43 (ten years ago)

Mike Fratello says you have to guard Pero Antic beyond the 3 point line

Matt Armstrong, Wednesday, 29 April 2015 23:43 (ten years ago)

i have to say the whole digression in that podcast about pierce and lebron has me extremely intrigued about a potential wiz/cavs east final

J0rdan S., Wednesday, 29 April 2015 23:51 (ten years ago)

I did not know the story and really dug it, kinda crazy it's a fuckin preseason game in 2004

slothroprhymes, Wednesday, 29 April 2015 23:57 (ten years ago)

speaking of podcasts today's BS report with haralabob le flambeur is almost entirely about spurs-clips, officiating, etc, v interesting stuff

slothroprhymes, Wednesday, 29 April 2015 23:59 (ten years ago)

Lemme guess bob says something like he's not going to say it was fixed but then spends the next ten minutes strongly implying it was fixed

juice college (agent hibachi), Thursday, 30 April 2015 00:02 (ten years ago)

lol no, but he does bring up the beef between doc and bill kennedy

having gotten into a public twitter tiff with h-bob I am not the biggest fan of his rich person kinda sociopath vibe but he's v smart, respeck where due

slothroprhymes, Thursday, 30 April 2015 00:04 (ten years ago)

have we talked abt this rondo not getting a playoff share thing? seems kinda dirty even if he did m/l quit on them.

― Clay, Wednesday, April 29, 2015 7:34 PM (27 minutes ago) Bookmark Flag Post Permalink

He fought with their coach and literally quit on them in middle of a game I'd be pissed if I were a mav

juice college (agent hibachi), Thursday, 30 April 2015 00:05 (ten years ago)

I don't get why they hid behind the injury thing and didn't just suspend him. Now they don't have a leg to stand on in hiding behind the player vote and refusing to pay him.

tsrobodo, Thursday, 30 April 2015 00:08 (ten years ago)

They're not "hiding behind" the player vote. That's how shares are determined.

polyphonic, Thursday, 30 April 2015 00:09 (ten years ago)

Lol Alan Anderson of all people singlehandedly keeping this from turning into a blowout

juice college (agent hibachi), Thursday, 30 April 2015 00:11 (ten years ago)

im def into bob's rich guy sociopath thing. if you're gonna be a rich sociopath at least become a basketball nerd.

J0rdan S., Thursday, 30 April 2015 00:15 (ten years ago)

lol there are def ways to be a sociopath that are a lot more damaging to human society it's true

slothroprhymes, Thursday, 30 April 2015 00:19 (ten years ago)

HAWKS PLZ JUST END THIS

slothroprhymes, Thursday, 30 April 2015 01:14 (ten years ago)

are the hawks bad now or do they just not know how to play in the 'offs or what i haven't watched a second of that series and don't plan on it unless it goes to 7

Clay, Thursday, 30 April 2015 01:16 (ten years ago)

So many 3 attempts

Jeff, Thursday, 30 April 2015 01:17 (ten years ago)

it's a bit of hangover from that swoon of theirs, bit of unlucky breaks on shots they usually hit, and a surprising amount of brooklyn...not sucking

don't blame you for not watching I watched exactly one full game (1)

slothroprhymes, Thursday, 30 April 2015 01:18 (ten years ago)

Jarreettt XD

, Thursday, 30 April 2015 01:22 (ten years ago)

demareeeeeee

slothroprhymes, Thursday, 30 April 2015 01:22 (ten years ago)

Wtf was that shot from Lopez

Jeff, Thursday, 30 April 2015 01:26 (ten years ago)

Deron finally benched in crunch time after a couple horrible turnovers and a bad reach in foul after Teague got by him

Dude is so toast

juice college (agent hibachi), Thursday, 30 April 2015 01:28 (ten years ago)

Ugh Jarrett Jack has never lost that tendency to try to abort a drive and pass instead while he's in the air, so terrible

juice college (agent hibachi), Thursday, 30 April 2015 01:32 (ten years ago)

Blopez is 100% gassed also Hawks should be ashamed if they manage to give this away

juice college (agent hibachi), Thursday, 30 April 2015 01:33 (ten years ago)

omg there's portland blood everywhere on the memphis court :/

slothroprhymes, Thursday, 30 April 2015 01:55 (ten years ago)

I spoke too soon! this is v close now. go blazers.

slothroprhymes, Thursday, 30 April 2015 02:11 (ten years ago)

amazed by the noncall on that meyers leonard goaltend

Matt Armstrong, Thursday, 30 April 2015 02:12 (ten years ago)

he actually tipped it across the rim

Matt Armstrong, Thursday, 30 April 2015 02:12 (ten years ago)

time to automate that shit, come on

Matt Armstrong, Thursday, 30 April 2015 02:12 (ten years ago)

the universe adjusts itself properly and supports underdogs every once in a while

tbh I think we're seeing underdog luck mostly bc the hoops gods are making up for letting the rox escape the first round

slothroprhymes, Thursday, 30 April 2015 02:21 (ten years ago)

i give you my personal guarantee ('The Clay Bond') that portland wins this series

Clay, Thursday, 30 April 2015 02:25 (ten years ago)

reminder that meyers leonard had a 50/40/90 season

k3vin k., Thursday, 30 April 2015 02:38 (ten years ago)

man gasol is so fuckin good

slothroprhymes, Thursday, 30 April 2015 02:40 (ten years ago)

he is a genius for real

Clay, Thursday, 30 April 2015 02:44 (ten years ago)

this is def the most evenly matched they've looked all series both teams playin great

slothroprhymes, Thursday, 30 April 2015 02:45 (ten years ago)

vince had a vintage putback dunk about halfway through the second and i would like to shout that out

Clay, Thursday, 30 April 2015 02:46 (ten years ago)

yeah and he had another nice slam just a couple of minutes ago

k3vin k., Thursday, 30 April 2015 02:47 (ten years ago)

man there's great stuff about lebron and pierce in the simmons/windhorst podcast. did anyone know about how their feud started?

― J0rdan S., Wednesday, April 29, 2015 7:43 PM (3 hours ago) Bookmark Flag Post Permalink

how did it start

lag∞n, Thursday, 30 April 2015 02:55 (ten years ago)

i remember lebron giving an interview a few years back about how he doesn't really have any rivals and PP is his rival by default. i thought there was mutual respect tho, idk i'll listen to the podcast tomorrow on the plane unlike SOME PPL ITT who are so above podcasts

k3vin k., Thursday, 30 April 2015 02:58 (ten years ago)

just tell me what is inside the podcasts

lag∞n, Thursday, 30 April 2015 02:59 (ten years ago)

feel like their shd be a blog that tells whats inside the podcasts

lag∞n, Thursday, 30 April 2015 03:00 (ten years ago)

that's a good idea for a blog mb you should start it up, i'll let you know what podcasts i'd like you to blog about

Clay, Thursday, 30 April 2015 03:01 (ten years ago)

cool just tell me what is inside them and then put them on the blog i guess i will give u the login info

lag∞n, Thursday, 30 April 2015 03:03 (ten years ago)

pass it on to max i'm sure gawker will listen to podcasts for us

Clay, Thursday, 30 April 2015 03:05 (ten years ago)

pods.gawker.com

lag∞n, Thursday, 30 April 2015 03:08 (ten years ago)

gotta take advantage of verticals where you find them

slothroprhymes, Thursday, 30 April 2015 03:09 (ten years ago)

blazers are dead again :(

Clay, Thursday, 30 April 2015 03:11 (ten years ago)

naht just yet man

slothroprhymes, Thursday, 30 April 2015 03:19 (ten years ago)

lma is playing like he already inked with san antonio

Clay, Thursday, 30 April 2015 03:21 (ten years ago)

CJ tho

slothroprhymes, Thursday, 30 April 2015 03:27 (ten years ago)

wow cj is nuts tonight

Clay, Thursday, 30 April 2015 03:27 (ten years ago)

cj >>>> ray allen

Clay, Thursday, 30 April 2015 03:30 (ten years ago)

yes i am ready for the era of meyers leonard, enforcer

Clay, Thursday, 30 April 2015 03:35 (ten years ago)

he has a very high potential to be an extreme irritant to opposing players imo

lag∞n, Thursday, 30 April 2015 03:36 (ten years ago)

like just look it him he cant be serious

lag∞n, Thursday, 30 April 2015 03:36 (ten years ago)

he is tho it's unpredictable but he brings it out in people & that messes up their shit, it has to be the bieber haircut

slothroprhymes, Thursday, 30 April 2015 03:37 (ten years ago)

like I'm kinda surprised z-bo didn't get tossed

slothroprhymes, Thursday, 30 April 2015 03:38 (ten years ago)

yeah i mean "why am i banging in the post with a tall bieber this is absurd" prob a common thought of his opponents xps

Clay, Thursday, 30 April 2015 03:38 (ten years ago)

omg dame u r so bad at defense stop

Clay, Thursday, 30 April 2015 03:40 (ten years ago)

omg when I put this game on it was a blowout! did I ruin it by 'liking' Memphis during a game last week??

Heroic melancholy continues to have a forceful grip on (bernard snowy), Thursday, 30 April 2015 03:42 (ten years ago)

uh memphis ultimately losing this game is the opposite of the game being ruined hello

Clay, Thursday, 30 April 2015 03:44 (ten years ago)

lopez with the hair and the beard and the crazy eyes really has a convincing look going

lag∞n, Thursday, 30 April 2015 03:46 (ten years ago)

xp no you're right I'm glad it got interesting at least

Heroic melancholy continues to have a forceful grip on (bernard snowy), Thursday, 30 April 2015 03:49 (ten years ago)

memphis is a really smart bball club, i do appreciate the way they play

Clay, Thursday, 30 April 2015 03:51 (ten years ago)

the pierce/lebron story windhorst told is this

the feud started in 2004 in a preseason game at the mohegan sun that took place on the first night of the 2004 sox world series (nb i haven't factchecked this story). apparently the teams got into it a lil bit and lebron was going harder than he should in a preseason game. at one point windhorst said he picked pierce's pocket and went down the court and dunked it and then came back and kinda grilled pierce (if he has the dates right lebron would've been 20, pierce 27). so the teams kind of had this beef and then had to play another preseason game a few days later at a college arena in ohio (maybe ohio state or cincinnati). the game was real chippy agaom (something specific might have happened here but i forget). after the game since it was a college arena the two locker rooms were adjacent to each other and windhorst said pierce tried to storm into the cavs locker to fight lebron and had to be carried back into the celtics locker room by a bunch of people. and i guess that's where it began but, windhorst says, nobody remembers especially in boston because it was happening right as the sox were winning the world series.

then he told a few other stories. he said at some point in lebron's first cleveland run maverick carter's dad was sitting courtside one night and started going at it with pierce. so pierce puts up like 44 points while talking trash to maverick carter's dad the entire game. he also mentioned the time bron and pierce kind of spilled into the crowd and bron's mom ran down the steps and like berated pierce, and then when they got up bron cursed his mom out (i think this is a famous bron moment).

simmons talked about how in game 5 of the 2012 east finals -- the game in miami where pierce hit that dagger three right in lebron's grill -- pierce and kg were talking the most personal trash to bron that anyone had ever heard or something. he then said (idk if this is him editorializing or passing on real celtics gossip) that pierce and kg really thought they had "broken" lebron that game and were gonna snuff out the run in miami. then the next game is where bron dropped 30 in the first half at the garden with that possessed terminator look on his face the entire time.

J0rdan S., Thursday, 30 April 2015 03:58 (ten years ago)

lmao wow nice ty

lag∞n, Thursday, 30 April 2015 04:03 (ten years ago)

portland utterly fell apart in the last couple minutes

Clay, Thursday, 30 April 2015 04:03 (ten years ago)

i love pierce and kgs belief in the power of their trash talk

lag∞n, Thursday, 30 April 2015 04:04 (ten years ago)

i wonder if kg ever really went in on duncan or theres just no point

lag∞n, Thursday, 30 April 2015 04:07 (ten years ago)

kg "your mothers pussy tastes like peaches"
duncan "youre playing great tonight kevin keep it up i really admire the hard work youve put into your game"

lag∞n, Thursday, 30 April 2015 04:08 (ten years ago)

lma just complete garbage tonight

Clay, Thursday, 30 April 2015 04:09 (ten years ago)

welp portland were not the better team this series

lag∞n, Thursday, 30 April 2015 04:09 (ten years ago)

like lebron taking off the cavs jersey on his way into the lockerroom levels of quit xp

Clay, Thursday, 30 April 2015 04:10 (ten years ago)

where's good job good effort kid

Clay, Thursday, 30 April 2015 04:10 (ten years ago)

kobe taking no shots for a half level of quit

lag∞n, Thursday, 30 April 2015 04:12 (ten years ago)

i give you my personal guarantee ('The Clay Bond') that portland wins this series

― Clay, Wednesday, April 29, 2015 7:25 PM (1 hour ago) Bookmark Flag Post Permalink

i was hacked btw, you guys make sure to use some good passwords or it will happen to you

Clay, Thursday, 30 April 2015 04:14 (ten years ago)

mine is ilovehoops

lag∞n, Thursday, 30 April 2015 04:16 (ten years ago)

the (non) reaction shots of high as hell on pain killers conley are killing me

lag∞n, Thursday, 30 April 2015 04:18 (ten years ago)

the girl in the commercial with the talking horse seems cool

lag∞n, Thursday, 30 April 2015 04:21 (ten years ago)

uhhh now u sound like the one high as hell on painkillers

Heroic melancholy continues to have a forceful grip on (bernard snowy), Thursday, 30 April 2015 04:23 (ten years ago)

that commercial is execrable, sorry, I'm over it

Heroic melancholy continues to have a forceful grip on (bernard snowy), Thursday, 30 April 2015 04:24 (ten years ago)

love how they keep referring to z-bo as lamarcus' 'old friend' when roy and aldridge ran zach out of town after one year with him

Clay, Thursday, 30 April 2015 04:24 (ten years ago)

uhhh now u sound like the one high as hell on painkillers

― Heroic melancholy continues to have a forceful grip on (bernard snowy), Thursday, April 30, 2015 12:23 AM (45 seconds ago) Bookmark Flag Post Permalink

i wish

lag∞n, Thursday, 30 April 2015 04:24 (ten years ago)

commercials like that are the reason I have the TV on mute and keep missing Important Basketball Plays v_v

Heroic melancholy continues to have a forceful grip on (bernard snowy), Thursday, 30 April 2015 04:25 (ten years ago)

lol portland keeps hitting desperation 3s this is ridiculous

Clay, Thursday, 30 April 2015 04:26 (ten years ago)

*transforms into spurs & warriors fan*

luv playoff basketball u guys

Clay, Thursday, 30 April 2015 04:27 (ten years ago)

lol

lag∞n, Thursday, 30 April 2015 04:28 (ten years ago)

sportcasters think calling memphis arena"the grindhouse" is cooler than it actually is

lag∞n, Thursday, 30 April 2015 04:29 (ten years ago)

memphis went 1-15 from three

lag∞n, Thursday, 30 April 2015 04:38 (ten years ago)

really too bad abt conley being out for the dubs series

lag∞n, Thursday, 30 April 2015 04:41 (ten years ago)

dubs are legit having one of the luckiest seasons of all time

polyphonic, Thursday, 30 April 2015 04:51 (ten years ago)

i dont think a healthy memphis wld really have much of a shot but it wld be an interesting matchup personnel/stylewise

lag∞n, Thursday, 30 April 2015 04:53 (ten years ago)

want to see someone "go gritty" v the dubs

lag∞n, Thursday, 30 April 2015 04:56 (ten years ago)

gatorade no one knows who the hell jabari parker is

lag∞n, Thursday, 30 April 2015 04:57 (ten years ago)

love farmersonly.com

lag∞n, Thursday, 30 April 2015 04:57 (ten years ago)

shaq is the least funny human being who ever lived

Clay, Thursday, 30 April 2015 05:03 (ten years ago)

he will be gone soon ;)

lag∞n, Thursday, 30 April 2015 05:12 (ten years ago)

gatorade no one knows who the hell jabari parker is
--lag∞n

um we all do now, wow rude

slothroprhymes, Thursday, 30 April 2015 10:38 (ten years ago)

just wanna say the vaguely hallucinatory vibe that affects posts during the 2nd half of late playoff games is great, especially the lagoon commercial diaries

slothroprhymes, Thursday, 30 April 2015 10:45 (ten years ago)

I wld pay j0rdan to transcribe all of windhorsts podcasts

, Thursday, 30 April 2015 12:35 (ten years ago)

it's ok i don't mind doing it pro bono

J0rdan S., Thursday, 30 April 2015 13:37 (ten years ago)

http://i.imgur.com/e5Qebq7.png

:|

lag∞n, Thursday, 30 April 2015 14:14 (ten years ago)

lolllllll

slothroprhymes, Thursday, 30 April 2015 14:14 (ten years ago)

the brands... found me

lag∞n, Thursday, 30 April 2015 14:15 (ten years ago)

http://i.imgur.com/EgXIKmx.png

lag∞n, Thursday, 30 April 2015 14:17 (ten years ago)

then the brands came for me
and there was no one to speak out

slothroprhymes, Thursday, 30 April 2015 14:22 (ten years ago)

I wld pay j0rdan to transcribe all of windhorsts podcasts

― 龜, Thursday, April 30, 2015 8:35 AM (1 hour ago) Bookmark Flag Post Permalink

willing to reappropriate the money earmarked for coach nick

lag∞n, Thursday, 30 April 2015 14:35 (ten years ago)

I think the horse is jermaine from flight of the conchords

juice college (agent hibachi), Thursday, 30 April 2015 14:49 (ten years ago)

oh... wow damn

lag∞n, Thursday, 30 April 2015 14:58 (ten years ago)

xp it def is that kiwi voice is recognizable anywhere

slothroprhymes, Thursday, 30 April 2015 15:20 (ten years ago)

horse dont like me no more :(

http://i.imgur.com/Sjiv2qN.png

lag∞n, Thursday, 30 April 2015 15:21 (ten years ago)

no response

lag∞n, Thursday, 30 April 2015 15:21 (ten years ago)

https://youtu.be/OboOBJy2xHY

Allen (etaeoe), Thursday, 30 April 2015 17:33 (ten years ago)

following the battle for the 7/8 seed in the east the past few weeks (partly cuz i want the nets in the lottery, partly cuz i want to be able to see someone interesting/entertaining) has really really driven home for me how bad the east is. curious if thibs ends up in new orleans. orlando would be an interesting fit but supposedly billy donovan is going to finally take that job.

― balls, Wednesday, 15 April 2015 03:56 (2 weeks ago) Permalink

donovan took that job

Bookmark No Bingus Permalink (Sufjan Grafton), Thursday, 30 April 2015 18:24 (ten years ago)

I had no idea Blake Griffin had such an awful rebounding season, what the hell is that about? His TRB% has declined every year and is getting pretty fucking bad for a guy with his talent.

Matt Armstrong, Thursday, 30 April 2015 20:59 (ten years ago)

Deandre

tsrobodo, Thursday, 30 April 2015 21:03 (ten years ago)

dre def took some of those missing rebounds

lag∞n, Thursday, 30 April 2015 21:03 (ten years ago)

also started playing outside more

lag∞n, Thursday, 30 April 2015 21:04 (ten years ago)

be curious if pf defensive rebounding is down across the league since power forwards started playing on the perimeter more and they have to be there to guard them

lag∞n, Thursday, 30 April 2015 21:05 (ten years ago)

deandre's been around a while tho... and blake always liked jumpers.

Matt Armstrong, Thursday, 30 April 2015 21:08 (ten years ago)

but dre somehow magically got much better at rebounding which like never happens, also blake def takes more Js than he used to

lag∞n, Thursday, 30 April 2015 21:11 (ten years ago)

Blake's DRB% has gone down every season, something's going on there.

Matt Armstrong, Thursday, 30 April 2015 21:11 (ten years ago)

plus blake should have gotten a bump from the minutes he played with hawes, who was also terrible on the boards. idk

Matt Armstrong, Thursday, 30 April 2015 21:12 (ten years ago)

jordans rebound rate by year, the bottom one is what the espn algo predicted he wld do this year, this is an underreported story

http://i.imgur.com/GRInwjV.png

lag∞n, Thursday, 30 April 2015 21:13 (ten years ago)

Blake's DRB% has gone down every season, something's going on there.

― Matt Armstrong, Thursday, April 30, 2015 5:11 PM (1 minute ago) Bookmark Flag Post Permalink

yeah im not saying that nothing is going on there just that maybe theres not as much going on as it might seem

lag∞n, Thursday, 30 April 2015 21:13 (ten years ago)

also he has short arms, maybe they r getting shorter

lag∞n, Thursday, 30 April 2015 21:16 (ten years ago)

Nature consequence of the aging process.

A-Hanisi Coates (Leee), Thursday, 30 April 2015 21:56 (ten years ago)

athleticism has definitely declined a little, he doesn't do as many completely bonkers things anymore

Matt Armstrong, Thursday, 30 April 2015 21:59 (ten years ago)

might have something to do with the clips defensive schemes changing, emphasizing getting back on d more

clips team DRB%
12-13 15th
13-14 26th
14-15 9th

clips team ORB%
12-13 7th
13-14 20th
14-15 28th

micah, Thursday, 30 April 2015 22:32 (ten years ago)

was a hallmark of doc celtics teams too, just did not contest O rebounds

lag∞n, Thursday, 30 April 2015 22:37 (ten years ago)

i would guess that a big proportion of blakes missing rebounds are/were o boards but i cbf proving it

micah, Thursday, 30 April 2015 22:45 (ten years ago)

in other news there is a body of water in my country called Lake Burley Griffin, i would like to make a pun about this but i feel it is too obscure

micah, Thursday, 30 April 2015 22:47 (ten years ago)

Blake Burly Griffin &c

micah, Thursday, 30 April 2015 22:47 (ten years ago)

rose 7 assists in 8 mins

lag∞n, Thursday, 30 April 2015 23:26 (ten years ago)

dunleavy such a dirty player

micah, Thursday, 30 April 2015 23:31 (ten years ago)

bulls came 2 play 2 nite

lag∞n, Thursday, 30 April 2015 23:35 (ten years ago)

Jimmy Butler's hops very underrated I guess cuz he never goes for style points

Matt Armstrong, Thursday, 30 April 2015 23:52 (ten years ago)

my god this is a bloodbath

lag∞n, Thursday, 30 April 2015 23:56 (ten years ago)

holy crap that is...a sizable deficit for thee yung bucks

slothroprhymes, Thursday, 30 April 2015 23:56 (ten years ago)

Jeez turned this on a little late and it was already a 20 point game

juice college (agent hibachi), Friday, 1 May 2015 00:03 (ten years ago)

same here. q: were any of Rose's assists "nice"? Feel like he never gets any 'wow' ones.

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 00:04 (ten years ago)

oh giannis no

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 00:08 (ten years ago)

Dick move by Giannis I liked oj mayo getting in butlers grill but a late tackle is just stupid

juice college (agent hibachi), Friday, 1 May 2015 00:09 (ten years ago)

haha scottie pippen coming off the bench for a fight

micah, Friday, 1 May 2015 00:10 (ten years ago)

https://www.youtube.com/watch?v=UKb5l-RxQFQ

micah, Friday, 1 May 2015 00:10 (ten years ago)

If the Bucks came back to make that game close it would make me some money but it seems unlikely?

Matt Armstrong, Friday, 1 May 2015 00:20 (ten years ago)

giannis did not want to play in the game anymore

lag∞n, Friday, 1 May 2015 00:20 (ten years ago)

is the score of this game real or a funny joke

Clay, Friday, 1 May 2015 00:49 (ten years ago)

Great game

Jeff, Friday, 1 May 2015 00:52 (ten years ago)

xp it's real the television sez so

slothroprhymes, Friday, 1 May 2015 00:54 (ten years ago)

ffs thibs, no one you want to play in the next series should play in the 4th.

circles, Friday, 1 May 2015 01:04 (ten years ago)

Haha for real is he playing dudes he really shld be scraping the end of the bench

I went to mute at 30 pts lead and just turned the tv off around 40

Bucks gone fishin in epic fashion

juice college (agent hibachi), Friday, 1 May 2015 01:07 (ten years ago)

taj and noah both starteed the 4th

circles, Friday, 1 May 2015 01:10 (ten years ago)

he's got such tunnel vision

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 01:23 (ten years ago)

Wtf Bulls doubling up on bucks, last time I remember seeing that was my era Bulls over Malone Stockton

Premise ridiculous. Who have two potato? (forksclovetofu), Friday, 1 May 2015 01:33 (ten years ago)

MJ era rather

Premise ridiculous. Who have two potato? (forksclovetofu), Friday, 1 May 2015 01:34 (ten years ago)

Holy shit Reggie is talking about journey

, Friday, 1 May 2015 01:44 (ten years ago)

I had no idea Blake Griffin had such an awful rebounding season, what the hell is that about? His TRB% has declined every year and is getting pretty fucking bad for a guy with his talent.

― Matt Armstrong, Thursday, April 30, 2015 4:59 PM (4 hours ago) Bookmark Flag Post Permalink

I know this has already been addressed but it was 90% contract year deandre cannabalizing rebounds, 10% him playijng farther from the hoop. look at his rebounding numbers this series

k3vin k., Friday, 1 May 2015 01:47 (ten years ago)

Dunleavy had it coming
https://vine.co/v/e7neQHjgql6
https://vine.co/v/e7n2JH2VjHm

tsrobodo, Friday, 1 May 2015 02:11 (ten years ago)

Tbf the most interesting thing about dun jr is his dirty streak.

#wegonnabechampionship (Spottie), Friday, 1 May 2015 02:21 (ten years ago)

"look at the ball rotation, look at the beautiful ball rotation, look at the beautiful result"

luv u Kevin harlan

Clay, Friday, 1 May 2015 02:21 (ten years ago)

cp 0-6 in q1

micah, Friday, 1 May 2015 02:21 (ten years ago)

Belinelli going bonkers!

juice college (agent hibachi), Friday, 1 May 2015 02:32 (ten years ago)

italian firepower

slothroprhymes, Friday, 1 May 2015 02:33 (ten years ago)

Boris!

slothroprhymes, Friday, 1 May 2015 02:35 (ten years ago)

Clips gonna lose

, Friday, 1 May 2015 02:40 (ten years ago)

Timmy's right leg in motion looks like late 90's cgi

juice college (agent hibachi), Friday, 1 May 2015 02:44 (ten years ago)

DAJ mouthing what looks v much like "fuck this shit" at the charity stripe

slothroprhymes, Friday, 1 May 2015 02:44 (ten years ago)

agree, stupid line

lag∞n, Friday, 1 May 2015 03:09 (ten years ago)

nice start for the clips but cp3 gonna need to get unshook

lag∞n, Friday, 1 May 2015 03:20 (ten years ago)

damage already done

slothroprhymes, Friday, 1 May 2015 03:23 (ten years ago)

clips lead a mirage

slothroprhymes, Friday, 1 May 2015 03:23 (ten years ago)

Clips gonna lose

― 龜, Friday, May 1, 2015 12:40 PM

not convinced

micah, Friday, 1 May 2015 03:27 (ten years ago)

all leads are real

lag∞n, Friday, 1 May 2015 03:27 (ten years ago)

not clippers leads not with that bench and not with impending blake mindfarts

slothroprhymes, Friday, 1 May 2015 03:29 (ten years ago)

I'm sorry goon I know this hurts either for spurs fatigue reasons or cp3 adoration reasons but SA is getting out of this round and dying to a more noble opponent

slothroprhymes, Friday, 1 May 2015 03:30 (ten years ago)

plz dont use that lil shit tone with me

lag∞n, Friday, 1 May 2015 03:33 (ten years ago)

also u realize the clippers have won 2 out of the five games in this series right and barely lost the other two

lag∞n, Friday, 1 May 2015 03:34 (ten years ago)

and as far as leads u get to keep the points, is how the game works

lag∞n, Friday, 1 May 2015 03:35 (ten years ago)

and one of them was given to the spurs by the refs

lag∞n, Friday, 1 May 2015 03:36 (ten years ago)

refs shd give one back tonight imo

lag∞n, Friday, 1 May 2015 03:36 (ten years ago)

plz dont use that lil shit tone with me
--lag∞n

dude you bait people with shit like that with some regularity chill the hell out

slothroprhymes, Friday, 1 May 2015 03:44 (ten years ago)

shut it slothpo

lag∞n, Friday, 1 May 2015 03:44 (ten years ago)

time 2 take turk and austin out

lag∞n, Friday, 1 May 2015 03:49 (ten years ago)

glen tore something

lag∞n, Friday, 1 May 2015 03:54 (ten years ago)

thats trouble

micah, Friday, 1 May 2015 03:54 (ten years ago)

omg jamal is not close

lag∞n, Friday, 1 May 2015 03:55 (ten years ago)

spurs looking a lil frustrated

lag∞n, Friday, 1 May 2015 04:00 (ten years ago)

wow great transition d by blake

lag∞n, Friday, 1 May 2015 04:03 (ten years ago)

i want to see diaw's +/- for the series, it seems like he's just killed the clippers every time he's in

k3vin k., Friday, 1 May 2015 04:08 (ten years ago)

...that paul heave...

lag∞n, Friday, 1 May 2015 04:08 (ten years ago)

wow jamal crawford lunging 30 feet away from the basket to block diaw's shot, textbook defense

k3vin k., Friday, 1 May 2015 04:09 (ten years ago)

feel like boris has spent a lot of the series floating not doing much then hit some big shots

lag∞n, Friday, 1 May 2015 04:10 (ten years ago)

cp3 throwing that savvy vet shit in w a possible travel lol

slothroprhymes, Friday, 1 May 2015 04:12 (ten years ago)

not the best spot

lag∞n, Friday, 1 May 2015 04:13 (ten years ago)

that t.o. was clutch.

head clowning instructor (art), Friday, 1 May 2015 04:14 (ten years ago)

this game man... this series

lag∞n, Friday, 1 May 2015 04:16 (ten years ago)

yeeeesh this is nuts

slothroprhymes, Friday, 1 May 2015 04:17 (ten years ago)

bellinelli Jesus Christ

Clay, Friday, 1 May 2015 04:19 (ten years ago)

fuckin marco

k3vin k., Friday, 1 May 2015 04:19 (ten years ago)

beelllllinellliiiiiii

head clowning instructor (art), Friday, 1 May 2015 04:19 (ten years ago)

that was not real

Clay, Friday, 1 May 2015 04:19 (ten years ago)

italy has never given us anything this beautiful until now

slothroprhymes, Friday, 1 May 2015 04:20 (ten years ago)

no matter how this ends I need a three minute static shot of ballmer's reaction

Clay, Friday, 1 May 2015 04:20 (ten years ago)

O M G

lag∞n, Friday, 1 May 2015 04:20 (ten years ago)

lol i got xped so many times on zing

lag∞n, Friday, 1 May 2015 04:21 (ten years ago)

omg why would crawford get rid of the ball there?

k3vin k., Friday, 1 May 2015 04:22 (ten years ago)

srsly

lag∞n, Friday, 1 May 2015 04:22 (ten years ago)

jamal crawford cold as ice

head clowning instructor (art), Friday, 1 May 2015 04:23 (ten years ago)

wuuuuuuut

lag∞n, Friday, 1 May 2015 04:24 (ten years ago)

dumb

Clay, Friday, 1 May 2015 04:24 (ten years ago)

aaaahahahahahahahahahahahahahaha

slothroprhymes, Friday, 1 May 2015 04:24 (ten years ago)

offensive int

k3vin k., Friday, 1 May 2015 04:24 (ten years ago)

IT WAS BORIS

lag∞n, Friday, 1 May 2015 04:25 (ten years ago)

yea that's ridiculous

slothroprhymes, Friday, 1 May 2015 04:25 (ten years ago)

crazy

micah, Friday, 1 May 2015 04:25 (ten years ago)

boris lol i love u

head clowning instructor (art), Friday, 1 May 2015 04:26 (ten years ago)

wow bring on game 7, hopefully ilh can survive this rivalry

lag∞n, Friday, 1 May 2015 04:26 (ten years ago)

Ughhhh

brosario nawson (m bison), Friday, 1 May 2015 04:26 (ten years ago)

yea this is done, clipdogs got it

slothroprhymes, Friday, 1 May 2015 04:27 (ten years ago)

for now

slothroprhymes, Friday, 1 May 2015 04:27 (ten years ago)

would be righteous if a cp3 game seven bring down of the Spurs tore ilh asunder

Clay, Friday, 1 May 2015 04:27 (ten years ago)

whats crazy is blake was totally gonna interfere with it if boris didnt what the hell hows that idea get in both of their heads

lag∞n, Friday, 1 May 2015 04:27 (ten years ago)

more like tragic!

slothroprhymes, Friday, 1 May 2015 04:28 (ten years ago)

xp dumb ideas are contagious

slothroprhymes, Friday, 1 May 2015 04:28 (ten years ago)

game seven ya'll

wld really love to see la take this

head clowning instructor (art), Friday, 1 May 2015 04:29 (ten years ago)

it's only right that this series goes to 7

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 04:29 (ten years ago)

slothp im sorry i was mean to u i say that out of all genuineness but also so i can own u without it being some terrible vendetta

----

all leads are real

― lag∞n, Thursday, April 30, 2015 11:27 PM (Yesterday) Bookmark Flag Post Permalink

not clippers leads not with that bench and not with impending blake mindfarts

― slothroprhymes, Thursday, April 30, 2015 11:29 PM (Yesterday) Bookmark Flag Post Permalink

I'm sorry goon I know this hurts either for spurs fatigue reasons or cp3 adoration reasons but SA is getting out of this round and dying to a more noble opponent

― slothroprhymes, Thursday, April 30, 2015 11:30 PM (Yesterday) Bookmark Flag Post Permalink

lol

lag∞n, Friday, 1 May 2015 04:29 (ten years ago)

do people actively want clippers rox like what the actual fuck who wants to legit sit through even half a game of that

slothroprhymes, Friday, 1 May 2015 04:30 (ten years ago)

xp wow I was wrong it is hardly the first time

slothroprhymes, Friday, 1 May 2015 04:30 (ten years ago)

somehow I think I will survive

slothroprhymes, Friday, 1 May 2015 04:30 (ten years ago)

but... wil u learn

lag∞n, Friday, 1 May 2015 04:31 (ten years ago)

personally id love to see la take down both sa and houston. also i think houston could take maybe 1-2 max before getting rolled

head clowning instructor (art), Friday, 1 May 2015 04:31 (ten years ago)

ya rockets have no chance v either of these teams

lag∞n, Friday, 1 May 2015 04:32 (ten years ago)

regret not watching more clips games. nobody was hyping this team all yr

head clowning instructor (art), Friday, 1 May 2015 04:32 (ten years ago)

kev was iirc

lag∞n, Friday, 1 May 2015 04:32 (ten years ago)

so is Tony Parker cooked

Matt Armstrong, Friday, 1 May 2015 04:34 (ten years ago)

the clips are obviously good! I don't think anyone has said otherwise aside from critiquing the bench and relatively inconsequential (in the grand scheme of things) blake jokes

slothroprhymes, Friday, 1 May 2015 04:34 (ten years ago)

clippers are must watch, have been all year. they have so many rivalries in the west.

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:35 (ten years ago)

clips rox would be great you crazy

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:35 (ten years ago)

great game, CP and blake came through big in the 2nd half

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:35 (ten years ago)

the problem is they're fucking insufferable to watch because of the attendant baggage which they refuse to shed, they may actually be worse than the rockets on a macro scale

slothroprhymes, Friday, 1 May 2015 04:36 (ten years ago)

so is Tony Parker cooked

― Matt Armstrong, Friday, May 1, 2015 12:34 AM (58 seconds ago) Bookmark Flag Post Permalink

players who rely on quickness often go fast

lag∞n, Friday, 1 May 2015 04:36 (ten years ago)

so is Tony Parker cooked

― Matt Armstrong, Thursday, April 30, 2015 9:34 PM (1 minute ago) Bookmark Flag Post Permalink

he looks pudgy, like 10-15 lbs overweight, soft.

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:36 (ten years ago)

the clippers are must watch in the same way that all fascist movements must be monitored

Matt Armstrong, Friday, 1 May 2015 04:37 (ten years ago)

would legit rather watch laimbeer lay people the fuck out at least that's honest thuggery

slothroprhymes, Friday, 1 May 2015 04:37 (ten years ago)

you all shd abandon yr clipper hate its eating u from the inside, theyre really not all that hitler

lag∞n, Friday, 1 May 2015 04:37 (ten years ago)

lol wrote that post before matts

lag∞n, Friday, 1 May 2015 04:37 (ten years ago)

exactly matt

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:38 (ten years ago)

big baby def torn achilles

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:40 (ten years ago)

pop doing the not mad just disappointed routine in his presser lol "we were soft... just soft"

lag∞n, Friday, 1 May 2015 04:40 (ten years ago)

the whiny dishonest bullshit just detracts from how entrancing many aspects of their style are, like a really good kobe beef burger that suddenly has grated poop on it idk

slothroprhymes, Friday, 1 May 2015 04:40 (ten years ago)

pop is crestfallen

slothroprhymes, Friday, 1 May 2015 04:41 (ten years ago)

lol dishonest bullshit cmon this is not the disney channel folks

lag∞n, Friday, 1 May 2015 04:42 (ten years ago)

so is Tony Parker cooked

― Matt Armstrong, Thursday, April 30, 2015 9:34 PM (6 minutes ago) Bookmark Flag Post Permalink

i think we did this like a week ago

Clay, Friday, 1 May 2015 04:42 (ten years ago)

still cooked

lag∞n, Friday, 1 May 2015 04:42 (ten years ago)

yeah

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:42 (ten years ago)

been eating with boris

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:43 (ten years ago)

this series abt as close as possible

lag∞n, Friday, 1 May 2015 04:43 (ten years ago)

lol /dishonest bullshit/ cmon this is not the disney channel folks
--lag∞n

yes watching paul shout for fouls he did not in fact draw is super fun

"dishonest" prob implies that I'm making a moral judgment which I'm not, more like it's just uuuuuugh to watch

slothroprhymes, Friday, 1 May 2015 04:44 (ten years ago)

letting a few flops ruin yr enjoyment of a true basketball genius, sad

lag∞n, Friday, 1 May 2015 04:45 (ten years ago)

haha

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:46 (ten years ago)

pretty much everything else about what he does is genius, I would never say otherwise

slothroprhymes, Friday, 1 May 2015 04:46 (ten years ago)

v excite for game 7

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:47 (ten years ago)

https://pbs.twimg.com/media/CD5LdgKW8AEb5ao.png

lol this isnt the shot but they cut to ballmer right after that ridic paul desperation 3 rimmed out and i was so right there with him

lag∞n, Friday, 1 May 2015 04:47 (ten years ago)

tnt.com shd have a ballmer feed

lag∞n, Friday, 1 May 2015 04:48 (ten years ago)

ballmer cam would be great

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:49 (ten years ago)

his blood pressure must be through the roof

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:49 (ten years ago)

letting a few flops ruin yr enjoyment of a true basketball genius, sad

― lag∞n, Friday, May 1, 2015 4:45 AM (3 minutes ago) Bookmark Flag Post Permalink

"a few"

Matt Armstrong, Friday, 1 May 2015 04:51 (ten years ago)

one or two

lag∞n, Friday, 1 May 2015 04:51 (ten years ago)

"tim pop called you all soft do you agree"
/50 yard stare/
"they played better than us"

lag∞n, Friday, 1 May 2015 04:53 (ten years ago)

timmy wanted out of that interview so bad

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:54 (ten years ago)

guess the reffing is even now? that jamal travel was so blatant

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:55 (ten years ago)

that was super bad yeah

Clay, Friday, 1 May 2015 04:55 (ten years ago)

nah guys move their feet that much all the time

lag∞n, Friday, 1 May 2015 04:56 (ten years ago)

i mean even if that shdve been called theres no way the officiating is even

lag∞n, Friday, 1 May 2015 04:56 (ten years ago)

he had the ball tho and wasn't dribbling

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 04:57 (ten years ago)

refs gave spurs like 8-10 points last game

lag∞n, Friday, 1 May 2015 04:57 (ten years ago)

he he slid his pivot foot from heel to toe like two inches, stuff like that happens all the time usually the tv just doesnt freak out about it and put it on replay 10 times

lag∞n, Friday, 1 May 2015 04:58 (ten years ago)

nah guys move their feet that much all the time

― lag∞n, Thursday, April 30, 2015 9:56 PM (1 minute ago) Bookmark Flag Post Permalink

the ref was looking directly down at his feet and just swallowed it

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:58 (ten years ago)

he hopped before the shuffle/slide

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:59 (ten years ago)

it technically was a travel but wldve been a p weak call

lag∞n, Friday, 1 May 2015 04:59 (ten years ago)

there's nothing better after watching exciting sports game than to talk about the officiating, such a great pastime

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 04:59 (ten years ago)

:/

#wegonnabechampionship (Spottie), Friday, 1 May 2015 04:59 (ten years ago)

this series has saved the first round its true

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:00 (ten years ago)

you didn't enjoy the sixty point blowout?

Clay, Friday, 1 May 2015 05:02 (ten years ago)

he hopped before the shuffle/slide

― #wegonnabechampionship (Spottie), Friday, May 1, 2015 12:59 AM (2 minutes ago) Bookmark Flag Post Permalink

ha yeah this is actually true, cant find a good enough video to see if there was contact tho which wld be a reason the ref didnt call it

lag∞n, Friday, 1 May 2015 05:02 (ten years ago)

anyway this series is very good hallelujah

lag∞n, Friday, 1 May 2015 05:04 (ten years ago)

ugh why does this game 7 have to overlap with Floyd vs Manny

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:07 (ten years ago)

that fights gonna be garbage anyway

lag∞n, Friday, 1 May 2015 05:07 (ten years ago)

still gonna watch tho

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:08 (ten years ago)

also Chi/Cle should be a good series

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:08 (ten years ago)

im gonna watch the game 7 B-)

lag∞n, Friday, 1 May 2015 05:08 (ten years ago)

and round 21 of the nfl draft, fuck!!!!

xp

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 05:09 (ten years ago)

yeah cleve sans love gonna have a real hard time w a slightly rejuvinated bulls

lag∞n, Friday, 1 May 2015 05:10 (ten years ago)

haha xp.

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:11 (ten years ago)

granny what are your predix for chi/cle?

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:11 (ten years ago)

like what is the cavs starting five the first two games

kyrie
shump
jones
bron
mozgov

lol

lag∞n, Friday, 1 May 2015 05:13 (ten years ago)

mayweather is such a sociopath get him off my tv

lag∞n, Friday, 1 May 2015 05:14 (ten years ago)

serial abuser with the money club written all over his clothes

lag∞n, Friday, 1 May 2015 05:14 (ten years ago)

or the money team

lag∞n, Friday, 1 May 2015 05:14 (ten years ago)

this bulls team is so inconsistent on both ends and has always shrunk/lost confidence vs LeBron in playoffs. but no Love, no JR for 1 game (right?)...Bulls depth wears them down and Cavs don't stick together as a unit as much as Bulls = Bulls win in 6

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 05:15 (ten years ago)

jr suspended for 2 games

lag∞n, Friday, 1 May 2015 05:16 (ten years ago)

like what is the cavs starting five the first two games

kyrie
shump
jones
bron
mozgov

lol

― lag∞n, Thursday, April 30, 2015 10:13 PM (1 minute ago) Bookmark Flag Post Permalink

one of these names really does not belong

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:17 (ten years ago)

...in the nba

lag∞n, Friday, 1 May 2015 05:17 (ten years ago)

yeah bulls got this I think too. jimmy butler is a top 5 player for watching now

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:17 (ten years ago)

hah goon yes

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:18 (ten years ago)

mayweather is such a sociopath get him off my tv

― lag∞n, Thursday, April 30, 2015 10:14 PM (3 minutes ago) Bookmark Flag Post Permalink

Clay, Friday, 1 May 2015 05:18 (ten years ago)

worse bench.. Clips vs Cavs

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:18 (ten years ago)

I don't even know who jones is...james??

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 05:19 (ten years ago)

cavs actually lol xp

lag∞n, Friday, 1 May 2015 05:19 (ten years ago)

mayweather is such a sociopath get him off my tv

― lag∞n, Thursday, April 30, 2015 10:14 PM (3 minutes ago) Bookmark Flag Post Permalink

― Clay, Thursday, April 30, 2015 10:18 PM (40 seconds ago) Bookmark Flag Post Permalink

yeah, got a friend who's paying for it I'm just showing up

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:19 (ten years ago)

what if we get a clips cavs finals omg

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:19 (ten years ago)

chuck betting on the draw is somehow classic chuck "i love to throw my money in the garbage and then light the garbage on fire" chuck problem gambling shit

Clay, Friday, 1 May 2015 05:20 (ten years ago)

lol he got serious abt that fast

lag∞n, Friday, 1 May 2015 05:20 (ten years ago)

oh i see floyd is on tnt now I'm a few minutes behind

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:20 (ten years ago)

I don't even know who jones is...james??

― A True White Kid that can Jump (Granny Dainger), Thursday, April 30, 2015 10:19 PM (1 minute ago) Bookmark Flag Post Permalink

yup

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:21 (ten years ago)

could start mike miller tho i guess? ha

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:21 (ten years ago)

ya they might as well be the same non entity at this point

lag∞n, Friday, 1 May 2015 05:22 (ten years ago)

is floyd nervous or does he always talk like this? never heard him talk before

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:24 (ten years ago)

on drugs, snorts Seroquel iirc

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 05:28 (ten years ago)

sounds about right

#wegonnabechampionship (Spottie), Friday, 1 May 2015 05:33 (ten years ago)

what if we get a clips cavs finals omg
--#wegonnabechampionship (Spottie)

clips in 5 prob

slothroprhymes, Friday, 1 May 2015 11:00 (ten years ago)

hedo turkoglu will form an impromptu illegal gambling ring from the bench while this happens

slothroprhymes, Friday, 1 May 2015 11:07 (ten years ago)

It's incredible that this is going to game 7 after cp3 and Blake mostly had a trash first half and the clips are relying heavily on big baby and nepotism rivers off the bench

If Parker hadn't died six months ago the Spurs would have stomped them out in five or six- but yeah I guess it's a testament to how freaking good the clippers 5 + Jamal usually is especially on the offensive end

juice college (agent hibachi), Friday, 1 May 2015 14:46 (ten years ago)

Ballmer cam might be the best second screen idea ever btw

juice college (agent hibachi), Friday, 1 May 2015 14:46 (ten years ago)

according to my calculations:

paul is +12 in 235 minutes this series. clippers are -15 in the 48 minutes paul has sat

k3vin k., Friday, 1 May 2015 15:16 (ten years ago)

surprised its not more tbh, clips have kinda been saved by their bench hitting some improbable shots

lag∞n, Friday, 1 May 2015 15:20 (ten years ago)

lollllll http://deadspin.com/hedo-turkoglu-is-the-saddest-basketball-man-1701484947

slothroprhymes, Friday, 1 May 2015 15:37 (ten years ago)

passing up hedo open on the 3 point line - where he can show off his sole remaining skill - for an inevitably blown austin rivers layup is why i cant support this team going forward any further

slothroprhymes, Friday, 1 May 2015 15:40 (ten years ago)

btw paul letting the ball roll to postpone the start of the shot clock is really smart why dont more players do that, it gives yr team like 10% more time to get a shot off

lag∞n, Friday, 1 May 2015 15:42 (ten years ago)

oh no! hedo didnt get the ball on one possession the clippers are evil lol

lag∞n, Friday, 1 May 2015 15:43 (ten years ago)

not evil, just dumb but w/e i suppose its pointless to pile on mockery to the clippers bench

slothroprhymes, Friday, 1 May 2015 15:48 (ten years ago)

the g∞n/sloth clip beef simmering itt

Bookmark No Bingus Permalink (Sufjan Grafton), Friday, 1 May 2015 15:49 (ten years ago)

not passing to one guy once does not qualify as stupid

lag∞n, Friday, 1 May 2015 15:50 (ten years ago)

this is not a beef... its a massacre

lag∞n, Friday, 1 May 2015 15:52 (ten years ago)

i just said it was pointless to keep beating the dead horse of the clips bench so i'm not going to

slothroprhymes, Friday, 1 May 2015 15:54 (ten years ago)

u were literally advocating for passing to the bench guy tho no

lag∞n, Friday, 1 May 2015 15:55 (ten years ago)

btw paul letting the ball roll to postpone the start of the shot clock is really smart why dont more players do that, it gives yr team like 10% more time to get a shot off

― lag∞n, Friday, May 1, 2015 11:42 AM (9 minutes ago) Bookmark Flag Post Permalink

for some offenses it doesn't matter but if you're going to run a really complex set or something that usually requires a lot of passes (like the clips or spurs) then it's definitely an advantage. paul is a genius obv

k3vin k., Friday, 1 May 2015 15:56 (ten years ago)

xp i was, but you're right it isnt ultimately indicative of much in and of itself & everything else you could say about that general topic has pretty much already been said

slothroprhymes, Friday, 1 May 2015 15:58 (ten years ago)

http://static.foxsports.com/content/fscom/img/2013/07/09/070913-NBA-Brad-Stevens-PI-JA_20130709211717873_660_320.JPG

Bookmark No Bingus Permalink (Sufjan Grafton), Friday, 1 May 2015 16:08 (ten years ago)

cute

lag∞n, Friday, 1 May 2015 16:30 (ten years ago)

posting brad pics until the fighting stops

Bookmark No Bingus Permalink (Sufjan Grafton), Friday, 1 May 2015 16:37 (ten years ago)

it did! never not gonna appreciate the smile of brother brad though

slothroprhymes, Friday, 1 May 2015 16:38 (ten years ago)

just accept ilh is gonna be a warzone until this series is over

lag∞n, Friday, 1 May 2015 16:41 (ten years ago)

i want a Clips Dubs WCF so bad now.

#wegonnabechampionship (Spottie), Friday, 1 May 2015 16:43 (ten years ago)

yeah its destiny

lag∞n, Friday, 1 May 2015 16:44 (ten years ago)

would be cool

Bookmark No Bingus Permalink (Sufjan Grafton), Friday, 1 May 2015 16:46 (ten years ago)

if that ended up happening i'd be fine with the clips winning the first two rounds, but if they hang tough and beat the spurs only to fall to the rockets that will kinda suck

slothroprhymes, Friday, 1 May 2015 16:47 (ten years ago)

rockets can't lose as they haven't released josh smith yet

Bookmark No Bingus Permalink (Sufjan Grafton), Friday, 1 May 2015 16:49 (ten years ago)

rockets need Brewer or smith to be operating at lvl they were in mavs series to beat LA for sure. that's an unlikely scenario, both are middling dudes who got hot against a really bad defense.

head clowning instructor (art), Friday, 1 May 2015 17:25 (ten years ago)

also bring charitable to houston, let's say the harden/paul and DJ/dwight matchups are even, houston doesn't have a great answer for blake. Someone among the trio of jones, ariza or Mr smith has to close him down and idk seems like Blake can call his shots. esp if he's on his game

head clowning instructor (art), Friday, 1 May 2015 17:28 (ten years ago)

Being not bring*

head clowning instructor (art), Friday, 1 May 2015 17:28 (ten years ago)

rockets wld be lucky to win two v either team imo

lag∞n, Friday, 1 May 2015 17:30 (ten years ago)

fatigue is gonna win one for houston, everybody is gassed, but yeah, still dont see it getting further

head clowning instructor (art), Friday, 1 May 2015 17:45 (ten years ago)

what if they come out in pinstripes, though

Bookmark No Bingus Permalink (Sufjan Grafton), Friday, 1 May 2015 17:54 (ten years ago)

can't find an infinite loop of scott stapp singing 'what if?' unfortunately

Bookmark No Bingus Permalink (Sufjan Grafton), Friday, 1 May 2015 17:55 (ten years ago)

Flag Post

slothroprhymes, Friday, 1 May 2015 17:59 (ten years ago)

is floyd nervous or does he always talk like this? never heard him talk before

― #wegonnabechampionship (Spottie), Friday, 1 May 2015 05:24 (12 hours ago) Permalink

I think he's a little punchdrunk tbh. It hasn't affected him in the ring but there's a flatness to his affect and he slurs words a bit.

Matt Armstrong, Friday, 1 May 2015 18:14 (ten years ago)

ban boxing

lag∞n, Friday, 1 May 2015 18:15 (ten years ago)

thats gotta be it xp

#wegonnabechampionship (Spottie), Friday, 1 May 2015 18:15 (ten years ago)

Boxing is the greatest sport

Matt Armstrong, Friday, 1 May 2015 18:36 (ten years ago)

basketball definitely the best team sport, nothing comes close

Matt Armstrong, Friday, 1 May 2015 18:36 (ten years ago)

that's nonsense

polyphonic, Friday, 1 May 2015 18:54 (ten years ago)

lag∞n
Posted: May 1, 2015 at 11:15:01 AM
ban boxing

seriously, it's a weird society that perpetuates shit like boxing and mma and football eventually

Clay, Friday, 1 May 2015 19:25 (ten years ago)

always thought so too, kinda disgusting

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 19:49 (ten years ago)

I loved boxing as a kid but not really interested anymore. But I would probably watch this fight if I didn't have to pay for it. :(

Football has been hard to shake for me but I'm definitely pulling away from it.

polyphonic, Friday, 1 May 2015 20:18 (ten years ago)

I would be fine if football basically became flag football w/weight limits and real juice testing tbh it'd probably 90% as good as it is now and it would be exciting to see Wes welker types have actual careers and long lives

juice college (agent hibachi), Friday, 1 May 2015 20:53 (ten years ago)

Ray rice thing killed the nfl for me, which is weird I guess, bc it's not like I didn't always know that was the culture. I just couldn't ignore it anymore. Couldn't watch a game without thinking about what was going on at home, what the sport was doing to their minds and bodies. Felt honestly like cheering on murder at the coliseum. So I stopped. I still pay attention at the margins because you have to to be able to converse with men in America m/l, and i watched the super bowl, but shove the rest.

Clay, Friday, 1 May 2015 21:50 (ten years ago)

football is amazing but i def have a general wincing feeling when i watch, support banning it, especially for children

lag∞n, Friday, 1 May 2015 21:51 (ten years ago)

i didnt wathc for liek the 1st half of last season but the patriots sucked me back in and by the time of the superbowl i was 100% pychotically on board

lag∞n, Friday, 1 May 2015 21:52 (ten years ago)

it'd be sure v difft if I had a team I acknowledge that

Clay, Friday, 1 May 2015 21:54 (ten years ago)

college football also a mess ;_;

post_garbage_from . (Sufjan Grafton), Friday, 1 May 2015 21:56 (ten years ago)

yeah really so much worse than the nfl even

lag∞n, Friday, 1 May 2015 21:58 (ten years ago)

I've never cared for college sports, just a huge ethical nightmare, capitalism in a nutshell shit I can't even begin to handle. Also college bball is bad and college football it's like... maybe if I was from the south? It feels like a regional thing (tho obv has infected Oregon over the last decade thx phil knight)

Clay, Friday, 1 May 2015 21:59 (ten years ago)

Fell off the NFL for good (so far) hard when the Kaepernick sex scandal happened, but I was already being primed to give it up with the Niners' acting like a typical spoiled and entitled corporation the last few ("few") years.

Madison Dumbbarfer (Leee), Friday, 1 May 2015 22:03 (ten years ago)

Will be cool when they replace human football players with big and fast robots

, Friday, 1 May 2015 22:04 (ten years ago)

ya ive never been a college sports watcher outside march madness its just like not very good even before i had any sort of awareness around how shitty the whole scene was

lag∞n, Friday, 1 May 2015 22:04 (ten years ago)

lol my dad loves college football and always tried to talk to me abt it even tho he knows i have no idea what hes saying

lag∞n, Friday, 1 May 2015 22:05 (ten years ago)

Learning about the history of the NCAA was definitely a "stay woke" moment for me ;)

, Friday, 1 May 2015 22:07 (ten years ago)

was thinking about Cavs starting 5 and how if NBAers were robots you could take the best parts of Mike Millerbot and James Jonesbot and form one decent small forwardbot #thoughtsfromthebong

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 22:08 (ten years ago)

lol my dad loves college football and always tried to talk to me abt it even tho he knows i have no idea what hes saying

lol I think the moment an American man has a son he becomes enraptured by saying things like "'bama looks tough this year, huh?"

Clay, Friday, 1 May 2015 22:15 (ten years ago)

otm

lag∞n, Friday, 1 May 2015 22:16 (ten years ago)

i just troll him by every time he brings up a pac 12 team i say the sec is better this is literally the only thing i know how to say abt college football (he is from cali and racist against the south)

lag∞n, Friday, 1 May 2015 22:17 (ten years ago)

mike millerbot + James jonesbot would = the greatest three point shooter ever

#wegonnabechampionship (Spottie), Friday, 1 May 2015 22:17 (ten years ago)

all the shitheads I know who love college sports also lean conservative and like to speak to the noble quality of playing for something "more than themselves" as if the university of missouri's scholarship department was D-Day

Clay, Friday, 1 May 2015 22:22 (ten years ago)

yeah the halo around amateurism is such baloney excuse my french

lag∞n, Friday, 1 May 2015 22:23 (ten years ago)

besides the horrible culture and brutality, football just bores me 90% of the time. 7 seconds of action followed by 35 seconds standing around talking about what to do next, repeat, zzz. that odell beckham catch was insane, v cool, tremendous athleticism in action but

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 22:24 (ten years ago)

I mean shocking I know that conservative men love watching unpaid minorities destroy themselves for no pay as a tribute to the virtues of state pride but idk ymmv here

Clay, Friday, 1 May 2015 22:24 (ten years ago)

oops...but doesn't seem to happen that much, def not often enough to pull me in.

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 22:25 (ten years ago)

Apparently T0ny R1ce sells insurance to giant corporations now and just writes 'T0ny R1ce' in the subject line of every email.

Sufjan Grafton, Friday, 1 May 2015 22:26 (ten years ago)

yet they love to dismiss NBA as "just a bunch of spoiled thugs jumping around" or some bullshit

A True White Kid that can Jump (Granny Dainger), Friday, 1 May 2015 22:27 (ten years ago)

mike millerbot + James jonesbot would = the greatest three point shooter ever

― #wegonnabechampionship (Spottie), Friday, May 1, 2015 6:17 PM (10 minutes ago) Bookmark

Banned from the Steph Curry fan club

, Friday, 1 May 2015 22:28 (ten years ago)

tough but fair

lag∞n, Friday, 1 May 2015 22:28 (ten years ago)

i am the steph curry fan club! i just have to say dumb things i don't believe once in a while to keep from sounding too much like a homer

#wegonnabechampionship (Spottie), Friday, 1 May 2015 22:46 (ten years ago)

btw hope our honored mod checks in and all's well before tomorrow's game 7

Clay, Friday, 1 May 2015 22:52 (ten years ago)

saw some completely absurd math on a blog today that claimed to prove meyers leonard was the year's best 3 pt shooter and i will not deign to argue with them

Clay, Friday, 1 May 2015 22:54 (ten years ago)

saw that too its a fact

lag∞n, Friday, 1 May 2015 22:54 (ten years ago)

xp

im basically scared af but thank u for ur concern

brosario nawson (m bison), Friday, 1 May 2015 23:03 (ten years ago)

shook mods pt 2

lag∞n, Friday, 1 May 2015 23:08 (ten years ago)

Still love cbball.

Jeff, Friday, 1 May 2015 23:35 (ten years ago)

saw some completely absurd math on a blog today that claimed to prove meyers leonard was the year's best 3 pt shooter and i will not deign to argue with them

― Clay, Friday, May 1, 2015 6:54 PM (44 minutes ago) Bookmark Flag Post Permalink

plz link!

k3vin k., Friday, 1 May 2015 23:43 (ten years ago)

guess not best 3 pt shooter of the year but a top 3 overall shooter if you believer that specious math

Clay, Friday, 1 May 2015 23:51 (ten years ago)

myers leonard only attempted 32 free throws, think we should qualify that a lil bit

call all destroyer, Friday, 1 May 2015 23:54 (ten years ago)

as I said, specious math

Clay, Saturday, 2 May 2015 00:21 (ten years ago)

oh yeah i saw that graphic in the game

k3vin k., Saturday, 2 May 2015 00:27 (ten years ago)

seriously, it's a weird society that perpetuates shit like boxing and mma and football eventually

― Clay, Friday, May 1, 2015 7:25 PM (Yesterday) Bookmark Flag Post Permalink

lotsa weird societies out there

Matt Armstrong, Saturday, 2 May 2015 00:43 (ten years ago)

dont think anyone will argue otherwise

Clay, Saturday, 2 May 2015 00:59 (ten years ago)

if the hawks don't close out this game...uuuuggghhh

slothroprhymes, Saturday, 2 May 2015 01:12 (ten years ago)

trying to think of a nonweird society. Would have suggested China but now they're getting into boxing.

Matt Armstrong, Saturday, 2 May 2015 01:29 (ten years ago)

sorry i think making a ripe public spectacle of violence as sport is not cool matt

Clay, Saturday, 2 May 2015 01:31 (ten years ago)

tho tbf i did give props to giannis for smacking down the loathed dunleavy just yesterday so i am not cool either

Clay, Saturday, 2 May 2015 01:32 (ten years ago)

I just think it's kind of a universal human thing. Pretty much every developed nation has violent sporting events of some kind.

Matt Armstrong, Saturday, 2 May 2015 01:38 (ten years ago)

gun violence is more the wtf America thing

Matt Armstrong, Saturday, 2 May 2015 01:41 (ten years ago)

yes sure but loads of universal human things shared by developed societies are pretty loathsome and worth complaining about? xp

Clay, Saturday, 2 May 2015 01:41 (ten years ago)

Hawks looking like the hawks again

Heez, Saturday, 2 May 2015 01:42 (ten years ago)

nets gon nets

micah, Saturday, 2 May 2015 01:46 (ten years ago)

god yes fucking kill them

balls, Saturday, 2 May 2015 01:59 (ten years ago)

NBA teams quitting in the 3rd quarter of elimination games is so hot right now

Matt Armstrong, Saturday, 2 May 2015 02:00 (ten years ago)

Wtf Lionel Hollins

Matt Armstrong, Saturday, 2 May 2015 02:23 (ten years ago)

glad to see the hawks and bulls w the definitive closeouts east was looking even lamer than we thought

lag∞n, Saturday, 2 May 2015 02:24 (ten years ago)

yeah this makes me feel like all is right with the world (to an exent)

call all destroyer, Saturday, 2 May 2015 02:30 (ten years ago)

guess hawks and wiz could be a lil fun if the wiz are actually okay

Clay, Saturday, 2 May 2015 02:36 (ten years ago)

has wittman saved his job? if he makes the ecf has he?

balls, Saturday, 2 May 2015 02:48 (ten years ago)

teague 0 points and 13 assists

#wegonnabechampionship (Spottie), Saturday, 2 May 2015 03:23 (ten years ago)

xp if he makes the finals prob, beyond that it's a total crapshoot

slothroprhymes, Saturday, 2 May 2015 03:41 (ten years ago)

I just think it's kind of a universal human thing. Pretty much every developed nation has violent sporting events of some kind.

don't think anyone said it was particular to american society

A True White Kid that can Jump (Granny Dainger), Saturday, 2 May 2015 08:51 (ten years ago)

I just think it's kind of a universal human thing. Pretty much every developed nation has violent sporting events of some kind.

― Matt Armstrong, Friday, May 1, 2015 9:38 PM (Yesterday) Bookmark

Finally an opinion expressed on ILH that's worthy of posting to reddit

, Saturday, 2 May 2015 12:40 (ten years ago)

it's pretty weird the league didn't anticipate this game 7 going up against the fight and scheduling it for earlier in the day

k3vin k., Saturday, 2 May 2015 13:01 (ten years ago)

?? Games gonna be over by the time the fight starts

, Saturday, 2 May 2015 13:08 (ten years ago)

Finally an opinion expressed on ILH that's worthy of posting to reddit

― 龜, Saturday, May 2, 2015 8:40 AM (1 hour ago) Bookmark Flag Post Permalink

lol

lag∞n, Saturday, 2 May 2015 14:06 (ten years ago)

Get hype everyone??

juice college (agent hibachi), Sunday, 3 May 2015 00:05 (ten years ago)

I'm scared this will be the game that tears ilh apart

juice college (agent hibachi), Sunday, 3 May 2015 00:05 (ten years ago)

I'm treaming. I'm tream

, Sunday, 3 May 2015 00:06 (ten years ago)

harlan and reggie tonight!

k3vin k., Sunday, 3 May 2015 00:06 (ten years ago)

cwebb

lag∞n, Sunday, 3 May 2015 00:07 (ten years ago)

I'm scared this will be the game that tears ilh apart

― juice college (agent hibachi), Saturday, May 2, 2015 5:05 PM (2 minutes ago) Bookmark Flag Post Permalink

over/under bise threadbans g∞n by 10:00est?

Clay, Sunday, 3 May 2015 00:10 (ten years ago)

cwebb

― lag∞n, Saturday, May 2, 2015 8:07 PM (4 minutes ago)

lol that's what i meant, hence the excitement

k3vin k., Sunday, 3 May 2015 00:12 (ten years ago)

predix: spurs by 15

micah, Sunday, 3 May 2015 00:12 (ten years ago)

Arena looks smoky

, Sunday, 3 May 2015 00:12 (ten years ago)

clips struggling to get their offense free

micah, Sunday, 3 May 2015 00:25 (ten years ago)

They're letting Parker and cp3 defend really physical both ways

Tony looks miraculously arisen tho

juice college (agent hibachi), Sunday, 3 May 2015 00:26 (ten years ago)

well if paul's out...

Clay, Sunday, 3 May 2015 00:36 (ten years ago)

I see m bise horribly mutilating his cp3 voodoo doll has worked

, Sunday, 3 May 2015 00:42 (ten years ago)

ugh please let paul come back

k3vin k., Sunday, 3 May 2015 00:43 (ten years ago)

wow that's the worst continuation call i've ever seen

k3vin k., Sunday, 3 May 2015 00:44 (ten years ago)

Tiago splitter looks like he's about to drop the hottest political treatise of 2015

, Sunday, 3 May 2015 00:44 (ten years ago)

lol

lag∞n, Sunday, 3 May 2015 00:47 (ten years ago)

JAMAL

k3vin k., Sunday, 3 May 2015 00:50 (ten years ago)

OUR LORD US BACK

lag∞n, Sunday, 3 May 2015 00:57 (ten years ago)

Clips have an azn trainer too

, Sunday, 3 May 2015 01:03 (ten years ago)

Nba teams
Hire me

, Sunday, 3 May 2015 01:03 (ten years ago)

prob a doctor

k3vin k., Sunday, 3 May 2015 01:04 (ten years ago)

wait it was a black guy i saw with paul before

k3vin k., Sunday, 3 May 2015 01:04 (ten years ago)

http://www.nba.com/coachfile/jasen_powell/?nav=page

k3vin k., Sunday, 3 May 2015 01:05 (ten years ago)

Danny green has two monster blocks, he stuffed Blake earlier in the post no less

juice college (agent hibachi), Sunday, 3 May 2015 01:05 (ten years ago)

god clippers stop fucking leaving your feet

k3vin k., Sunday, 3 May 2015 01:05 (ten years ago)

paul hobbled

lag∞n, Sunday, 3 May 2015 01:06 (ten years ago)

prob a doctor

Wow racist much

, Sunday, 3 May 2015 01:06 (ten years ago)

kawhi smells blood man

k3vin k., Sunday, 3 May 2015 01:07 (ten years ago)

Wow racist much

― 龜, Saturday, May 2, 2015 9:06 PM (47 seconds ago)

lol in the NFL isn't it a doctor who runs on the field when there's an injury or whatever? i guess the NBA uses trainers

k3vin k., Sunday, 3 May 2015 01:07 (ten years ago)

the green block on redick was a thing of beauty

Clay, Sunday, 3 May 2015 01:09 (ten years ago)

nba trainers are docs as far as I know

Clay, Sunday, 3 May 2015 01:10 (ten years ago)

the clippers guy isn't!

k3vin k., Sunday, 3 May 2015 01:12 (ten years ago)

Look all I'm saying is that the clips have a token azn guy too. Why do YT ppl have to make everything bad

, Sunday, 3 May 2015 01:13 (ten years ago)

they have to have a doctor on their bench in case of serious injury I'd think xp

Clay, Sunday, 3 May 2015 01:14 (ten years ago)

I figured out why deandre can't shoot free throws well. He shoots them left handed

, Sunday, 3 May 2015 01:14 (ten years ago)

Dayo I support your quest to become an NBA team employee and will happily act as a reference for you

Clay, Sunday, 3 May 2015 01:14 (ten years ago)

nba teams have trainers and doctors diff jobs

lag∞n, Sunday, 3 May 2015 01:16 (ten years ago)

Ty clay for your support

, Sunday, 3 May 2015 01:17 (ten years ago)

paul def not 100% but looks like his hammy loosened up he was dribbling off his foot repeatedly when he first came back hope hes riding the bike all halftime

lag∞n, Sunday, 3 May 2015 01:20 (ten years ago)

I'm willing to donate my hamstring to cp3 in these trying times *takes out Bowie knife, bites on rag*

, Sunday, 3 May 2015 01:21 (ten years ago)

Nate Rob! His suit is beautiful!

Clay, Sunday, 3 May 2015 01:22 (ten years ago)

this is the guy u need 2 train ur team v committed

lag∞n, Sunday, 3 May 2015 01:23 (ten years ago)

"ur hamstring thats nothing to mess with"

lag∞n, Sunday, 3 May 2015 01:24 (ten years ago)

im crying. what a game

moullet, Sunday, 3 May 2015 01:24 (ten years ago)

Schaumburg should be paying the tream for this free publicity

, Sunday, 3 May 2015 01:26 (ten years ago)

xps to clay, p sure i have that same jacket tho it prob looks better on him

head clowning instructor (art), Sunday, 3 May 2015 01:26 (ten years ago)

this whole series has been a dream

lag∞n, Sunday, 3 May 2015 01:26 (ten years ago)

Nate Rob! His suit is beautiful!

It's the punch drunk love suit

, Sunday, 3 May 2015 01:26 (ten years ago)

tie clashes but w/e he looks great

lag∞n, Sunday, 3 May 2015 01:27 (ten years ago)

lol @ hedo lounging in the bg of that shot. get that potassium man, don't want to catch a cramp on the bench

head clowning instructor (art), Sunday, 3 May 2015 01:28 (ten years ago)

Yeah I have a similar jacket but Nate just looks like a brilliant hunk in that thing

Clay, Sunday, 3 May 2015 01:28 (ten years ago)

lol @ hedo lounging in the bg of that shot. get that potassium man, don't want to catch a cramp on the bench

Lol I had to take a pic https://twitter.com/fldlxnc/status/594675198743437312

, Sunday, 3 May 2015 01:30 (ten years ago)

man, #newheroball sucks

moullet, Sunday, 3 May 2015 01:32 (ten years ago)

so did Reggie get demoted, have they heard our cries?

Clay, Sunday, 3 May 2015 01:33 (ten years ago)

they knew this was too srs 4 regie

lag∞n, Sunday, 3 May 2015 01:34 (ten years ago)

Reggie is gonna fight mayweather

, Sunday, 3 May 2015 01:34 (ten years ago)

Cwebb snuck in a 'flick of da wrist' on live TV I'm done

, Sunday, 3 May 2015 01:38 (ten years ago)

Game living up to wild expectations

Clay, Sunday, 3 May 2015 01:39 (ten years ago)

Reggie is gonna fight mayweather
--龜

might be one of the few situations in which you'd have to be on Reggie's side

slothroprhymes, Sunday, 3 May 2015 01:40 (ten years ago)

tony cooked manu ultra cooked

moullet, Sunday, 3 May 2015 01:42 (ten years ago)

If it ever happened hopefully the ground underneath the ring would open up into a yawning pit of hell enveloping everything on top

, Sunday, 3 May 2015 01:42 (ten years ago)

both these teams look completely exhausted

Clay, Sunday, 3 May 2015 01:46 (ten years ago)

plz game7, never end

moullet, Sunday, 3 May 2015 01:48 (ten years ago)

what a hassle to try to watch this game at public spot. 1st bar, 1 tv, people watching golf. 2nd bar, 7 TV's, all showing the golf, waitress wouldn't put on the game cause "it's the quarterfinals in this golf thing". pleaded with her and finally got NBA on 1 tv. Asked owner if any shot I could catch the end of the game on one of the shitty TV's in a corner somewhere. Nope, $30 cover for boxing match starting at 7pm. This country's sports viewing priorities so out of wack. If elected I would etc etc.

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 01:52 (ten years ago)

"it's the quarterfinals in this golf thing"

actual savages

Clay, Sunday, 3 May 2015 01:56 (ten years ago)

omg boris

moullet, Sunday, 3 May 2015 01:57 (ten years ago)

there were more TV's than occupied tables at that time too!

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 01:57 (ten years ago)

i dont get it why the USA doesn't just bomb all golf couses

anyway, game 7

moullet, Sunday, 3 May 2015 01:57 (ten years ago)

oh my god, no way

k3vin k., Sunday, 3 May 2015 01:58 (ten years ago)

Wut

, Sunday, 3 May 2015 01:58 (ten years ago)

chris paul does that 80 times a year and never gets that call. they give it to manu now?

k3vin k., Sunday, 3 May 2015 01:59 (ten years ago)

oh i forgot caddyshack. long live golf

moullet, Sunday, 3 May 2015 01:59 (ten years ago)

that's the only way manu is gonna get a 3pter at this point eh

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 01:59 (ten years ago)

CHRIS PAUL

head clowning instructor (art), Sunday, 3 May 2015 01:59 (ten years ago)

wowwww

slothroprhymes, Sunday, 3 May 2015 01:59 (ten years ago)

my take: chris paul is good

Clay, Sunday, 3 May 2015 02:00 (ten years ago)

is it the shoes?

head clowning instructor (art), Sunday, 3 May 2015 02:00 (ten years ago)

is this the isiah thomas game of cp3 career

moullet, Sunday, 3 May 2015 02:00 (ten years ago)

cp3 playing on one leg

micah, Sunday, 3 May 2015 02:01 (ten years ago)

lol at cp3 being helped up at the bench, still yelling at his team

micah, Sunday, 3 May 2015 02:02 (ten years ago)

he was yelling at the refs i think

k3vin k., Sunday, 3 May 2015 02:02 (ten years ago)

with every breath he takes

head clowning instructor (art), Sunday, 3 May 2015 02:02 (ten years ago)

Kevin Harlan might actually lift off into orbit if the end of this game is close

juice college (agent hibachi), Sunday, 3 May 2015 02:03 (ten years ago)

Cp3 has very nice lashes btw

, Sunday, 3 May 2015 02:03 (ten years ago)

Btw Austin effing up the foul and getting yelled at and yanked by his dad immediately was hysterical

juice college (agent hibachi), Sunday, 3 May 2015 02:03 (ten years ago)

an aspect of my own personal hell i'm pretty sure would be doc rivers reading really beautiful prose aloud

Clay, Sunday, 3 May 2015 02:04 (ten years ago)

doc rivers reads lengthy passages from Pale Fire as i swear to god my intentions were good

Clay, Sunday, 3 May 2015 02:06 (ten years ago)

im getting very sad the game has to end lol

moullet, Sunday, 3 May 2015 02:07 (ten years ago)

can't we just do another spurs/clips series next round instead of whoever vs rockets, ugh

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:09 (ten years ago)

they should play best of 15 then the winner vs Finals winner

moullet, Sunday, 3 May 2015 02:09 (ten years ago)

xps clay that's such a terrifying proposition

gravity's rainbow tho that could be fascinating

slothroprhymes, Sunday, 3 May 2015 02:10 (ten years ago)

did they say what happened to reggie?? not that I'm complaining...

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:11 (ten years ago)

gravity's rainbow tho that could be fascinating

a screaming comes across the sky indeed

Clay, Sunday, 3 May 2015 02:12 (ten years ago)

did they say what happened to reggie?? not that I'm complaining...

― A True White Kid that can Jump (Granny Dainger), Saturday, May 2, 2015 10:11 PM (1 minute ago)

he's in vegas for the fight

k3vin k., Sunday, 3 May 2015 02:13 (ten years ago)

ty

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:14 (ten years ago)

what's the largest lead in this game, like 5?

Clay, Sunday, 3 May 2015 02:14 (ten years ago)

think the spurs were up 7 or 8 early in the 1Q

k3vin k., Sunday, 3 May 2015 02:16 (ten years ago)

hope m bise makes it thru this 1 in good health

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:17 (ten years ago)

i think barkley also in vegas

moullet, Sunday, 3 May 2015 02:17 (ten years ago)

lol wonder if chuck really bet the draw

Clay, Sunday, 3 May 2015 02:19 (ten years ago)

I forgot to check my program for this game until now and just saw the note that due to shookness the role of kawhi Leonard will be played by Danny green

juice college (agent hibachi), Sunday, 3 May 2015 02:20 (ten years ago)

WOW redick

k3vin k., Sunday, 3 May 2015 02:23 (ten years ago)

incredible defense from blake the previous defensive possession. looked like roy hibbert

k3vin k., Sunday, 3 May 2015 02:23 (ten years ago)

this game is game 6 2013 finals level killing it

Clay, Sunday, 3 May 2015 02:23 (ten years ago)

OTM

head clowning instructor (art), Sunday, 3 May 2015 02:25 (ten years ago)

it's so fucking unfair that one of these teams has to go home but we're stuck with watching the rest of the east playoffs

k3vin k., Sunday, 3 May 2015 02:26 (ten years ago)

nah I shoulda paid $30 to retain my bar set for undercard boxing

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:26 (ten years ago)

xp

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:26 (ten years ago)

omg redick

k3vin k., Sunday, 3 May 2015 02:27 (ten years ago)

lawler's law

k3vin k., Sunday, 3 May 2015 02:27 (ten years ago)

sick

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:27 (ten years ago)

UGH TRAVEL ON BORIS

k3vin k., Sunday, 3 May 2015 02:29 (ten years ago)

KAWHI IS SICK. SICK SICK SICK!

moullet, Sunday, 3 May 2015 02:30 (ten years ago)

this is so intense

Clay, Sunday, 3 May 2015 02:30 (ten years ago)

tony no

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:31 (ten years ago)

harlan mvp

Clay, Sunday, 3 May 2015 02:31 (ten years ago)

yeeesssss

slothroprhymes, Sunday, 3 May 2015 02:31 (ten years ago)

I'm screaming

, Sunday, 3 May 2015 02:32 (ten years ago)

omg

johnny crunch, Sunday, 3 May 2015 02:32 (ten years ago)

This game is gonna give me a heart attack

juice college (agent hibachi), Sunday, 3 May 2015 02:32 (ten years ago)

this is so intense

― Clay

balls, Sunday, 3 May 2015 02:32 (ten years ago)

Holy shit this game

tsrobodo, Sunday, 3 May 2015 02:32 (ten years ago)

im clapping at home for spurs like I only do for bulls. this is some shit.

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:32 (ten years ago)

Boris-green-Parker trio has just been relentless

juice college (agent hibachi), Sunday, 3 May 2015 02:32 (ten years ago)

the bar is remarkably chill w me yelling at the tv every few mins. nobody else is watching so prob people just assume im insane

head clowning instructor (art), Sunday, 3 May 2015 02:33 (ten years ago)

doc basically trying to calm down a baby with that speech

Clay, Sunday, 3 May 2015 02:33 (ten years ago)

where is the hack wtf pop

moullet, Sunday, 3 May 2015 02:34 (ten years ago)

30 seconds tied game 7 moment you dream about on the court when you're a kid stuff

Clay, Sunday, 3 May 2015 02:35 (ten years ago)

can't hack in the last 2 minutes

k3vin k., Sunday, 3 May 2015 02:35 (ten years ago)

that was the latest whistle in nba history

Clay, Sunday, 3 May 2015 02:36 (ten years ago)

cp3 got away w one there

head clowning instructor (art), Sunday, 3 May 2015 02:37 (ten years ago)

robbery

moullet, Sunday, 3 May 2015 02:37 (ten years ago)

savvyvetmoves

slothroprhymes, Sunday, 3 May 2015 02:37 (ten years ago)

someone shackle austin rivers to the bench so he can't come in for 3 point defense

k3vin k., Sunday, 3 May 2015 02:37 (ten years ago)

I don't mind that given the shitty calls the Spurs have gotten in other games

, Sunday, 3 May 2015 02:38 (ten years ago)

that was a borderline call at a curious moment. then again the spurs have benefited from the calls all series, so

k3vin k., Sunday, 3 May 2015 02:38 (ten years ago)

really a makeup call in this situation smh

Clay, Sunday, 3 May 2015 02:39 (ten years ago)

the only replayed the foul once, looked like he got his legs

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:39 (ten years ago)

That was not a foul. Occasionally the ball does lie

head clowning instructor (art), Sunday, 3 May 2015 02:40 (ten years ago)

is it me or has pop been kinda bad this series?

Clay, Sunday, 3 May 2015 02:40 (ten years ago)

Almost purely a makeup call for the phantom one cp3 got one play earlier

juice college (agent hibachi), Sunday, 3 May 2015 02:40 (ten years ago)

Pops been a little off honestly

juice college (agent hibachi), Sunday, 3 May 2015 02:41 (ten years ago)

Holy shit holy shit holy shit

head clowning instructor (art), Sunday, 3 May 2015 02:41 (ten years ago)

Holy shit

head clowning instructor (art), Sunday, 3 May 2015 02:42 (ten years ago)

Wow

juice college (agent hibachi), Sunday, 3 May 2015 02:42 (ten years ago)

isiah thomas game. it's official

moullet, Sunday, 3 May 2015 02:42 (ten years ago)

i'm actually about to cry

k3vin k., Sunday, 3 May 2015 02:42 (ten years ago)

Cancel the fight the night can't get any better

, Sunday, 3 May 2015 02:43 (ten years ago)

xpost doc is a vgood coach too, matters a lot

moullet, Sunday, 3 May 2015 02:43 (ten years ago)

is it me or has pop been kinda bad this series?

― Clay, Saturday, May 2, 2015 10:40 PM (2 minutes ago

thought he's been fine today

k3vin k., Sunday, 3 May 2015 02:43 (ten years ago)

this is super fucked up

Clay, Sunday, 3 May 2015 02:44 (ten years ago)

whos the old man?

moullet, Sunday, 3 May 2015 02:44 (ten years ago)

damn

Clay, Sunday, 3 May 2015 02:44 (ten years ago)

Wooooooooooo

head clowning instructor (art), Sunday, 3 May 2015 02:44 (ten years ago)

chris paul might go to the conference finals!

Clay, Sunday, 3 May 2015 02:45 (ten years ago)

If there's one thing I love, it's watching the spurs lose.

head clowning instructor (art), Sunday, 3 May 2015 02:45 (ten years ago)

welp that will be a round of western basketball I will not have to watch, not too bad tbh

slothroprhymes, Sunday, 3 May 2015 02:45 (ten years ago)

usually takes some crazy stuff to knock off SA eh

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:46 (ten years ago)

Ginobili hugging green (I think) makes me think he might be done

juice college (agent hibachi), Sunday, 3 May 2015 02:47 (ten years ago)

Paul was a monster this game

juice college (agent hibachi), Sunday, 3 May 2015 02:47 (ten years ago)

yeah i think he's done, i think duncan will be back

balls, Sunday, 3 May 2015 02:47 (ten years ago)

xp

balls, Sunday, 3 May 2015 02:48 (ten years ago)

unbelievable

lag∞n, Sunday, 3 May 2015 02:48 (ten years ago)

I can't believe Duncan has a back tattoo

, Sunday, 3 May 2015 02:48 (ten years ago)

what a series

lag∞n, Sunday, 3 May 2015 02:48 (ten years ago)

that billy crystal chris Paul embrace made me irrationally happy

head clowning instructor (art), Sunday, 3 May 2015 02:49 (ten years ago)

Friendly reminder that Paul played that second half on one leg

head clowning instructor (art), Sunday, 3 May 2015 02:49 (ten years ago)

one of best gm 7s ive seen

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:51 (ten years ago)

incredible, mind-blowing, classic series. wow

k3vin k., Sunday, 3 May 2015 02:51 (ten years ago)

I'm gonna prep myself for a yellow card but...

Other than some great rebounds kawhi was secretly kinda terrible the whole game

juice college (agent hibachi), Sunday, 3 May 2015 02:52 (ten years ago)

Otoh Danny green was ballin out

juice college (agent hibachi), Sunday, 3 May 2015 02:53 (ten years ago)

kawhi was great the first 4 games and bad the last three

lag∞n, Sunday, 3 May 2015 02:54 (ten years ago)

the spurs were pretty inconsistent tbh

Clay, Sunday, 3 May 2015 02:54 (ten years ago)

I really wanted him to just dunk the bejesus out of some of those tentative layups and short jumpers

juice college (agent hibachi), Sunday, 3 May 2015 02:55 (ten years ago)

kawhi played good defense today and had some good offensive rebounds iirc, but his shot wasn't falling. he had some really tough ones that were in and out

k3vin k., Sunday, 3 May 2015 02:55 (ten years ago)

looking forward to la terminating houston w extreme prejudice

head clowning instructor (art), Sunday, 3 May 2015 02:55 (ten years ago)

(1) Warriors vs (5) Grizzlies
(2) Rockets vs (3) Clippers

(1) Hawks vs (5) Wizards
(2) Cavs vs (3) Bulls

who ya got

Clay, Sunday, 3 May 2015 02:56 (ten years ago)

didn't think he was terrible just average, hesitant to shoot at times, you'd want more out of GOAT Kawhi in a gm 7

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 02:57 (ten years ago)

lmao pop inviting reporters into the presser classic

lag∞n, Sunday, 3 May 2015 02:57 (ten years ago)

dead btw

brosario nawson (m bison), Sunday, 3 May 2015 02:58 (ten years ago)

I just can't believe it's over. Spurs been going to the finals ever since my son was born.

brosario nawson (m bison), Sunday, 3 May 2015 02:59 (ten years ago)

rip bise good run

lag∞n, Sunday, 3 May 2015 02:59 (ten years ago)

(1) Warriors vs (5) Grizzlies
(2) Rockets vs (3) Clippers

(1) Hawks vs (5) Wizards
(2) Cavs vs (3) Bulls

who ya got
--Clay

dubs in 5, clips in 6, hawks in 6...bulls in 7

slothroprhymes, Sunday, 3 May 2015 03:00 (ten years ago)

warriors in 5
clippers in 6

both east series i think are toss-ups

k3vin k., Sunday, 3 May 2015 03:00 (ten years ago)

http://www.nba.com/live1/ press for pop / doc

moullet, Sunday, 3 May 2015 03:00 (ten years ago)

And I think I wore my manu jersey for the last time at the same time as manu

brosario nawson (m bison), Sunday, 3 May 2015 03:00 (ten years ago)

Warriors in 5
Clippers in 6

Hawks in 6
Bulls in 6

Clay, Sunday, 3 May 2015 03:00 (ten years ago)

xps to bise lma prob end up in sa next yr dont worry

head clowning instructor (art), Sunday, 3 May 2015 03:01 (ten years ago)

dubs in 6, clips in 5, hawks in 5, bulls in 7

head clowning instructor (art), Sunday, 3 May 2015 03:02 (ten years ago)

lol pop saying "psychobabble" got a laugh out of me

Clay, Sunday, 3 May 2015 03:03 (ten years ago)

xps to bise lma prob end up in sa next yr dont worry
― head clowning instructor (art), Saturday, May 2, 2015 10:01 PM (3 minutes ago) Bookmark Flag Post Permalink

my happiness for the next 5 years depends on this

brosario nawson (m bison), Sunday, 3 May 2015 03:05 (ten years ago)

Warriors in 4
Clippers in 5

Hawks in 5
Bulls in 7

lag∞n, Sunday, 3 May 2015 03:06 (ten years ago)

nate rob is bad at this

Clay, Sunday, 3 May 2015 03:08 (ten years ago)

Praying for warriors clips and I want Steph to murk.these.fools.

brosario nawson (m bison), Sunday, 3 May 2015 03:11 (ten years ago)

wonder when the last time both finals teams were out in the first round

lag∞n, Sunday, 3 May 2015 03:13 (ten years ago)

brosario nawson (m bison)
Posted: May 2, 2015 at 11:11:34 PM
Praying for warriors clips and I want Steph to murk.these.fools

suspect u will get ur wish on both counts

lag∞n, Sunday, 3 May 2015 03:14 (ten years ago)

was rooting for spurs but i'm happy that (presuming clips get past rockets) the 'what's wrong w/ cp3 in the playoffs' bs narrative is going to be buried

balls, Sunday, 3 May 2015 03:14 (ten years ago)

yeah glad i don't have to pick between the spurs and gsw in the conf finals

Clay, Sunday, 3 May 2015 03:15 (ten years ago)

whos the old man?

― moullet, Sunday, May 3, 2015 12:44 PM

yelling at the timekeeper? spurs owner

micah, Sunday, 3 May 2015 03:16 (ten years ago)

Paul impressed me so much in this series. He was incredible

brosario nawson (m bison), Sunday, 3 May 2015 03:16 (ten years ago)

xpost lol, thanks micah

moullet, Sunday, 3 May 2015 03:17 (ten years ago)

Other than some great rebounds kawhi was secretly kinda terrible the whole game

― juice college (agent hibachi), Sunday, May 3, 2015 12:52 PM

matt barnes played fantastic defense on him and improved every game imo

micah, Sunday, 3 May 2015 03:17 (ten years ago)

he played an alltime great series xps re: cp3

Clay, Sunday, 3 May 2015 03:18 (ten years ago)

Anyone with espn 1nsider got this? "Roster Reload: Spurs' rebuild finally begin this offseason?"

brosario nawson (m bison), Sunday, 3 May 2015 03:18 (ten years ago)

Blake was great too. Dre took tony out of this series.

Also tim was amazing all series long.

brosario nawson (m bison), Sunday, 3 May 2015 03:19 (ten years ago)

tim duncan is unreal

lag∞n, Sunday, 3 May 2015 03:20 (ten years ago)

shaq just tried to sing when doves cry but ... that was not the melody or the lyrics to when doves cry

Clay, Sunday, 3 May 2015 03:22 (ten years ago)

brutal

lag∞n, Sunday, 3 May 2015 03:23 (ten years ago)

lol fight servers crashing ppl saying they're delaying the main event

lag∞n, Sunday, 3 May 2015 03:26 (ten years ago)

"im a better person cause i went through this series" doc

wow man, fuck doc

moullet, Sunday, 3 May 2015 03:26 (ten years ago)

wut that cld be true lol

lag∞n, Sunday, 3 May 2015 03:26 (ten years ago)

As teams complete their seasons, ESPN Insider's NBA team will take a look at the offseason picture and priorities for all 30 teams. Below, Kevin Pelton offers a snapshot of the San Antonio Spurs.

2014-15 record: 55-27
Pythagorean record: 57-25
Offensive Rating: 106.2 (7th)
Defensive Rating: 99.6 (3rd)

Under Contract For 2015-16
PLAYER SALARY RPM WARP
Tiago Splitter $8,500,000 3.7 3.1
Patrick Mills $3,578,947 0.2 1.2
Boris Diaw $7,500,000 0.2 0.6
Tony Parker $13,437,500 -3.2 0.5
Kyle Anderson $1,142,880 -3.2 -0.6
Possible Free Agents
PLAYER TYPE RPM WARP
Tim Duncan Unrestricted 4.4 11.8
Kawhi Leonard Restricted 8.4 10.8
Daniel Green Unrestricted 4.9 9.9
Manu Ginobili Unrestricted 4.2 4.4
Cory Joseph Restricted 1.1 1.5
Aron Baynes Restricted 0.3 1.1
Marco Belinelli Unrestricted -3.6 0.9
Jeff Ayres Unrestricted -3.1 0.2
Matt Bonner Unrestricted -4.3 0.2
Reggie Williams Non-guaranteed - 0.0
Draft picks

Own first-round pick (26th)
Own second-round pick (55th)

Projected cap space

Maximum: $29.3 million
Minimum: $0
Likely: $0

What's returning

The Spurs have just five players under guaranteed contract, including a pair of starters. Last August, point guard Tony Parker signed a three-year, $43 million extension that looked like a bargain at the time. Parker's future is more uncertain after a down season that saw him battle injuries (most notably to his hamstring) and post his lowest PER (15.9) in more than a decade. Parker, who will soon turn 33, may be heading toward a more even timeshare at the point with backup Patty Mills, a year removed from shoulder surgery that sidelined him through late December and hampered his shooting percentages.

EDITOR'S PICKS

NBA offseason looks for all 30 teams
Marc Stein and Kevin Pelton provide offseason plans for every eliminated team in the NBA.
Up front, the complementary duo of Boris Diaw and Tiago Splitter returns. Diaw played his way into shape in time to be a major factor in the postseason. Splitter dealt with a mysterious nerve injury that affected his calf, and a calf injury limited him in the playoffs. When he was healthy, however, Splitter was good as ever.

Rookie Kyle Anderson spent most of the season in the D-League, seeing just 358 minutes of action -- all but 19 before the All-Star break.

Free agents

Coming off winning Finals MVP, Kawhi Leonard made the leap at age 23, emerging as San Antonio's go-to player in the second half of the season after working through a hand ligament injury. Leonard won Defensive Player of the Year honors and boosted his scoring average from 15.8 to 18.7 points per 36 minutes. The Spurs declined to sign Leonard to an extension last fall to preserve cap flexibility, since he counts just $7.2 million against the cap until re-signed. Expect San Antonio to make Leonard a maximum qualifying offer, which would guarantee him five years at the maximum salary if he accepts it and would force other teams to offer him at least three guaranteed years rather than the usual two.

With Leonard sure to return, the big question for the Spurs is whether veterans Tim Duncan and Manu Ginobili plan to continue playing. At 39, Duncan remains one of the league's better players on a per-minute basis, and Ginobili (38 in July) is still a useful reserve. If they do retire, San Antonio can clear about $14.5 million under the cap. if the Spurs were to lure a max free agent, they'd surely be able to create enough room via trade. There's also the possibility one or both players could take a large pay cut to clear cap space.

The last starter hitting free agency is shooting guard Danny Green. While Green had a disappointing series against the Clippers, as a premier 3-and-D specialist he's sure to get a huge raise from the $4-plus million he made in 2013-14. If Green's price tag skyrockets, San Antonio might have a tough choice to make.

Several reserves are also on the market. Young point guard Cory Joseph might look elsewhere for more playing time after competing with Mills to back up Parker. Marco Belinelli has given San Antonio cost-effective shooting off the bench. Aron Baynes stepped in capably during Splitter's injury, and veteran Matt Bonner is likely to be back as a stretch 4.

Biggest need: A younger star

Age is the Spurs' biggest weakness at this point, and if Duncan and Ginobili retire this offseason will give them the opportunity to reload with a younger cast. Parker's health and effectiveness remain a concern, but in Leonard San Antonio has one star for years to come. Adding another in the prime of his career would allow the Spurs to extend their run beyond Duncan's eventual retirement.

Biggest Question: How long will Duncan and Ginobili keep playing?

Really, the decisions Duncan and Ginobili make about retirement will drive everything San Antonio does this summer. If they want to come back, it's possible the Spurs will return a relatively similar core next season in the hopes that better health and better luck -- they were a win away from the No. 2 seed and home-court advantage until the Western Conference finals -- change the outcome of their season.

Ideal Offseason

Duncan and Ginobili decide to hang it up, and San Antonio deals Diaw to make way for LaMarcus Aldridge to return to Texas as Duncan's heir apparent. With the rest of the core intact, the Spurs stay in the hunt for home-court advantage in the first half of the season. At the All-Star break, Duncan announces his return to play for the veteran's minimum (hat tip to Bill Simmons on that notion), giving San Antonio its deepest frontcourt since Duncan played next to David Robinson. With Parker staying healthy and Mills providing scoring punch off the bench, the Spurs win their sixth championship of the Duncan-Popovich era.

k3vin k., Sunday, 3 May 2015 03:27 (ten years ago)

At the All-Star break, Duncan announces his return to play for the veteran's minimum (hat tip to Bill Simmons on that notion)

lol simmons loves drama so much

Clay, Sunday, 3 May 2015 03:31 (ten years ago)

Thanks belovéd

brosario nawson (m bison), Sunday, 3 May 2015 03:48 (ten years ago)

I don't think trading boris to get lma would be necessary bc they could always trade splitter instead

brosario nawson (m bison), Sunday, 3 May 2015 03:49 (ten years ago)

And also I could not bear to see Bobo on another team

brosario nawson (m bison), Sunday, 3 May 2015 03:50 (ten years ago)

blake tho 24-13-10

lag∞n, Sunday, 3 May 2015 05:00 (ten years ago)

just finished this amazing game. one of the best I've ever seen and easily one of the all time greatest quarters

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 05:01 (ten years ago)

danny green so many cool blocks

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 05:01 (ten years ago)

too bad about that one second half he had though xps

Clay, Sunday, 3 May 2015 05:01 (ten years ago)

Blake gonna burn the city of Houston to the ground

head clowning instructor (art), Sunday, 3 May 2015 05:02 (ten years ago)

crazy that the clips won that series with 6 players + one good game from austin and a quarters worth of ok play by big baby

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 05:02 (ten years ago)

fucking batshit good game; new respect for the clippers starters

Premise ridiculous. Who have two potato? (forksclovetofu), Sunday, 3 May 2015 05:03 (ten years ago)

jj redick also drilled ~5 threes over seven games so don't forget that contrib

head clowning instructor (art), Sunday, 3 May 2015 05:03 (ten years ago)

cp3 final four games of the series 99pts 38ast 4to

lag∞n, Sunday, 3 May 2015 05:05 (ten years ago)

1leg

head clowning instructor (art), Sunday, 3 May 2015 05:06 (ten years ago)

jj redick also drilled ~5 threes over seven games so don't forget that contrib

― head clowning instructor (art), Saturday, May 2, 2015 10:03 PM (2 minutes ago) Bookmark Flag Post Permalink

?

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 05:06 (ten years ago)

my condolences to m bise

Nhex, Sunday, 3 May 2015 05:07 (ten years ago)

watching the 4th q again

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 05:15 (ten years ago)

redick is a guy im irrationally critical of for p much no reason. his 3pt %age wasn't great but he put in solid cobtribtions in every game

head clowning instructor (art), Sunday, 3 May 2015 05:21 (ten years ago)

ppl wondering where reggie was -

http://i.kinja-img.com/gawker-media/image/upload/s--c0bswKw6--/c_fit,fl_progressive,q_80,w_636/1235360488619993520.jpg

balls, Sunday, 3 May 2015 05:26 (ten years ago)

hah theyre shithoused

lag∞n, Sunday, 3 May 2015 05:27 (ten years ago)

reddick shot over 40% from three on the series

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 05:32 (ten years ago)

Barkley is prob shithoused most nights of the week.

Aimless, Sunday, 3 May 2015 05:38 (ten years ago)

God I hate Reggie miller so much

juice college (agent hibachi), Sunday, 3 May 2015 10:58 (ten years ago)

blake tho 24-13-10

― lag∞n, Sunday, May 3, 2015 1:00 AM (5 hours ago) Bookmark Flag Post Permalink

Blake broke into simmons's old 42 club for the whole series, he was really awesome

juice college (agent hibachi), Sunday, 3 May 2015 11:00 (ten years ago)

I agree w the general sentiment that Tim comes back though, he was great all year into this series, they were one win from the 2 seed and one shot from the second round (where they probably would have rolled)

juice college (agent hibachi), Sunday, 3 May 2015 11:01 (ten years ago)

Warriors in 5
Clippers in 7 (I bet they have a lot of trouble w harden and cp3 might be messed up for a game or two)

Wiz in 7
Cavs in 6

These will all be wrong obv

juice college (agent hibachi), Sunday, 3 May 2015 11:03 (ten years ago)

gsw in 6
lac in 7
atl in 5
chi in 6

micah, Sunday, 3 May 2015 13:15 (ten years ago)

Warriors 6, Clips 6, ATL 6, Cavs 5 =)

, Sunday, 3 May 2015 14:01 (ten years ago)

warriors 6, clips 7, atl 7, cavs 6

call all destroyer, Sunday, 3 May 2015 14:10 (ten years ago)

Warriors 4, clips 4, bulls 4, don't care 7.

Jeff, Sunday, 3 May 2015 14:25 (ten years ago)

it really sucks how there's such a weak selection of women's jerseys out there

k3vin k., Sunday, 3 May 2015 15:28 (ten years ago)

pierce ain't making his shots but drew gooden is lol

slothroprhymes, Sunday, 3 May 2015 17:19 (ten years ago)

this game is p good both teams playing very fast

lag∞n, Sunday, 3 May 2015 17:36 (ten years ago)

wall down hard

lag∞n, Sunday, 3 May 2015 17:53 (ten years ago)

Kurt Helin ‏@basketballtalk 15m15 minutes ago
Doc Rivers on whether Chris Paul will play in Game 1 vs. Rockets: ‘If I had to guess, I would say no’

lag∞n, Sunday, 3 May 2015 18:16 (ten years ago)

Oof. Starting Austin then eh?

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 18:18 (ten years ago)

jamal one wld hope

lag∞n, Sunday, 3 May 2015 18:31 (ten years ago)

Yah but then literally zero scoring from the bench

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 18:35 (ten years ago)

Big baby played me hard w that fake injury. Probably one of my least favorite players in league history

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 18:37 (ten years ago)

just have to not play the whole bench at once, doc seems to have finally figured that one out xp

lag∞n, Sunday, 3 May 2015 18:46 (ten years ago)

the Hawks D has really fallen apart and they were such a wacky team defensively even before the Thabo injury, but with the Love injury and the Western Conference Death March I can't write them off yet

Matt Armstrong, Sunday, 3 May 2015 18:54 (ten years ago)

Yah lol xp when doc did the hockey style subs the first game and they lost a 20 point lead in 45 seconds or whatever I'm sure that was the best thing that coulda happened on that series to wake doc up.

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 18:56 (ten years ago)

I forgot Hubie coached the Hawks

Matt Armstrong, Sunday, 3 May 2015 18:58 (ten years ago)

oh shit beal :/

slothroprhymes, Sunday, 3 May 2015 18:59 (ten years ago)

lotta pain there for just a sprained ankle, hope he just has high performance nerves

Matt Armstrong, Sunday, 3 May 2015 18:59 (ten years ago)

wall was down rolling around like that earlier

lag∞n, Sunday, 3 May 2015 19:00 (ten years ago)

pierce giving lessons?

Matt Armstrong, Sunday, 3 May 2015 19:00 (ten years ago)

lots of people tweet about how they're sick of Paul Pierce wheelchair jokes but some things are just the gold standard

Matt Armstrong, Sunday, 3 May 2015 19:01 (ten years ago)

Yah

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 19:13 (ten years ago)

man, come on beal

Matt Armstrong, Sunday, 3 May 2015 19:15 (ten years ago)

he was crying going to the locker room

Matt Armstrong, Sunday, 3 May 2015 19:16 (ten years ago)

jeeesus hawks can't buy a shot

slothroprhymes, Sunday, 3 May 2015 19:16 (ten years ago)

xp are you calling him weak or a flopper or what

slothroprhymes, Sunday, 3 May 2015 19:17 (ten years ago)

WHAT THE FUCK EVEN WAS THAT UGH

slothroprhymes, Sunday, 3 May 2015 19:18 (ten years ago)

lol and now pierce with the rest on the floor

Matt Armstrong, Sunday, 3 May 2015 19:19 (ten years ago)

well i guess that's some redemption but jeez hawks

slothroprhymes, Sunday, 3 May 2015 19:19 (ten years ago)

think atlanta just missed over 100 shots in 5 seconds

lag∞n, Sunday, 3 May 2015 19:19 (ten years ago)

so glad that wasn't a charge

A True White Kid that can Jump (Granny Dainger), Sunday, 3 May 2015 19:19 (ten years ago)

xp are you calling him weak or a flopper or what

― slothroprhymes, Sunday, May 3, 2015 7:17 PM (2 minutes ago) Bookmark Flag Post Permalink

if you roll around on the floor for a minute and lumber to the locker room crying it better not just be a sprained ankle or you are a drama queen.

Matt Armstrong, Sunday, 3 May 2015 19:20 (ten years ago)

it could always turn out that he's super tough and playing on a fractured ankle rn

Matt Armstrong, Sunday, 3 May 2015 19:20 (ten years ago)

feel like Teague's reluctance to shoot hurting the Hawks a little?

Matt Armstrong, Sunday, 3 May 2015 19:21 (ten years ago)

ya he looks real tentative

lag∞n, Sunday, 3 May 2015 19:22 (ten years ago)

john wall's the best player on either team

J0rdan S., Sunday, 3 May 2015 19:22 (ten years ago)

beal went back in and tried (before having to come back out again) so i don't think he's "soft" or insert-cliche-here

slothroprhymes, Sunday, 3 May 2015 19:24 (ten years ago)

Beal stayed in

Matt Armstrong, Sunday, 3 May 2015 19:25 (ten years ago)

that 4th quarter collapse was very celtics-esque :[

slothroprhymes, Sunday, 3 May 2015 19:27 (ten years ago)

Paul Pierce isn't soft either, it's more about being really dramatic

Matt Armstrong, Sunday, 3 May 2015 19:27 (ten years ago)

oh I guess Beal came out with like 30 seconds left whatever

Matt Armstrong, Sunday, 3 May 2015 19:27 (ten years ago)

"The Grizzlies and The Spurs come up next," man Reggie Miller was right about this being the most unpredictable playoffs

Matt Armstrong, Sunday, 3 May 2015 19:28 (ten years ago)

ugh ... mark jackson again?

polyphonic, Sunday, 3 May 2015 19:33 (ten years ago)

warriors are gonna cruise to third round, memphis bout to be exposed

brosario nawson (m bison), Sunday, 3 May 2015 19:54 (ten years ago)

dubs have an answer for every attack it is a thing of beauty

slothroprhymes, Sunday, 3 May 2015 19:55 (ten years ago)

Z Bo, what an artist

Matt Armstrong, Sunday, 3 May 2015 20:02 (ten years ago)

It's hard to believe he's the same guy who played on the Knicks

polyphonic, Sunday, 3 May 2015 20:07 (ten years ago)

ugh ... mark jackson again?

― polyphonic, Sunday, May 3, 2015 3:33 PM (39 minutes ago) Bookmark Flag Post Permalink

feel like hes been more subdued recently wonder whats going on in his life

lag∞n, Sunday, 3 May 2015 20:14 (ten years ago)

yeah he seems p chill

polyphonic, Sunday, 3 May 2015 20:15 (ten years ago)

okay now he's defending mayweather lol

polyphonic, Sunday, 3 May 2015 20:17 (ten years ago)

Mark Jackson saying he's seen all of the greatest boxers in history.

Matt Armstrong, Sunday, 3 May 2015 20:18 (ten years ago)

Would love to hear Mark break down the Joe Gans vs. Benny Leonard debate

Matt Armstrong, Sunday, 3 May 2015 20:18 (ten years ago)

assertive tony allen!

slothroprhymes, Sunday, 3 May 2015 20:19 (ten years ago)

they shd put tony allen on steph all series just to amuse us

lag∞n, Sunday, 3 May 2015 20:20 (ten years ago)

I watch about 1000000 NBA games each season and just had to change the channel during a playoff game because of Mark Jackson

Matt Armstrong, Sunday, 3 May 2015 20:23 (ten years ago)

just mute it man!

slothroprhymes, Sunday, 3 May 2015 20:29 (ten years ago)

haha this trollish tony allen booing is hilarious

polyphonic, Sunday, 3 May 2015 20:31 (ten years ago)

ugh - hawks shooting was a big issue w/ the nets, chalked it up to horford and milsap injuries but was hoping they'd shook it off w/ game 6. hawks d i can't explain, losing thabo hurts yeah but he missed a huge chunk of the season when they were fine w/o him. i was hoping we'd at least make ecf cuz that would be the best the atlanta hawks have ever done and was ecstatic when the bulls ended up on the cavs side of the bracket cuz it would weaken whoever did make it to the ecf plus we owned the nets and wizards all season. now, not so much. this team was unlikely to win a championship as composed and i've been wondering what moves they could and should make. i love pg's and i love teague but i'll admit when i watched the clips and wiz play this year i was coveting pretty hard. paul esp haunting cuz that's the one time i found looking at past drafts over the past 30 or so years where the hawks really blew it (not counting cases where everybody blew it like the spurs w/ manu and parker or something), i thought maybe it was the case w/ the lebron draft cuz that draft was so crazy loaded and we traded our pick but even there we only would've gotten like tj ford or something. it was super well known the fans wanted paul and that team at the time desperately needed a pg even. anyway i'll be there for game 2, maybe we can turn it around.

balls, Sunday, 3 May 2015 20:34 (ten years ago)

losing thabo hurts yeah but he missed a huge chunk of the season when they were fine w/o him.

― balls, Sunday, May 3, 2015 8:34 PM (4 minutes ago) Bookmark Flag Post Permalink

They were fine without him, but certainly not as good, right?

Matt Armstrong, Sunday, 3 May 2015 20:40 (ten years ago)

"By no means am I Dr. Benjamin Carson." - Jalen Rose, on his lack of medical expertise

polyphonic, Sunday, 3 May 2015 20:41 (ten years ago)

they went 17-13 in games he didn't play... xp holy shit Jalen

Matt Armstrong, Sunday, 3 May 2015 20:43 (ten years ago)

yikes, didn't realize their record was that bad w/o him. could've sworn he went out around the time of the streak.

balls, Sunday, 3 May 2015 20:48 (ten years ago)

thabo played 20mins a game for the hawks for 50 games this season doubt he was v key either way

lag∞n, Sunday, 3 May 2015 20:51 (ten years ago)

otto porter has turned into a professional basketball player

balls, Sunday, 3 May 2015 20:53 (ten years ago)

worth noting hawks are performing somewhere in the neighborhood of what most ppl wld prob guess based on their roster

lag∞n, Sunday, 3 May 2015 20:54 (ten years ago)

ben carson btw is one of the most accomplished living physicians in the world and revered by the black community, no amount of bullshit conservative politics are gonna reverse that

k3vin k., Sunday, 3 May 2015 20:56 (ten years ago)

thabo played 20mins a game for the hawks for 50 games this season doubt he was v key either way

― lag∞n, Sunday, May 3, 2015 8:51 PM (3 minutes ago) Bookmark Flag Post Permalink

their offense was almost exactly the same with him on the floor and their defense was dramatically better with him on the floor. We can try to find explanations for that which aren't Thabo based but it is what it is.

Matt Armstrong, Sunday, 3 May 2015 20:56 (ten years ago)

we can try to connect that to observations abt the winning % with or without him... or not :)

lag∞n, Sunday, 3 May 2015 20:57 (ten years ago)

idk what you mean by that

Matt Armstrong, Sunday, 3 May 2015 20:59 (ten years ago)

youre making two observations
1.the hawks defense was better while he was in the game
2. the hawks record was better while he healthy

are those two things related or no

lag∞n, Sunday, 3 May 2015 21:01 (ten years ago)

was thabos 20mins of good D a game the cause of the hawks going on an insane tear

lag∞n, Sunday, 3 May 2015 21:03 (ten years ago)

maybe he shdve been starting

lag∞n, Sunday, 3 May 2015 21:03 (ten years ago)

maybe he shdve been on the allstar team

lag∞n, Sunday, 3 May 2015 21:03 (ten years ago)

personally i think they were just clicking and playing over their heads

lag∞n, Sunday, 3 May 2015 21:05 (ten years ago)

nah, other than demarre who's really kept us alive the past few games i'd say the rest of the starting five is underperforming either due to injuries (horford + milsap), teams focusing on them + possible regression (korver), or who knows (teague). i still think sub out teague for wall and strengthen up the bench and this team is a legit title contender.

balls, Sunday, 3 May 2015 21:06 (ten years ago)

They were essentially the same on offense when he was in the game, significantly better on defense, and more likely to win the game when he was active. As I said there's ways to explain this without admitting that Thabo was important to them but it's an argument made from behind the 8 ball and would take some legwork.

Matt Armstrong, Sunday, 3 May 2015 21:06 (ten years ago)

he also had 2 significant injuries this season, so you have to argue that this coincidence happened twice.

Matt Armstrong, Sunday, 3 May 2015 21:08 (ten years ago)

so youre saying that thabo is the key to the hawks current slide or naw

lag∞n, Sunday, 3 May 2015 21:08 (ten years ago)

his 20mins a game of good D

lag∞n, Sunday, 3 May 2015 21:08 (ten years ago)

**drudge siren**

DAVID LEE SIGHTING

k3vin k., Sunday, 3 May 2015 21:09 (ten years ago)

but it's an argument made from behind the 8 ball and would take some legwork.

― Matt Armstrong, Sunday, May 3, 2015 5:06 PM (3 minutes ago) Bookmark Flag Post Permalink

lmaoooo

lag∞n, Sunday, 3 May 2015 21:09 (ten years ago)

they're in the second round of the playoffs and just lost a close game, they aren't being demoted to the D League

Matt Armstrong, Sunday, 3 May 2015 21:10 (ten years ago)

they r playing a lot worse then they were earlier in the season

lag∞n, Sunday, 3 May 2015 21:11 (ten years ago)

right but that decline almost exactly coincided with Thabo's first injury so that's a problem for your position that you actually have to come up with evidence to dispute beyond lmao

Matt Armstrong, Sunday, 3 May 2015 21:13 (ten years ago)

when it happened I was like whatever bazemore is fine but that hasn't panned out

Matt Armstrong, Sunday, 3 May 2015 21:14 (ten years ago)

whats that expression about coronation?

lag∞n, Sunday, 3 May 2015 21:15 (ten years ago)

lol correlation

lag∞n, Sunday, 3 May 2015 21:15 (ten years ago)

if u can tell a good story about how a low usage 20min a night role player cld have such a profound effect on the fortunes of a team i will try to not laugh at your behind the 8 ball legwork talk

lag∞n, Sunday, 3 May 2015 21:17 (ten years ago)

that's the thing though, Thabo has the highest correlation for any factor you could choose, and it's parsimonious so you have to do some legwork and can't just dismiss it.

Matt Armstrong, Sunday, 3 May 2015 21:19 (ten years ago)

its high correlation but doesnt make any sense, is prob not true

lag∞n, Sunday, 3 May 2015 21:20 (ten years ago)

if u can tell a good story about how a low usage 20min a night role player cld have such a profound effect on the fortunes of a team i will try to not laugh at your behind the 8 ball legwork talk

― lag∞n, Sunday, May 3, 2015 9:17 PM (1 minute ago) Bookmark Flag Post Permalink

bad bench, bad backup.

Matt Armstrong, Sunday, 3 May 2015 21:20 (ten years ago)

yr still only replacing a 20mins a night guy who did almost nothing on offense

lag∞n, Sunday, 3 May 2015 21:21 (ten years ago)

maybe bazemore does bad things on offense

Matt Armstrong, Sunday, 3 May 2015 21:22 (ten years ago)

i mean u cld prob put austin rivers in there and all things being equal not cause a team to go from beating western powerhouses to struggling against the nets

lag∞n, Sunday, 3 May 2015 21:22 (ten years ago)

the hawks decline is like they lost an allstar starter

lag∞n, Sunday, 3 May 2015 21:22 (ten years ago)

https://vine.co/v/e7YXOAnK6P6

polyphonic, Sunday, 3 May 2015 21:23 (ten years ago)

the hawks decline is like they lost an allstar starter

― lag∞n, Sunday, May 3, 2015 9:22 PM (3 minutes ago) Bookmark Flag Post Permalink

well I disagree about this

Matt Armstrong, Sunday, 3 May 2015 21:27 (ten years ago)

they were really good for a while they were crushing bad teams and beating great ones!

lag∞n, Sunday, 3 May 2015 21:29 (ten years ago)

look at dec-feb its insane http://espn.go.com/nba/team/schedule/_/name/atl/seasontype/2/atlanta-hawks

lag∞n, Sunday, 3 May 2015 21:30 (ten years ago)

watching them they were clearly clicking on all cylinders, now theyre just clicking on a normal amount of cylinders and m/l playing up to their talent level

lag∞n, Sunday, 3 May 2015 21:31 (ten years ago)

love seeing conley coaching on the bench a little

k3vin k., Sunday, 3 May 2015 21:38 (ten years ago)

Conley should not be allowed outside without sunglasses on

, Sunday, 3 May 2015 21:48 (ten years ago)

Why were Curry's mom and his wife sitting so far back while his dad and brother were just a few rows from courtside?

Madison Dumbbarfer (Leee), Sunday, 3 May 2015 21:50 (ten years ago)

Eye patch acceptable if no shades available.

Madison Dumbbarfer (Leee), Sunday, 3 May 2015 21:51 (ten years ago)

Conley should not be allowed outside without sunglasses on
--龜

rude, this is discriminatory against ballers with facial injuries

slothroprhymes, Sunday, 3 May 2015 22:40 (ten years ago)

I would argue that the hawks struggles have everything to do with Teague not being a scoring threat

Heez, Sunday, 3 May 2015 23:04 (ten years ago)

the Wizards are yet to lose a game in the 2015 playoffs

what

Clay, Sunday, 3 May 2015 23:16 (ten years ago)

no way that shits sustainable

but yea its crazy regardless

slothroprhymes, Sunday, 3 May 2015 23:18 (ten years ago)

Had no idea Blake had a kid

#wegonnabechampionship (Spottie), Sunday, 3 May 2015 23:57 (ten years ago)

me stereotyping i'm sure but i wouldn't be shocked if that dude raised a little phil rivers type army

balls, Monday, 4 May 2015 00:35 (ten years ago)

Steph MVP =)

, Monday, 4 May 2015 00:44 (ten years ago)

Had no idea Blake had a kid

― #wegonnabechampionship (Spottie), Sunday, May 3, 2015 11:57 PM (Yesterday) Bookmark Flag Post Permalink

with the same woman who had matt leinarts illegitimate child too

panettone for the painfully alone (mayor jingleberries), Monday, 4 May 2015 19:51 (ten years ago)

niice

lag∞n, Monday, 4 May 2015 19:56 (ten years ago)

she is set

#wegonnabechampionship (Spottie), Monday, 4 May 2015 20:14 (ten years ago)

chef curry press conference streaming rn

slothroprhymes, Monday, 4 May 2015 20:23 (ten years ago)

cavs are being hosed (for now)

slothroprhymes, Monday, 4 May 2015 23:43 (ten years ago)

Haha you guys Anderson varajao with the facial hair looks exactly like...inigo montoya

juice college (agent hibachi), Monday, 4 May 2015 23:56 (ten years ago)

my name is anderson varejao you killed my achilles prepare to die

slothroprhymes, Monday, 4 May 2015 23:57 (ten years ago)

what what the heck just happened

slothroprhymes, Monday, 4 May 2015 23:58 (ten years ago)

CHRIS WEBBER WON'T SHUT THE FUCK UP

Mr. Snrub, Monday, 4 May 2015 23:59 (ten years ago)

do not disparage c-webb sir he's all we've got on TNT broadcasts aside from harlan and marv

slothroprhymes, Tuesday, 5 May 2015 00:00 (ten years ago)

cp3 out of game 1 :(

Clay, Tuesday, 5 May 2015 00:08 (ten years ago)

hopefully thats it

#wegonnabechampionship (Spottie), Tuesday, 5 May 2015 00:13 (ten years ago)

o my god jimmy buckets don't hurt em

slothroprhymes, Tuesday, 5 May 2015 00:30 (ten years ago)

ESPN Stats & Info ‏@ESPNStatsInfo 1m1 minute ago
Bulls are currently shooting better outside the paint (56.7%) than they are inside the paint (52.9%)

prob need a better plan if theyre gonna win this series

lag∞n, Tuesday, 5 May 2015 00:33 (ten years ago)

basketball is a gaem of runs

lag∞n, Tuesday, 5 May 2015 00:43 (ten years ago)

shd put bron on rose in the 4th for old times sake

lag∞n, Tuesday, 5 May 2015 00:51 (ten years ago)

this game is a lot better than I thought it'd be tbh

slothroprhymes, Tuesday, 5 May 2015 01:04 (ten years ago)

rose stay taking terrible shots

lag∞n, Tuesday, 5 May 2015 01:05 (ten years ago)

but they go in

slothroprhymes, Tuesday, 5 May 2015 01:06 (ten years ago)

(in this game)

slothroprhymes, Tuesday, 5 May 2015 01:06 (ten years ago)

they went in

lag∞n, Tuesday, 5 May 2015 01:06 (ten years ago)

He made one of them

Nu era rose is fine a p good player but I just don't find his game that interesting or exciting

juice college (agent hibachi), Tuesday, 5 May 2015 01:07 (ten years ago)

I mean that's blake griffin's new thing and we're all happy about him doing it, like oh look the puppy made a long 2

slothroprhymes, Tuesday, 5 May 2015 01:07 (ten years ago)

blake takes good shots and makes them

lag∞n, Tuesday, 5 May 2015 01:08 (ten years ago)

rose takes contested off balance shots and hes a worse shooter than blake

lag∞n, Tuesday, 5 May 2015 01:08 (ten years ago)

Ya goon otm here blakes jumper opened up his game and he's p smart abt which one to take and when to dish

juice college (agent hibachi), Tuesday, 5 May 2015 01:11 (ten years ago)

ya almost exclusively takes wide open looks where hes set and in rhythm, and is a quick great passer when he decides not to shoot

lag∞n, Tuesday, 5 May 2015 01:13 (ten years ago)

be interesting to see if he can extend his range out to three

lag∞n, Tuesday, 5 May 2015 01:14 (ten years ago)

Lebron seems like...not in full playoff mode here, lot of weird lapse of concentration type mistakes

juice college (agent hibachi), Tuesday, 5 May 2015 01:15 (ten years ago)

Missing his boo jr I guess

juice college (agent hibachi), Tuesday, 5 May 2015 01:16 (ten years ago)

Naaaaaah
http://youtu.be/NiDpz3WtCRY

#wegonnabechampionship (Spottie), Tuesday, 5 May 2015 01:16 (ten years ago)

right blake figured it out with the long jumpers but it took a while I would be willing to believe rose could do the same to take some wear off his body

if he's still doing it midway through next season with as bad a percentage than yea we have a major jump shooting prob

slothroprhymes, Tuesday, 5 May 2015 01:16 (ten years ago)

if blake ever figures out threes O_O

slothroprhymes, Tuesday, 5 May 2015 01:17 (ten years ago)

lebron has seemed not that engaged all year, except when he was very not engaged, who knows whats up w him

lag∞n, Tuesday, 5 May 2015 01:17 (ten years ago)

if he's still doing it midway through next season with as bad a percentage than yea we have a major jump shooting prob

― slothroprhymes, Monday, May 4, 2015 9:16 PM (1 minute ago) Bookmark Flag Post Permalink

rose just does not have a very good shooting mechanics, drives coach nick crazy lol

lag∞n, Tuesday, 5 May 2015 01:18 (ten years ago)

Naaaaaah
http://youtu.be/NiDpz3WtCRY

― #wegonnabechampionship (Spottie), Monday, May 4, 2015 6:16 PM (48 seconds ago) Bookmark Flag Post Permalink

lol i forgot about this classic warriors bench era

Clay, Tuesday, 5 May 2015 01:18 (ten years ago)

It's crazy how lbj is still a 25-7-7 guy even when he's not engaged

#wegonnabechampionship (Spottie), Tuesday, 5 May 2015 01:19 (ten years ago)

Think roses problem with bad shot selection is he still has the mind of an MVP in peak physical health but that's not what he is anymore

Basically he was a hero baller once but he shldnt be trying to play hero ball anymore

juice college (agent hibachi), Tuesday, 5 May 2015 01:19 (ten years ago)

Man jimmy butler is good I like him

juice college (agent hibachi), Tuesday, 5 May 2015 01:20 (ten years ago)

its too bad the warriors cldnt have kept bazemore this season wldve been truly epic cn u imagine him during the klay 37 pt quarter

lag∞n, Tuesday, 5 May 2015 01:20 (ten years ago)

Basically he was a hero baller once but he shldnt be trying to play hero ball anymore

― juice college (agent hibachi), Monday, May 4, 2015 9:19 PM (35 seconds ago) Bookmark Flag Post Permalink

super tough adjustment for most guys

lag∞n, Tuesday, 5 May 2015 01:20 (ten years ago)

this is butler's team now afaic.

slothroprhymes, Tuesday, 5 May 2015 01:21 (ten years ago)

End of games rose shouldn't be allowed to take a short further than 5 feet from the basket.

Jeff, Tuesday, 5 May 2015 01:22 (ten years ago)

And no more behind the back dribbles while driving.

Jeff, Tuesday, 5 May 2015 01:22 (ten years ago)

ah irving punked himself trying to draw the foul on that three

lag∞n, Tuesday, 5 May 2015 01:23 (ten years ago)

Bazemore woulda collapsed and fainted w excitement for that klay quarter

#wegonnabechampionship (Spottie), Tuesday, 5 May 2015 01:24 (ten years ago)

It's crazy how lbj is still a 25-7-7 guy even when he's not engaged

― #wegonnabechampionship (Spottie), Monday, May 4, 2015 9:19 PM (4 minutes ago) Bookmark Flag Post Permalink

ya tho his defensive decline is all time

lag∞n, Tuesday, 5 May 2015 01:25 (ten years ago)

who starts for the clipdogs tonight - jamal? ...or austin

slothroprhymes, Tuesday, 5 May 2015 01:26 (ten years ago)

got to be jamal

lag∞n, Tuesday, 5 May 2015 01:26 (ten years ago)

cn u imagine austin rivers starting a playoff game my lord

lag∞n, Tuesday, 5 May 2015 01:27 (ten years ago)

to be quite honest austin rivers starting would seem like a plausible doc irrational confidence/league-trolling move

slothroprhymes, Tuesday, 5 May 2015 01:28 (ten years ago)

if that happens ballmer shd fire him on the court

lag∞n, Tuesday, 5 May 2015 01:28 (ten years ago)

not probable! but plausible. I would not be shocked to my core.

slothroprhymes, Tuesday, 5 May 2015 01:28 (ten years ago)

sure he has practice doing shit like that xp

lag∞n, Tuesday, 5 May 2015 01:28 (ten years ago)

rivers is starting :)

polyphonic, Tuesday, 5 May 2015 01:36 (ten years ago)

fire doc

lag∞n, Tuesday, 5 May 2015 01:37 (ten years ago)

holy hell I can't believe I called it

slothroprhymes, Tuesday, 5 May 2015 01:37 (ten years ago)

ban doc

lag∞n, Tuesday, 5 May 2015 01:39 (ten years ago)

yea I lied I'm actually kind of shocked

wow doc thanks for 07-08 but you're a fucking moron

slothroprhymes, Tuesday, 5 May 2015 01:41 (ten years ago)

clippers till might win tho

lag∞n, Tuesday, 5 May 2015 01:42 (ten years ago)

like as much as I was decrying the clips last series I want them to field a good team & play good ball and that...is not how you do it

slothroprhymes, Tuesday, 5 May 2015 01:42 (ten years ago)

xp the series? oh yeah def, unless paul is out the whole time. as for the game, eh I dunno

slothroprhymes, Tuesday, 5 May 2015 01:43 (ten years ago)

they cn win the game, rockets not that sound

lag∞n, Tuesday, 5 May 2015 01:45 (ten years ago)

ha i cannot believe austin started that is the most crap thing

Clay, Tuesday, 5 May 2015 01:45 (ten years ago)

sorry doc u r the c word that is right u r crappy

Clay, Tuesday, 5 May 2015 01:46 (ten years ago)

ahahahahahahahahahahahah

slothroprhymes, Tuesday, 5 May 2015 01:49 (ten years ago)

sry doc u r cHUMAN GARBAGE

lag∞n, Tuesday, 5 May 2015 01:49 (ten years ago)

i think it's likely this series gets seriously chippy bc both of these teams are cheap and intentionally annoying and full of floppy hatable people

Clay, Tuesday, 5 May 2015 01:49 (ten years ago)

otm

slothroprhymes, Tuesday, 5 May 2015 01:49 (ten years ago)

austin straight falling down on the break for no reason

lag∞n, Tuesday, 5 May 2015 01:50 (ten years ago)

on the day dell curry's amazing son won the mvp award doc rivers started his own shit boy that he traded a pick for in a playoff game, may his name live forever in infamy.

Clay, Tuesday, 5 May 2015 01:51 (ten years ago)

dell curry has beautiful nice sons doc rivers son is an abomination

lag∞n, Tuesday, 5 May 2015 01:52 (ten years ago)

seth curry is prob better than austin why not

lag∞n, Tuesday, 5 May 2015 01:53 (ten years ago)

lol this game is a comical garbage fire so far

slothroprhymes, Tuesday, 5 May 2015 01:56 (ten years ago)

harden getting the and 1 and shouting COME ON MOTHERFUCKER

slothroprhymes, Tuesday, 5 May 2015 02:05 (ten years ago)

clips need to be riding blake

lag∞n, Tuesday, 5 May 2015 02:08 (ten years ago)

Ben Golliver ‏@BenGolliver 1m1 minute ago
The Kevin Love replacement trio of Miller, Marion and Jones combined for 3 points on 1-4 shooting, 7 rebounds, 0 assists in 30 minutes

lag∞n, Tuesday, 5 May 2015 02:09 (ten years ago)

as if on cue griffin passes up a wide open long two, backs out and bricks a three

micah, Tuesday, 5 May 2015 02:09 (ten years ago)

yeah that was weird prob just wasnt expecting that pass

lag∞n, Tuesday, 5 May 2015 02:09 (ten years ago)

Ben Golliver ‏@BenGolliver 1m1 minute ago
The Kevin Love replacement trio of Miller, Marion and Jones combined for 3 points on 1-4 shooting, 7 rebounds, 0 assists in 30 minutes

― lag∞n, Monday, May 4, 2015 10:09 PM (3 minutes ago) Bookmark Flag Post Permalink

Omg I'm dying to hear windhorst spin this

juice college (agent hibachi), Tuesday, 5 May 2015 02:14 (ten years ago)

Btw mike miller got the wite version of brons haircut probably to psych himself up for the series

juice college (agent hibachi), Tuesday, 5 May 2015 02:14 (ten years ago)

lmao hedo D on dwight

lag∞n, Tuesday, 5 May 2015 02:15 (ten years ago)

on the day dell curry's amazing son won the mvp award doc rivers started his own shit boy that he traded a pick for in a playoff game, may his name live forever in infamy.

― Clay, Monday, May 4, 2015 9:51 PM (23 minutes ago) Bookmark Flag Post Permalink

Rip doc u had a good run but u got high on your own supply

juice college (agent hibachi), Tuesday, 5 May 2015 02:15 (ten years ago)

josh smith being good is so weird

slothroprhymes, Tuesday, 5 May 2015 02:15 (ten years ago)

dwight being good is not weird that dunk was tremendous but fuck dwight

slothroprhymes, Tuesday, 5 May 2015 02:16 (ten years ago)

Hedo is really looking like the guy who stayed after the 40-plus rec league wrapped up and tried to hang with the college age ballers

juice college (agent hibachi), Tuesday, 5 May 2015 02:17 (ten years ago)

Basically he was a hero baller once but he shldnt be trying to play hero ball anymore

― juice college (agent hibachi)

missed this earlier but can we name this Kobe Bryant Syndrome

Clay, Tuesday, 5 May 2015 02:37 (ten years ago)

rose should prob be trying to develop old man game is the thing, some guys age gracefully and he m/l has the athleticism of the wrong side of 30 most nights

Clay, Tuesday, 5 May 2015 02:37 (ten years ago)

lol the clippers are so sad and lost w/o paul they look confused

lag∞n, Tuesday, 5 May 2015 02:40 (ten years ago)

it is like when the emperor dies in that starwar movie and all the storm troopers start running around like crazy and kinda give up

Clay, Tuesday, 5 May 2015 02:41 (ten years ago)

i have never seen star war but yes

lag∞n, Tuesday, 5 May 2015 02:42 (ten years ago)

i just like it when ppl run around like crazy

Clay, Tuesday, 5 May 2015 02:43 (ten years ago)

game of thrones would be much improved if whenever anyone died all the other characters freaked out and ran around like crazy for instance

Clay, Tuesday, 5 May 2015 02:44 (ten years ago)

its a good innovation

lag∞n, Tuesday, 5 May 2015 02:44 (ten years ago)

howard gotten away w 2 goal tends 2nite by my count

lag∞n, Tuesday, 5 May 2015 02:48 (ten years ago)

xxp that sorta is kings landing tbh but that is a debate for another thread

slothroprhymes, Tuesday, 5 May 2015 02:49 (ten years ago)

irrationally delighted at the court mics picking up doc yelling "austin!" and then vaguely pointing somewhere

Clay, Tuesday, 5 May 2015 02:50 (ten years ago)

lol

lag∞n, Tuesday, 5 May 2015 02:52 (ten years ago)

howard gotten away w 2 goal tends 2nite by my count

― lag∞n, Tuesday, May 5, 2015 12:48 PM

was about to post this

micah, Tuesday, 5 May 2015 02:56 (ten years ago)

lol rox stay blowing leads

slothroprhymes, Tuesday, 5 May 2015 03:34 (ten years ago)

rivers wastes an impressive amount of clock w pointless jab steps

lag∞n, Tuesday, 5 May 2015 03:47 (ten years ago)

I'm not gonna give a shit abt this series until they start fighting each other and being mean and stuff

Clay, Tuesday, 5 May 2015 03:51 (ten years ago)

howard beasting

lag∞n, Tuesday, 5 May 2015 03:52 (ten years ago)

now playing: Scarface, "I Seen A Man Die"

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 5 May 2015 03:54 (ten years ago)

hahaha

slothroprhymes, Tuesday, 5 May 2015 03:54 (ten years ago)

hate the second round

Clay, Tuesday, 5 May 2015 03:59 (ten years ago)

omg jordan just made a beautiful pass

lag∞n, Tuesday, 5 May 2015 03:59 (ten years ago)

remember when all blake could do was dunk?

k3vin k., Tuesday, 5 May 2015 04:00 (ten years ago)

yeah the deandre pass to the corner was svelte

Clay, Tuesday, 5 May 2015 04:00 (ten years ago)

lmao rockets end up w a josh smith 3 out of a timeout

lag∞n, Tuesday, 5 May 2015 04:02 (ten years ago)

lmao that redick floater was the most half-assed floater i've ever seen

k3vin k., Tuesday, 5 May 2015 04:02 (ten years ago)

k3vin k.
Posted: May 5, 2015 at 12:00:13 AM
remember when all blake could do was dunk?

all he can do is trip dub pfft

lag∞n, Tuesday, 5 May 2015 04:02 (ten years ago)

dwight bein a punk in game one sweet

Clay, Tuesday, 5 May 2015 04:03 (ten years ago)

of COURSE reddick throwing up a crazy circus shot to put the clips over 100 would start the chippiness, who didn't see that coming

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 5 May 2015 04:03 (ten years ago)

uh oh jj u wakened a sleeping dragon v_v

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 5 May 2015 04:04 (ten years ago)

dwight is so frustrated w/ jordan's rebounding, it is kinda thrilling to watch him be all pissy about it

Clay, Tuesday, 5 May 2015 04:04 (ten years ago)

like every deandre rebound is immediately followed by dwight making babyfaces at the nearest ref

Clay, Tuesday, 5 May 2015 04:05 (ten years ago)

howard is the real BIG BABY

lag∞n, Tuesday, 5 May 2015 04:09 (ten years ago)

*rimshot*

slothroprhymes, Tuesday, 5 May 2015 04:11 (ten years ago)

ha u fucked up puple

lag∞n, Tuesday, 5 May 2015 04:12 (ten years ago)

double hacka we r lucky

lag∞n, Tuesday, 5 May 2015 04:14 (ten years ago)

blake 3 trip dubs this playoffs

lag∞n, Tuesday, 5 May 2015 04:16 (ten years ago)

yeah crucial playoff ft shootoff i'm lovin' it

Clay, Tuesday, 5 May 2015 04:16 (ten years ago)

rockets ft shooting so bad it broke the computers

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 5 May 2015 04:17 (ten years ago)

rip the computers, they were nice machines

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 5 May 2015 04:18 (ten years ago)

how bout the clippers taking the energy outta this building, eh?

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 5 May 2015 04:18 (ten years ago)

crazy the hacka has been around for like 15 years but it finally broke the nba now

lag∞n, Tuesday, 5 May 2015 04:19 (ten years ago)

funny how slow things are to catch on when they seem so obvious. there was a 3 point line for the longest time before people started realizing you could get more points from behind there

k3vin k., Tuesday, 5 May 2015 04:20 (ten years ago)

lol tru

lag∞n, Tuesday, 5 May 2015 04:20 (ten years ago)

the rockets have been really bad tonight. they look kinda dumb?

Clay, Tuesday, 5 May 2015 04:20 (ten years ago)

theyre garbage

lag∞n, Tuesday, 5 May 2015 04:20 (ten years ago)

guess they've been hurt by injuries pretty bad but this is terrible

Clay, Tuesday, 5 May 2015 04:21 (ten years ago)

cp3 wearing a weird green tuxedo jacket over a henley lets get him back in uniform huh

lag∞n, Tuesday, 5 May 2015 04:22 (ten years ago)

the only people i can really feel good rooting for in this entire series are deandre and big baby

Clay, Tuesday, 5 May 2015 04:23 (ten years ago)

deandre?

k3vin k., Tuesday, 5 May 2015 04:26 (ten years ago)

i love deandre

Clay, Tuesday, 5 May 2015 04:28 (ten years ago)

his years of rawness and failings at the line have humanized and endeared him to me

Clay, Tuesday, 5 May 2015 04:28 (ten years ago)

I'm surprised to discover that I can 'like' Redick as a shooter, as long as I never have to see his face, or krayzewski's

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 5 May 2015 04:29 (ten years ago)

but yeah there is no way in hell I can feel good about the rockets team I saw tonight

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 5 May 2015 04:30 (ten years ago)

I really felt "the hand of a dead body" from these guys. they really took me there.

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 5 May 2015 04:32 (ten years ago)

🚀🔫

Clay, Tuesday, 5 May 2015 04:34 (ten years ago)

http://espn.go.com/nba/story/_/id/12787091/uni-watch-takeaways-nba-new-sock-deal-stance

Premise ridiculous. Who have two potato? (forksclovetofu), Tuesday, 5 May 2015 04:40 (ten years ago)

Harden was a no show tonight. Deandre gonna be a problem for him.

#wegonnabechampionship (Spottie), Tuesday, 5 May 2015 06:09 (ten years ago)

Josh smith stays shooting threes too.

#wegonnabechampionship (Spottie), Tuesday, 5 May 2015 06:10 (ten years ago)

harden had NINE turnovers

lag∞n, Tuesday, 5 May 2015 12:54 (ten years ago)

blake 26-13-14

lag∞n, Tuesday, 5 May 2015 13:07 (ten years ago)

Sick numbers dude is blowing up rn

juice college (agent hibachi), Tuesday, 5 May 2015 15:16 (ten years ago)

feel like its such a standard thing where ppl always want great players to mature a little faster than is typical and then they reach peak right as everyones questioning whether they ever will

lag∞n, Tuesday, 5 May 2015 15:17 (ten years ago)

simmons been riding that maybe blake is not that good actually wave for a couple years now

lag∞n, Tuesday, 5 May 2015 15:18 (ten years ago)

tbf lots of people have. Blake's made a lot of improvements

Nhex, Tuesday, 5 May 2015 15:27 (ten years ago)

i alway stood by him blake is bae

lag∞n, Tuesday, 5 May 2015 15:30 (ten years ago)

he shd dominate this series given that he's playing a level above smith & jones

head clowning instructor (art), Tuesday, 5 May 2015 15:36 (ten years ago)

smith hypothetically is the perfect defender for him but lol reality

lag∞n, Tuesday, 5 May 2015 15:38 (ten years ago)

simmons was doing maybe blake not that good a couple of years ago and then last year had him third on his mvp and said he made the leap and then this year couldn't figure out why he didn't make another leap and went back to maybe blake not that good. symptomatic of simmons increasing tendency toward sports talk espn narrative of the day overload that for me has made it more difficult to read/listen to him than any narcissism or egotism or weird lack of filter. blake's great.

i'm doing that thing where you hi-five the players as they exit the tunnel before the game tonight. praying to god i'm not the only adult down there doing it.

balls, Tuesday, 5 May 2015 15:50 (ten years ago)

blake proved himself last year when CP went down for a couple months and he put up crazy numbers and lead the team. there were articles about CP having the ball in his hands too much and maybe they should run the offense trough Blake more when CP came back

#wegonnabechampionship (Spottie), Tuesday, 5 May 2015 15:51 (ten years ago)

blake seems like he spent the regular season just practicing his jumper now hes playing for rlz

panettone for the painfully alone (mayor jingleberries), Tuesday, 5 May 2015 17:21 (ten years ago)

reasonable strat imo

lag∞n, Tuesday, 5 May 2015 17:22 (ten years ago)

agree

#wegonnabechampionship (Spottie), Tuesday, 5 May 2015 17:36 (ten years ago)

ESPN Stats & Info ‏@ESPNStatsInfo 1m1 minute ago
John Wall inactive tonight for Wizards. He's averaging 17.4 points and an NBA-best 12.6 assists this postseason

lag∞n, Tuesday, 5 May 2015 23:16 (ten years ago)

I feel like that isn't good for the wizards but good for my bet on this series

slothroprhymes, Tuesday, 5 May 2015 23:23 (ten years ago)

what happened to him?

#wegonnabechampionship (Spottie), Tuesday, 5 May 2015 23:25 (ten years ago)

left wrist issue of some sort, not a lot of specifics

slothroprhymes, Tuesday, 5 May 2015 23:37 (ten years ago)

saw a pic of his hand earlier and it was scary swollen

Clay, Tuesday, 5 May 2015 23:51 (ten years ago)

ya he fell hard on it

lag∞n, Wednesday, 6 May 2015 00:04 (ten years ago)

wittman wearing glasses to try and look smarter, as if that'll work

slothroprhymes, Wednesday, 6 May 2015 00:14 (ten years ago)

worked for Brooks for 7 years

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 00:15 (ten years ago)

Nene looks like he has no lift right now, probably dealing with an injury?

Matt Armstrong, Wednesday, 6 May 2015 00:18 (ten years ago)

always

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 00:19 (ten years ago)

worked for Brooks for 7 years

― #wegonnabechampionship (Spottie), Tuesday, May 5, 2015 8:15 PM (4 minutes ago) Bookmark Flag Post Permalink

lol it was smart!

lag∞n, Wednesday, 6 May 2015 00:20 (ten years ago)

feel like glasses don't work with the Wittman tough guy ethos

Matt Armstrong, Wednesday, 6 May 2015 00:22 (ten years ago)

Sessions not exactly bringing it here

Matt Armstrong, Wednesday, 6 May 2015 00:22 (ten years ago)

brooks at least was consistent with the glasses or like actually has bad eyesight in addition to being a bad strategist, I've never seen wittman on the sidelines with glasses until tonight

slothroprhymes, Wednesday, 6 May 2015 00:23 (ten years ago)

Ian Eagle incredulous that bench players who have been playing for the Wizards all year are in this playoff game

Matt Armstrong, Wednesday, 6 May 2015 00:24 (ten years ago)

he is trying to soften his whole doofus football player in a suit vibe, like he is the embodiment of what someone calls don draper as an insult, but I don't think its gonna work

slothroprhymes, Wednesday, 6 May 2015 00:24 (ten years ago)

xp I mean some of their bench players are bad one could understand his bewilderment

slothroprhymes, Wednesday, 6 May 2015 00:25 (ten years ago)

wow that was a truly remarkable shot by Gortat

Matt Armstrong, Wednesday, 6 May 2015 00:26 (ten years ago)

schröder is dope

slothroprhymes, Wednesday, 6 May 2015 00:33 (ten years ago)

according to his Twitter btw sir foster is gonna play pony by ginuwine at some point

slothroprhymes, Wednesday, 6 May 2015 00:34 (ten years ago)

DONT BOO PAUL PIERCE YOU IDIOTS HE'LL FUCKING KILL YOU ALL

slothroprhymes, Wednesday, 6 May 2015 00:58 (ten years ago)

like I'm rooting for ATL in this series and not just bc I gambled on them and I don't want the fans to doom their team in that fashion

slothroprhymes, Wednesday, 6 May 2015 01:01 (ten years ago)

man if the hawks cant even destroy the wiz sans wall idk

lag∞n, Wednesday, 6 May 2015 01:44 (ten years ago)

hawks played considerably better in this 2nd half but wiz will not go away

slothroprhymes, Wednesday, 6 May 2015 02:02 (ten years ago)

Conley back in game 2 of grizz-dubs btw

slothroprhymes, Wednesday, 6 May 2015 02:02 (ten years ago)

nice

lag∞n, Wednesday, 6 May 2015 02:27 (ten years ago)

cawcaw!!

balls I know you were there for this shit glad you got to see a win man

slothroprhymes, Wednesday, 6 May 2015 02:27 (ten years ago)

has the bear woken up or is this 1st quarter deceptive

slothroprhymes, Wednesday, 6 May 2015 03:01 (ten years ago)

warriors do not look good

k3vin k., Wednesday, 6 May 2015 03:09 (ten years ago)

Speights flop so obvious lol

, Wednesday, 6 May 2015 03:18 (ten years ago)

Worst half I've seen them play in a long time. Still in the game tho.

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 03:50 (ten years ago)

Down by double digits in the third, what are the odds that they come back again?

Madison Dumbbarfer (Leee), Wednesday, 6 May 2015 04:31 (ten years ago)

randolph is so cool

polyphonic, Wednesday, 6 May 2015 04:49 (ten years ago)

RIP Dubs

A True White Kid that can Jump (Granny Dainger), Wednesday, 6 May 2015 04:51 (ten years ago)

grats griz curious to see how the dubs come out game 3

lag∞n, Wednesday, 6 May 2015 05:07 (ten years ago)

WHATS IN CONLEYS M CUP

lag∞n, Wednesday, 6 May 2015 05:10 (ten years ago)

lol here come the dubs

Clay, Wednesday, 6 May 2015 05:12 (ten years ago)

no quite enough time

lag∞n, Wednesday, 6 May 2015 05:12 (ten years ago)

still i live forever in hope

Clay, Wednesday, 6 May 2015 05:14 (ten years ago)

Steph's airball == good night everyone.

Madison Dumbbarfer (Leee), Wednesday, 6 May 2015 05:15 (ten years ago)

curry unable to ride the mvp wave, ball no lie

lag∞n, Wednesday, 6 May 2015 05:16 (ten years ago)

conley's eye is not good tv

Clay, Wednesday, 6 May 2015 05:20 (ten years ago)

ESPN Stats & Info ‏@ESPNStatsInfo 3m3 minutes ago
Warriors lose at home for 1st time since January 27 vs Bulls

cray

lag∞n, Wednesday, 6 May 2015 05:23 (ten years ago)

they were gonna lose one eventually, would have done so to the pelicans if not for...well, the pelicans

slothroprhymes, Wednesday, 6 May 2015 05:28 (ten years ago)

would be kinda surprised if they don't blaze through the next 3 though.

slothroprhymes, Wednesday, 6 May 2015 05:28 (ten years ago)

hope the griz put a fright in em

lag∞n, Wednesday, 6 May 2015 05:31 (ten years ago)

the bear has woken up and it won't be easy. dubs will be winning by very close margins

slothroprhymes, Wednesday, 6 May 2015 05:32 (ten years ago)

or we could have another 7 game thrilla on our hands and I wouldn't really mind that

slothroprhymes, Wednesday, 6 May 2015 05:33 (ten years ago)

inside the nba crew really working this pretty dumb girl metaphor for all its worth cant wait for shaqs take

lag∞n, Wednesday, 6 May 2015 05:33 (ten years ago)

what if it was a meme that the mvp award was a curse, wld be p cool

lag∞n, Wednesday, 6 May 2015 05:36 (ten years ago)

what if you won the mvp you had to wear a lone, gold hoop earring

Clay, Wednesday, 6 May 2015 05:45 (ten years ago)

p sure u do?

lag∞n, Wednesday, 6 May 2015 05:46 (ten years ago)

yes and a Hanes T

Sufjan Grafton, Wednesday, 6 May 2015 05:54 (ten years ago)

Rocking a Hitler stache.

Madison Dumbbarfer (Leee), Wednesday, 6 May 2015 05:59 (ten years ago)

game was awesome, crowd was great. grant hill was there, he's one of the new owners along w/ jami gertz's husband and the founder of spanx, one of the ladies sitting in our row got a selfie w/ him and kept telling him 'you are just a gorgeous man', it was pretty funny, dude is handsome though.

http://i.imgur.com/KXrg84Th.jpg

i hi-fived the hawks in the tunnel before the game and i tried to hi-five paul pierce after the game but he wasn't having it. we trolled kris humphries most of the game, shouting 'randy! put humphries in!' and chanting 'we want humphries', the only time he reacted was one time he was looking at something and guy in the row in front of me shouted 'dude are you looking at yr phone right now? are you updating yr instagram?' and that drew an dirty look pretty quickly. hawks still have issues, millsap was obv in pain during some parts of the game and his shoulder was glistening from tip off like w/ some sort of balm maybe. still, a win.

balls, Wednesday, 6 May 2015 06:15 (ten years ago)

Nice!

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 06:21 (ten years ago)

Not sure the dubs Could play worse. Conley obv the new juice man. Tony Allen is incredible, grizz ball denial was top notch. they should never play Jeff green.

Z bo for real a wizard. Crazy how many soft rolls he gets and how many rebounds he pulls among traffic.

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 06:25 (ten years ago)

Man I want the Dubs to
Win it all just to shut chuck up at this point.

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 06:34 (ten years ago)

Wtf why aren't they playing again until Saturday.

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 06:36 (ten years ago)

https://vine.co/v/eZd5dXzA6FW

ATTN: j0rdan

, Wednesday, 6 May 2015 11:46 (ten years ago)

that is a direct and aggressive way of campaigning for sure

slothroprhymes, Wednesday, 6 May 2015 12:31 (ten years ago)

Just watched. Seeing Steph catching his breath was a new experience. I doubt we'll see that again. (However, a fair criticism of Alvin Gentry is exhausting of offensive players.) Klay has come back to Earth too. Nonetheless, this team is unbeatable.

Allen (etaeoe), Wednesday, 6 May 2015 13:16 (ten years ago)

Watching Wizards and Hawks this afternoon. Pray for me.

Allen (etaeoe), Wednesday, 6 May 2015 13:16 (ten years ago)

i missed the second half of the game but the first half really had the feel of memphis playing as good as possible and the dubs playing as bad as possible but only being down 6 points aka dubs eventually win by like 11 points but no!

i still think they take it in 5

J0rdan S., Wednesday, 6 May 2015 14:19 (ten years ago)

https://vine.co/v/eZd5dXzA6FW

ATTN: j0rdan

― 龜, Wednesday, May 6, 2015 7:46 AM (2 hours ago) Bookmark Flag Post Permalink

lmao luv this guy

lag∞n, Wednesday, 6 May 2015 14:26 (ten years ago)

he picked a steph pass and got a wide open dunk and was yelling that again. he is the best.

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 14:57 (ten years ago)

https://www.youtube.com/watch?v=89_Zy6Q5k0U

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 15:00 (ten years ago)

that vine is beautiful. i really do like the grizz, the style of play plus the characters they have they're a throwback team almost. didn't see the game so maybe the grizz 'figured out' the dubs but i doubt it. if they're back to being the team i thought they were most of the season that could be an awesome series but i still think warriors will win.

balls, Wednesday, 6 May 2015 15:16 (ten years ago)

griz are def a good team to defend the dubs, great at clogging the middle and getting back on D and they have good perimeter defenders so i doubt well see the dubs run too wild on offense for extended stretches in this series, problem for the griz is the warriors D is also excellent

lag∞n, Wednesday, 6 May 2015 15:33 (ten years ago)

yeah they don't have to shoot superb to beat the grizz but def better than last night. also conley and z bo hit some tough shots

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 15:37 (ten years ago)

I like the grizz a lot actually but they were pretty tough to watch during their slump this year (after the Jeff green honeymoon wore off and tony allen was injured, zbo kinda slumped a little too). Z Bo and Gasol are a ton of fun to watch when it's all clicking, and Tony Allen obv.

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 15:38 (ten years ago)

dubs were just on cruise control after how easy the first game was and grizz i think sensed that, put GSW in a hole early. if the grizz stay at that level or even exceed it and the dubs go all out, most grizz can win is maybe another game, while theyre at home?

slothroprhymes, Wednesday, 6 May 2015 15:41 (ten years ago)

I'm back to feeling "cautiously optimistic" about the Grizz, i.e. I think they can take the series to 6 games

LAC/HOU even harder to predict -- I'm fairly certain the Clips will prevail, but whether they'll do it in 4 or 7, I couldn't begin to say

Heroic melancholy continues to have a forceful grip on (bernard snowy), Wednesday, 6 May 2015 15:54 (ten years ago)

griz expected wins for the rest of the series according to my advanced algo is .5

lag∞n, Wednesday, 6 May 2015 15:57 (ten years ago)

wld be interesting if they forced the dubs to go big, theyre not nearly their normal offensive selves in that configuration, zach not actually that much bigger than dre but he is a brute

lag∞n, Wednesday, 6 May 2015 15:59 (ten years ago)

doc rivers "pretty much doubts" that we'll see cp3 in clips-rox game 2

slothroprhymes, Wednesday, 6 May 2015 17:04 (ten years ago)

breaking

Kurt Helin ‏@basketballtalk 13s14 seconds ago
LeBron James wearing headband against Bulls in Game 2

lag∞n, Wednesday, 6 May 2015 23:01 (ten years ago)

mot exciting thing about the cavs so far this postseason

#wegonnabechampionship (Spottie), Wednesday, 6 May 2015 23:06 (ten years ago)

wellllll that's one way to make an auspicious start cavs

slothroprhymes, Wednesday, 6 May 2015 23:23 (ten years ago)

headband really does make a difference

slothroprhymes, Wednesday, 6 May 2015 23:24 (ten years ago)

I opted against doing something outdoors for this trash??

A True White Kid that can Jump (Granny Dainger), Wednesday, 6 May 2015 23:29 (ten years ago)

I mean cavs leads, even big ones, are not necessarily sustainable...but I'd say go outside for a while at least lol

slothroprhymes, Wednesday, 6 May 2015 23:33 (ten years ago)

A Mario Hezonja-esque dunk from LeBron there

Matt Armstrong, Wednesday, 6 May 2015 23:57 (ten years ago)

lol bro you never do let up with that euroballer adoration

slothroprhymes, Thursday, 7 May 2015 00:01 (ten years ago)

if the bulls got offensive boards properly on certain misses theyd barely be down jeez

slothroprhymes, Thursday, 7 May 2015 00:02 (ten years ago)

bulls have so many defensive issues

Matt Armstrong, Thursday, 7 May 2015 00:05 (ten years ago)

I feel like Tristan Thompson is Kwame Brown with better hands... which isn't so bad

Matt Armstrong, Thursday, 7 May 2015 00:50 (ten years ago)

not a good foul, says Marv Albert before checking the stats and seeing that it's a great use of the foul to give

Matt Armstrong, Thursday, 7 May 2015 00:53 (ten years ago)

having a lot of trouble with the James Jones name conundrum too

Matt Armstrong, Thursday, 7 May 2015 00:53 (ten years ago)

i haven't seen any of this game but this series looks like it's gonna follow the script of basically any important playoff series when bron was on the heat

J0rdan S., Thursday, 7 May 2015 01:18 (ten years ago)

seems like there were a lot of scripts in those

Matt Armstrong, Thursday, 7 May 2015 01:18 (ten years ago)

i wouldnt be so sure in this one tho despite how bad this game went

slothroprhymes, Thursday, 7 May 2015 01:20 (ten years ago)

(xp)

also matt how can you slander marv albert he's an old man let it go

slothroprhymes, Thursday, 7 May 2015 01:22 (ten years ago)

*realizing i just asked this of a juicing truther*

slothroprhymes, Thursday, 7 May 2015 01:22 (ten years ago)

jesus christ the james jones game that brian windbaghorst predicted actually fucking happened lollllll

now all thats left is a game with 6 mike miller threes and a double double from shawn marion

slothroprhymes, Thursday, 7 May 2015 01:27 (ten years ago)

I'm not much of a juicing truther, come on now. I mean Blake Griffin isn't FloJo but he ain't Babe Ruth either.

Matt Armstrong, Thursday, 7 May 2015 01:31 (ten years ago)

they do some intense training man

micah, Thursday, 7 May 2015 01:51 (ten years ago)

cp3 wearing a broach

lag∞n, Thursday, 7 May 2015 02:11 (ten years ago)

rox looking more like their usual selves

including the successful flopping, lol brewer

slothroprhymes, Thursday, 7 May 2015 02:12 (ten years ago)

kinda cool brooch tbh

slothroprhymes, Thursday, 7 May 2015 02:12 (ten years ago)

corey brewer is good at flopping cause he really does look like hed go flying if u pushed him

lag∞n, Thursday, 7 May 2015 02:13 (ten years ago)

Haha brewer just flopped like he'd been hit like a truck when Lester Hudson pushed him

Clippers losing their cool here

juice college (agent hibachi), Thursday, 7 May 2015 02:13 (ten years ago)

seems like there were a lot of scripts in those

i mean "uninspiring game 1 loss leads to immediate panic followed by easy series victory"

J0rdan S., Thursday, 7 May 2015 02:14 (ten years ago)

clippers are gonna get blown out aren't they

J0rdan S., Thursday, 7 May 2015 02:14 (ten years ago)

and/or Barnes is getting tossed

J0rdan S., Thursday, 7 May 2015 02:14 (ten years ago)

He's so waggly and spastic, he's like a muppet version of a basketball player

Xp re brewer

juice college (agent hibachi), Thursday, 7 May 2015 02:14 (ten years ago)

i greatly enjoy brewer's play when he's not flopsonning, wish he wasn't a rocket

slothroprhymes, Thursday, 7 May 2015 02:16 (ten years ago)

harden looking slightly shook by the playoff experience making uncharacteristic decisions

lag∞n, Thursday, 7 May 2015 02:17 (ten years ago)

I feel like Tristan Thompson is Kwame Brown with better hands... which isn't so bad

― Matt Armstrong, Wednesday, May 6, 2015 8:50 PM (1 hour ago) Bookmark Flag Post Permalink

Like this

Kwame would have been totally decent if he hadn't had solid marble blocks for hands and also not been a big baby

juice college (agent hibachi), Thursday, 7 May 2015 02:18 (ten years ago)

also not psychologically devastated by michael jordan

lag∞n, Thursday, 7 May 2015 02:18 (ten years ago)

smh joey crawford beefing w fans

lag∞n, Thursday, 7 May 2015 02:21 (ten years ago)

Who's this Hudson guy

, Thursday, 7 May 2015 02:21 (ten years ago)

He's like an Anthony Johnson type

, Thursday, 7 May 2015 02:21 (ten years ago)

jordan dunks good i enjoy it

lag∞n, Thursday, 7 May 2015 02:24 (ten years ago)

Hedo looks like he's wearing overalls

, Thursday, 7 May 2015 02:27 (ten years ago)

man howard has blake on him and he takes a weird spinning fading hook

lag∞n, Thursday, 7 May 2015 02:30 (ten years ago)

man warriors/clippers would be a great series

J0rdan S., Thursday, 7 May 2015 02:30 (ten years ago)

clippers are like 300% more likable with chris paul sitting

J0rdan S., Thursday, 7 May 2015 02:30 (ten years ago)

:[

lag∞n, Thursday, 7 May 2015 02:31 (ten years ago)

jordan

k3vin k., Thursday, 7 May 2015 02:32 (ten years ago)

blake is so fucking good though. i have always believed in blake i'm so proud

k3vin k., Thursday, 7 May 2015 02:32 (ten years ago)

blake is twice as good as any other player on the floor rn

J0rdan S., Thursday, 7 May 2015 02:33 (ten years ago)

the defense in this game has stopped

lag∞n, Thursday, 7 May 2015 02:35 (ten years ago)

yeah it's feeling extremely all star gameish

J0rdan S., Thursday, 7 May 2015 02:35 (ten years ago)

why is it a controversial statement for jordan to say chris paul's shit is unlikable at this point, yes he's also a genius etc etc but if likability is your metric he is...pretty bottom-barrel

slothroprhymes, Thursday, 7 May 2015 02:35 (ten years ago)

lester hudson has been the chinese mvp twice

micah, Thursday, 7 May 2015 02:36 (ten years ago)

John Schuhmann ‏@johnschuhmann 49s49 seconds ago
Clippers are 11-for-14 in the 2nd quarter. 28 points on 17 possessions.

lag∞n, Thursday, 7 May 2015 02:36 (ten years ago)

lol at mic'd-up doc talking to hudson: "why you tired? you aint played in a month!"

slothroprhymes, Thursday, 7 May 2015 02:38 (ten years ago)

lol

lag∞n, Thursday, 7 May 2015 02:38 (ten years ago)

i do admire the shameless honesty of how poorly he regards his bench and how blatantly he makes it that way regardless

slothroprhymes, Thursday, 7 May 2015 02:38 (ten years ago)

why is it a controversial statement for jordan to say chris paul's shit is unlikable at this point, yes he's also a genius etc etc but if likability is your metric he is...pretty bottom-barrel

― slothroprhymes, Wednesday, May 6, 2015 10:35 PM (2 minutes ago)

jordan was trolling. chris paul runs a beautiful offense that was ranked #1 in the league, that's fucking why

k3vin k., Thursday, 7 May 2015 02:38 (ten years ago)

why are there no games tomorrow?

k3vin k., Thursday, 7 May 2015 02:39 (ten years ago)

jordan just got a very good rebound

lag∞n, Thursday, 7 May 2015 02:40 (ten years ago)

man harden has had a couple of 3s that were so far in...

k3vin k., Thursday, 7 May 2015 02:40 (ten years ago)

blake can do anything he fucking wants out there

k3vin k., Thursday, 7 May 2015 02:41 (ten years ago)

He can even get picked by harden

, Thursday, 7 May 2015 02:42 (ten years ago)

xps kevin well ok. in any case i said he was a genius and meant it in terms of his game on both sides of the floor! but he will also sock you in the nuts, pretend to be fouled and act insufferably about it in a way only surpassed by harden, again, likability maybe shouldnt be a metric in sports but it is and always will be, its fair to at least mention it even if you recognize it should never be the be-all end-all.

there are no games tomorrow as part of an elaborate bill simmdog conspiracy to get us to actually sit and watch the grantland basketball hour

slothroprhymes, Thursday, 7 May 2015 02:44 (ten years ago)

opinions huh

micah, Thursday, 7 May 2015 02:45 (ten years ago)

im not trolling, i don't like rooting for chris paul

J0rdan S., Thursday, 7 May 2015 02:46 (ten years ago)

cp3 is more of a fav for die hard basketball fans

lag∞n, Thursday, 7 May 2015 02:47 (ten years ago)

blake putting up his 2012 game 6 east finals lebron game

J0rdan S., Thursday, 7 May 2015 02:47 (ten years ago)

haha the rockets r pure garbage

lag∞n, Thursday, 7 May 2015 02:48 (ten years ago)

had a chance to stomp the clips at home while paul is out and descided to not play D

lag∞n, Thursday, 7 May 2015 02:49 (ten years ago)

cp3 is more of a fav for die hard basketball fans

― lag∞n, Wednesday, May 6, 2015 10:47 PM (3 minutes ago) Bookmark Flag Post Permalink

lol whaaaaat is chris paul the underrated shoegaze album of point guards now, only appreciated by those who really understand it mannnnnnnn

slothroprhymes, Thursday, 7 May 2015 02:52 (ten years ago)

its true

lag∞n, Thursday, 7 May 2015 02:53 (ten years ago)

lmao shaq down!

lag∞n, Thursday, 7 May 2015 02:55 (ten years ago)

he was ranked #2 on the espn top 40 nba players entering the season! thats as mainstream as appeal gets in basketball

and he's obviously great, he's also a complete dickwad on the court and both those things can be simultaneously true and it's ok to be perturbed by the latter and not have that stance make you say "he must suck"

slothroprhymes, Thursday, 7 May 2015 02:56 (ten years ago)

Trve heads get it

#wegonnabechampionship (Spottie), Thursday, 7 May 2015 02:56 (ten years ago)

basketball diehards aka sociopaths so sure

J0rdan S., Thursday, 7 May 2015 02:56 (ten years ago)

the latter being the dickwad part

that has to have been the only genuinely funny inside the nba moment in quite some time

slothroprhymes, Thursday, 7 May 2015 02:56 (ten years ago)

what the hell happened to shaq

J0rdan S., Thursday, 7 May 2015 02:57 (ten years ago)

Did ilh strike!?

#wegonnabechampionship (Spottie), Thursday, 7 May 2015 02:57 (ten years ago)

he fell

lag∞n, Thursday, 7 May 2015 02:57 (ten years ago)

man first stage of ilh hack a shaq plan on tnt just now

balls, Thursday, 7 May 2015 02:58 (ten years ago)

his leg got tangled up in some technology under the desk then when he got up to race kenny he fell over

lag∞n, Thursday, 7 May 2015 02:58 (ten years ago)

he went down extremely hard it was good

lag∞n, Thursday, 7 May 2015 02:58 (ten years ago)

i saw it, was it an accident

J0rdan S., Thursday, 7 May 2015 02:59 (ten years ago)

The oh so funny race w Kenny to the big screen

#wegonnabechampionship (Spottie), Thursday, 7 May 2015 02:59 (ten years ago)

it kinda looked like some sort of shaq/rat trap, plus his shoe fell off

slothroprhymes, Thursday, 7 May 2015 03:00 (ten years ago)

but also had a power cord attached to it, maybe it was some electroshock mechanism

or, less interestingly, prob just a power strip

slothroprhymes, Thursday, 7 May 2015 03:01 (ten years ago)

feel like it cldve been a telestrator

lag∞n, Thursday, 7 May 2015 03:02 (ten years ago)

ilh ied

balls, Thursday, 7 May 2015 03:03 (ten years ago)

it awful that i find myself enjoying (briefly) the terrible cheese-rock song that soundtracks the segues from commercial back into gameplay in these playoffs

slothroprhymes, Thursday, 7 May 2015 03:06 (ten years ago)

*it's. i'm especially worried cuz i think it might be imagine dragons

slothroprhymes, Thursday, 7 May 2015 03:08 (ten years ago)

someone had a very weird idea

Kurt Helin ‏@basketballtalk 19s19 seconds ago
Cavaliers planned to give away 20,000 arm slings for Kevin Love, cancel http://dlvr.it/9j89Ts

lag∞n, Thursday, 7 May 2015 03:11 (ten years ago)

clips just gonna rest cp3 all four games of this series

lag∞n, Thursday, 7 May 2015 03:12 (ten years ago)

viable strat, gives them an edge for the conf finals

head clowning instructor (art), Thursday, 7 May 2015 03:14 (ten years ago)

pre season game vibes 2nite

lag∞n, Thursday, 7 May 2015 03:15 (ten years ago)

austin rivers getting there with three rockets in the paint

head clowning instructor (art), Thursday, 7 May 2015 03:16 (ten years ago)

rivers the only clipper who doeant know how to throw the ball to jordan at the rim

lag∞n, Thursday, 7 May 2015 03:19 (ten years ago)

shaq fall footage https://twitter.com/SHAQ/status/596152134057394176

lag∞n, Thursday, 7 May 2015 03:20 (ten years ago)

refs have missed some absolutely insane dwight goal tends this series

lag∞n, Thursday, 7 May 2015 03:27 (ten years ago)

looks like ref #28 has stopped calling dwight's fouls too

micah, Thursday, 7 May 2015 03:29 (ten years ago)

that was a beautiful rebound ty dj

head clowning instructor (art), Thursday, 7 May 2015 03:29 (ten years ago)

rockets D really keying on blake, clips not adjusting well

lag∞n, Thursday, 7 May 2015 03:41 (ten years ago)

hedo is so bad

k3vin k., Thursday, 7 May 2015 03:43 (ten years ago)

its kinda amazing to watch him operate he looks retired

lag∞n, Thursday, 7 May 2015 03:44 (ten years ago)

i posit that the sleeves he's always wearing are part of a full torso spanx-esque contraption meant to sausage up what must be a quickly deteriorating body

head clowning instructor (art), Thursday, 7 May 2015 03:49 (ten years ago)

hedo looks like a 45 year old who's trying to get back into shape for the first time after he saw his wife checking out a neighbor

Clay, Thursday, 7 May 2015 03:50 (ten years ago)

@ESPNNBA: Well that's interesting... Rockets have attempted 46 free throws through 3Q. That's most by any team for full playoff game since 2013.

lag∞n, Thursday, 7 May 2015 03:57 (ten years ago)

clips just gonna take threes the rest of the way hope they go in

lag∞n, Thursday, 7 May 2015 04:11 (ten years ago)

shaq fall btw

https://vine.co/v/eZxHuTiBtHY

Clay, Thursday, 7 May 2015 04:13 (ten years ago)

this game is boring i just decided

head clowning instructor (art), Thursday, 7 May 2015 04:16 (ten years ago)

exhaustion finally catching up w the clips

lag∞n, Thursday, 7 May 2015 04:17 (ten years ago)

feel like everyone would say the clips taking one of the first two without cp would be a victory but it's hard not to feel like they really blew this one

J0rdan S., Thursday, 7 May 2015 04:18 (ten years ago)

seems like they just bonked after that crazy first round/short bench

lag∞n, Thursday, 7 May 2015 04:18 (ten years ago)

few days off now

lag∞n, Thursday, 7 May 2015 04:20 (ten years ago)

yeah they really hit a wall. if the rockets can keep them from getting easy transition baskets i don't think the clips can outscore them in the halfcour.

J0rdan S., Thursday, 7 May 2015 04:22 (ten years ago)

without cp

J0rdan S., Thursday, 7 May 2015 04:22 (ten years ago)

the number of free throws in this game is outrageous

J0rdan S., Thursday, 7 May 2015 04:24 (ten years ago)

lol rockets u know u r extending the game when u intentionally foul

lag∞n, Thursday, 7 May 2015 04:25 (ten years ago)

we see you beardman

slothroprhymes, Thursday, 7 May 2015 04:30 (ten years ago)

austin playing over jordan in playoff crunchtime

lag∞n, Thursday, 7 May 2015 04:34 (ten years ago)

AHAHAHAHAHAHAHAHAHAHAHA

slothroprhymes, Thursday, 7 May 2015 04:34 (ten years ago)

austinnnnnnnnnn

J0rdan S., Thursday, 7 May 2015 04:34 (ten years ago)

lolol

polyphonic, Thursday, 7 May 2015 04:34 (ten years ago)

o my god what a nightcap that was

slothroprhymes, Thursday, 7 May 2015 04:34 (ten years ago)

the most austin rivers thing imaginable!

Clay, Thursday, 7 May 2015 04:34 (ten years ago)

looooooool

lag∞n, Thursday, 7 May 2015 04:35 (ten years ago)

that was incredible

lag∞n, Thursday, 7 May 2015 04:35 (ten years ago)

great buildup to that by Harlan

A True White Kid that can Jump (Granny Dainger), Thursday, 7 May 2015 04:35 (ten years ago)

"my beautiful baby boy i am sorry but i must destroy you" -- doc

Clay, Thursday, 7 May 2015 04:36 (ten years ago)

he is such a pros vs joes contestant

A True White Kid that can Jump (Granny Dainger), Thursday, 7 May 2015 04:36 (ten years ago)

austin https://vine.co/v/eZQmjYFwAhO

lag∞n, Thursday, 7 May 2015 04:38 (ten years ago)

sideline reporter: 64 free throws in this game, what accounts for that?
harden: <snickers> two foulin' teams

Clay, Thursday, 7 May 2015 04:43 (ten years ago)

he was struggling to hold himself back from saying "foul shots are good actually"

lag∞n, Thursday, 7 May 2015 04:47 (ten years ago)

2nd time hes broken his own ankles this series btw

http://i.kinja-img.com/gawker-media/image/upload/s--58d96jR7--/c_fit,fl_progressive,q_80,w_636/pqzwx961cve6kaxfoeoj.gif

lag∞n, Thursday, 7 May 2015 04:48 (ten years ago)

Austin joining the clippers prob the best development of 2015

Clay, Thursday, 7 May 2015 04:52 (ten years ago)

my advice to austin dont go behind yr back on the break

lag∞n, Thursday, 7 May 2015 04:57 (ten years ago)

also exit the nba pronto

lag∞n, Thursday, 7 May 2015 04:57 (ten years ago)

when does he hit free agency? that's gonna be some good drama. just a bunch of teams completely ignoring him and then doc gives him a 4 yr deal.

Heez, Thursday, 7 May 2015 05:01 (ten years ago)

did austin leave school early for the nba?

Clay, Thursday, 7 May 2015 05:12 (ten years ago)

wait i just remembered he was a lottery pick hah

Clay, Thursday, 7 May 2015 05:12 (ten years ago)

yeah he played one year

J0rdan S., Thursday, 7 May 2015 05:13 (ten years ago)

another year in college prob wouldn't have helped him, any star recruit should leave after one year

J0rdan S., Thursday, 7 May 2015 05:13 (ten years ago)

i was mostly worried abt whether or not he had a degree

Clay, Thursday, 7 May 2015 05:15 (ten years ago)

HERE COMES.... AUSTIN RIVERS

#wegonnabechampionship (Spottie), Thursday, 7 May 2015 05:32 (ten years ago)

Kurt Helin ‏@basketballtalk 36s36 seconds ago
Report: Matt Barnes talked trash to James Harden’s mom during Game 2

:)

lag∞n, Thursday, 7 May 2015 15:02 (ten years ago)

Haha

#wegonnabechampionship (Spottie), Thursday, 7 May 2015 15:27 (ten years ago)

dang thats kinda over the line, what did his mom have to do with his 15 free throw attempts (and makes)

slothroprhymes, Thursday, 7 May 2015 15:33 (ten years ago)

uh she literally created him hello

lag∞n, Thursday, 7 May 2015 15:45 (ten years ago)

i was mostly worried abt whether or not he had a degree

He'll be ok as long as his dad is coaching in the NBA.

Madison Dumbbarfer (Leee), Thursday, 7 May 2015 17:27 (ten years ago)

@WashWizards
Injury Update: John Wall underwent multiple exams that revealed 5 non-displaced fractures in left wrist & hand

rip

lag∞n, Thursday, 7 May 2015 18:39 (ten years ago)

displaced means bad? worse than hairline fracture, right?

#wegonnabechampionship (Spottie), Thursday, 7 May 2015 18:39 (ten years ago)

idk sounds right

lag∞n, Thursday, 7 May 2015 18:45 (ten years ago)

p dire how that already comically weak east is getting weakened further by injuries

lag∞n, Thursday, 7 May 2015 18:46 (ten years ago)

far as i can tell from some quick googlin' it means that the bone is not entirely broken, and may heal more quickly but i doubt quick enough for him to play in this series.

slothroprhymes, Thursday, 7 May 2015 18:51 (ten years ago)

KJ_NBA ‏@KJ_NBA 2m2 minutes ago
I really hope this season doesn't culminate with two Finals teams playing with backup point guards. And fouling each other intentionally.

lag∞n, Thursday, 7 May 2015 18:52 (ten years ago)

shump might be out game 3

slothroprhymes, Thursday, 7 May 2015 18:58 (ten years ago)

already a pall of depression over this 2nd round with all these injuries

slothroprhymes, Thursday, 7 May 2015 18:59 (ten years ago)

jfc

lag∞n, Thursday, 7 May 2015 18:59 (ten years ago)

NBA_Pete ‏@NBA_Pete 4m7 minutes ago
Breaking: Steph Curry has consumption. Lebron admits to being "juiceman." Both out.

Sufjan Grafton, Thursday, 7 May 2015 19:11 (ten years ago)

cp3 arrested for assault blake out with unnamed kegstand injuries

lag∞n, Thursday, 7 May 2015 19:13 (ten years ago)

lol cp3 already out tho

lag∞n, Thursday, 7 May 2015 19:13 (ten years ago)

displaced fracture sounds unpleasant as hell and like he's done for the playoffs

There are a few different types of displaced fractures. With a rotated fracture, the bone will break and one piece will turn around, but otherwise remain in the correct place. In the case of an angulated fracture, the bone will remain in essentially the right position, but one broken piece will tip either up or down. With an axially-displaced fracture a broken piece of bone will shift straight away from the rest of the bone. Once the fracture has been diagnosed, the bone must be reset. In some cases, it may be necessary to use pins and wires to hold the bone in the proper position. Depending on the severity of the break, this may be done surgically. A fracture may also require surgery in order to give doctors access to set the bone. Once the bone is properly set, the body can begin to fuse it back together again. There is a higher risk of other injuries with a displaced fracture. The broken portion of the bone can cause additional damage to the rest of the broken bone or other bones nearby. It can also cause damaged tissue, nerves, and blood vessels. All of these factors are considered when determining the severity of a fracture. A displaced fracture may also lead to an open fracture, which is when the sharp part of the broken bone pierces the skin. The bone can either remain sticking outside of the skin, or break through and then slip back inside the body. This is opposed to a closed fracture, where the skin remains intact. In the case of an open fracture there is a higher chance of deep bone infection. For this reason, surgery is often required in order to ensure that the bone heals correctly.

“audience participation” otherwise known as “touching” (forksclovetofu), Thursday, 7 May 2015 19:24 (ten years ago)

it said non-displaced tho

lag∞n, Thursday, 7 May 2015 19:28 (ten years ago)

it's placed

A True White Kid that can Jump (Granny Dainger), Thursday, 7 May 2015 19:39 (ten years ago)

Kurt Helin ‏@basketballtalk 36s36 seconds ago
Report: Matt Barnes talked trash to James Harden’s mom during Game 2

:)

― lag∞n, Thursday, May 7, 2015 11:02 AM (4 hours ago) Bookmark Flag Post Permalink

I love when dudes get the moms involved, kg and Pierce taunting bron in front of his mom and him getting snappy with her was one of my favorite bron moments

juice college (agent hibachi), Thursday, 7 May 2015 19:39 (ten years ago)

yeah that owned

lag∞n, Thursday, 7 May 2015 19:40 (ten years ago)

only 5 grand

NBA on ESPN ‏@ESPNNBA 8m8 minutes ago
Rockets guard Corey Brewer was fined for violating the NBA's anti-flopping rules in last night's Game 2

slothroprhymes, Thursday, 7 May 2015 19:56 (ten years ago)

there has never been a NBA story quite like Austin Rivers. Maybe no story in pro sports

Matt Armstrong, Thursday, 7 May 2015 20:56 (ten years ago)

it's like if Nikoloz Tskitishvili's dad ran a NBA team

Matt Armstrong, Thursday, 7 May 2015 20:56 (ten years ago)

yeah no one knows quite what to do with it

lag∞n, Thursday, 7 May 2015 20:57 (ten years ago)

Avery Johnson's son is upset about how y'all are treating Austin

https://twitter.com/itsaveryjohnson

polyphonic, Thursday, 7 May 2015 20:58 (ten years ago)

I'm not sure when the last HS superstar burned out quite like this without an injury either. I guess Josh Selby? But Austin was def. a notch above in hype.

Matt Armstrong, Thursday, 7 May 2015 21:36 (ten years ago)

lol you are being a bit hyperbolic

J0rdan S., Thursday, 7 May 2015 21:40 (ten years ago)

http://www.draftexpress.com/RSCI/

looks like the last top 2 guy who couldn't hack it was Kelvin Torbert over a decade ago

Matt Armstrong, Thursday, 7 May 2015 21:40 (ten years ago)

austin was a top 10 pick, he's played 4,000 nba minutes, he'll get a second contract (even if it's for little money)... he's not a good nba player and everyone makes fun of him on the internet but a lot of real high school flameouts would take it

J0rdan S., Thursday, 7 May 2015 21:41 (ten years ago)

kinda won a game for the clippers against the spurs too!

#wegonnabechampionship (Spottie), Thursday, 7 May 2015 21:42 (ten years ago)

bj mullens was rivals #1 player in 2008 and had a worse career than austin's having

michael beasley was a bigger bust than austin too

J0rdan S., Thursday, 7 May 2015 21:44 (ten years ago)

gerald green was rivals #1 player in 2005, he was a bigger flameout than austin at least for a minute

J0rdan S., Thursday, 7 May 2015 21:45 (ten years ago)

how about ndudi ebi

J0rdan S., Thursday, 7 May 2015 21:45 (ten years ago)

austin was a top 10 pick, he's played 4,000 nba minutes, he'll get a second contract (even if it's for little money)... he's not a good nba player and everyone makes fun of him on the internet but a lot of real high school flameouts would take it

― J0rdan S., Thursday, May 7, 2015 9:41 PM (1 minute ago) Bookmark Flag Post Permalink

I think getting a second NBA contract is somewhat iffy. He's mostly in the league because of the sunk cost fallacy.

Matt Armstrong, Thursday, 7 May 2015 21:46 (ten years ago)

He is basically one or two hilarious stumbles away from being 2-0 on the road as a playoff starter.

polyphonic, Thursday, 7 May 2015 21:49 (ten years ago)

gerald green was rivals #1 player in 2005, he was a bigger flameout than austin at least for a minute

― J0rdan S., Thursday, May 7, 2015 9:45 PM (2 minutes ago) Bookmark Flag Post Permalink

how about ndudi ebi

― J0rdan S., Thursday, May 7, 2015 9:45 PM (2 minutes ago) Bookmark Flag Post Permalink

Ebi was a long time ago man, that's my point.

also RSCI is better than cherrypicking one recruiting site.

Matt Armstrong, Thursday, 7 May 2015 21:50 (ten years ago)

haha poly

#wegonnabechampionship (Spottie), Thursday, 7 May 2015 21:50 (ten years ago)

part of the thing with Austin Rivers is that it's just so hard to see what the talent was. Gerald Green, Byron Mullens, you can see it quite easily.

Matt Armstrong, Thursday, 7 May 2015 21:52 (ten years ago)

he's the tebow of basketball. it looks ugly but he's a proven winner.

polyphonic, Thursday, 7 May 2015 21:52 (ten years ago)

I think getting a second NBA contract is somewhat iffy. He's mostly in the league because of the sunk cost fallacy.

― Matt Armstrong, Thursday, May 7, 2015 5:46 PM (4 minutes ago) Bookmark Flag Post Permalink

ya cld see someone taking a shot at him on the minimum but hes really not an nba quality player

lag∞n, Thursday, 7 May 2015 21:52 (ten years ago)

Kurt Helin ‏@basketballtalk 45s45 seconds ago
James Harden’s mom says Matt Barnes apologized for his Game 2 trash talk

ha this whole scenario is so matt barnes

lag∞n, Thursday, 7 May 2015 22:18 (ten years ago)

yah it is.

got a friend who i play ball w that says he went to HS w matt and that he was the biggest douche ever. he claims he punched (a very drunk) barnes at a party cos matt crossed a line when hitting on a girl, said he fell to the ground. idk. he seems like the type to not lie about that but who knows.

#wegonnabechampionship (Spottie), Thursday, 7 May 2015 22:39 (ten years ago)

That reminds me of

2014-15 NBA regular season thread: 82 games of injuries and inevitabilities

polyphonic, Thursday, 7 May 2015 22:44 (ten years ago)

lol

lag∞n, Thursday, 7 May 2015 22:46 (ten years ago)

Ha i rmembr that post! he just told me about this last week

#wegonnabechampionship (Spottie), Thursday, 7 May 2015 22:49 (ten years ago)

simmons on grantland thing tonight: "coming up next we have the goat of women's basketball. literally the goat."

Clay, Thursday, 7 May 2015 23:39 (ten years ago)

no games tonight :(

call all destroyer, Thursday, 7 May 2015 23:59 (ten years ago)

v bummer

#wegonnabechampionship (Spottie), Friday, 8 May 2015 00:01 (ten years ago)

where did the games go

lag∞n, Friday, 8 May 2015 00:24 (ten years ago)

they on ice

Sufjan Grafton, Friday, 8 May 2015 00:25 (ten years ago)

two meanings, u see

Sufjan Grafton, Friday, 8 May 2015 00:25 (ten years ago)

Are easily broken bones a sign of juicing. Is JOhn Wall juicing

, Friday, 8 May 2015 00:45 (ten years ago)

Need the opinion of a juicepert. Tnx.

, Friday, 8 May 2015 00:45 (ten years ago)

simmons on grantland thing tonight: "coming up next we have the goat of women's basketball. literally the goat."

― Clay, Thursday, May 7, 2015 11:39 PM (Yesterday) Bookmark Flag Post Permalink

jfc this guy

Matt Armstrong, Friday, 8 May 2015 01:03 (ten years ago)

part of the thing with Austin Rivers is that it's just so hard to see what the talent was. Gerald Green, Byron Mullens, you can see it quite easily.

― Matt Armstrong, Thursday, May 7, 2015 5:52 PM (4 hours ago)

yeah i mean i'm no basketball expert but i remember watching his mix tapes when he was in HS and thinking he couldn't really dribble. i'm sure some other ppl were low on him too at the time

k3vin k., Friday, 8 May 2015 02:22 (ten years ago)

ha i meant "scouting expert but i guess that works too u_u

k3vin k., Friday, 8 May 2015 02:26 (ten years ago)

Are easily broken bones a sign of juicing. Is JOhn Wall juicing

― 龜, Thursday, May 7, 2015 5:45 PM Bookmark Flag Post Permalink

Need the opinion of a juicepert. Tnx.

― 龜, Thursday, May 7, 2015 5:45 PM Bookmark Flag Post Permalink

I'm an SF Giants fan, so I guess I qualify! Most of what I heard about juice and injury proclivities had to do more with tendons, because you get extra beef muscle from the roids very quickly, but your tendons don't strengthen at the same rate and so are more vulnerable to tears and strains.

Madison Dumbbarfer (Leee), Friday, 8 May 2015 02:41 (ten years ago)

kevin love is a fucking baby

Boston Celtics forward Kelly Olynyk and his representatives have continued to deliver word to Love and people close to him that Olynyk wants to privately apologize to him, sources told Yahoo Sports. Olynyk wants to tell Love personally that he never intended to injure him in Game 4 of that series, that he's sorry for the shoulder surgery that'll cost Love six months.

Strangely, Love continues to rebuff Olynyk. He isn't interested in the call, refusing to ease Olynyk's guilt. For now, Love is a spectator to this Cavaliers playoff run, a player who is probably more missed on these Cavaliers now than he had ever been appreciated this season.

call all destroyer, Friday, 8 May 2015 02:56 (ten years ago)

simmons on grantland thing tonight: "coming up next we have the goat of women's basketball. literally the goat."
--Clay

it was a good interview tbh, didn't seem condescending or w/e

slothroprhymes, Friday, 8 May 2015 03:23 (ten years ago)

kevin love is less interesting to me than he ever was

slothroprhymes, Friday, 8 May 2015 03:24 (ten years ago)

no I didn't mean that Simmons was condescending just calling anyone "the literal goat" is funny.

Clay, Friday, 8 May 2015 03:56 (ten years ago)

goats r so trending right now

lag∞n, Friday, 8 May 2015 04:01 (ten years ago)

Haha love is so butthurt

#wegonnabechampionship (Spottie), Friday, 8 May 2015 04:04 (ten years ago)

goats are generally amusing it's true

slothroprhymes, Friday, 8 May 2015 04:08 (ten years ago)

honestly I was more surprised that the interview wasnt condescending given bill's history of casual sexism (although he's certainly improved/moved away from those attitudes in many ways)

slothroprhymes, Friday, 8 May 2015 04:09 (ten years ago)

having a daughter had to help

polyphonic, Friday, 8 May 2015 04:11 (ten years ago)

he seemed to genuinely admire & respect her which i guess is a low enough bar but still it was an good & entertaining interview

Clay, Friday, 8 May 2015 04:31 (ten years ago)

https://www.youtube.com/watch?v=Q-u-k6G4QzA

slothroprhymes, Friday, 8 May 2015 19:27 (ten years ago)

ha he really does seem dumb

lag∞n, Friday, 8 May 2015 19:30 (ten years ago)

heard wall broke his hand clashing with doctors

lag∞n, Friday, 8 May 2015 19:30 (ten years ago)

there are games tonight right bc i don't know how much more of this
https://pbs.twimg.com/media/CEcNXUWW0AAkKPK.jpg

i can take

slothroprhymes, Friday, 8 May 2015 20:23 (ten years ago)

whew there will be games

slothroprhymes, Friday, 8 May 2015 20:25 (ten years ago)

Get me hoop, I need hoop

juice college (agent hibachi), Friday, 8 May 2015 21:45 (ten years ago)

games and beer. games and beer. still at work. ;_;

Sufjan Grafton, Friday, 8 May 2015 22:01 (ten years ago)

you should tream and crack a few brews in office if you can't leave posthaste

slothroprhymes, Friday, 8 May 2015 23:33 (ten years ago)

lol just looked at timestamp and realized how late that was lol

slothroprhymes, Friday, 8 May 2015 23:33 (ten years ago)

we actually have employee funded kegs in the office. it's all very Vivek.

Sufjan Grafton, Friday, 8 May 2015 23:39 (ten years ago)

might tream some TNT if it's available

Sufjan Grafton, Friday, 8 May 2015 23:39 (ten years ago)

games tonight are espn. if you do stream tnt in the future though i recommend the behind the bucket cameras.

balls, Friday, 8 May 2015 23:42 (ten years ago)

Jalen says Russell Westbrook is one of the league's top "glue guys"

Matt Armstrong, Friday, 8 May 2015 23:44 (ten years ago)

hahahaha

balls, Friday, 8 May 2015 23:46 (ten years ago)

well that makes treaming even easier for sufjan you can just go on the ESPN website and use yr cable login

slothroprhymes, Friday, 8 May 2015 23:55 (ten years ago)

cool stuff

http://bkref.com/tiny/yOOjA

Matt Armstrong, Friday, 8 May 2015 23:56 (ten years ago)

so it's not totally cool that atl-was and gsw-mem get three days off while cle-chi and lac-hou get one day off.

Clay, Friday, 8 May 2015 23:58 (ten years ago)

xxp yeah, we good

Sufjan Grafton, Saturday, 9 May 2015 00:13 (ten years ago)

Ugh brick fest so far

juice college (agent hibachi), Saturday, 9 May 2015 00:18 (ten years ago)

can we sim the rest of this series

k3vin k., Saturday, 9 May 2015 00:41 (ten years ago)

noah is so cooked

micah, Saturday, 9 May 2015 00:44 (ten years ago)

eh he just hasn't recovered from injury really all year, i think he could bounce back after a summer off

Clay, Saturday, 9 May 2015 00:58 (ten years ago)

that shd have been a charge on bron

johnny crunch, Saturday, 9 May 2015 01:05 (ten years ago)

that shd have been a charge on bron

― johnny crunch, Friday, May 8, 2015 9:05 PM (1 minute ago)

absolutely not

k3vin k., Saturday, 9 May 2015 01:06 (ten years ago)

charges are such bullshit. there should not be a rule that encourages a defender to stand in the path of a player jumping at full speed. theres been a bunch of injuries this season alone because of it.

micah, Saturday, 9 May 2015 01:18 (ten years ago)

https://www.youtube.com/watch?v=PI5veHFijAk

micah, Saturday, 9 May 2015 01:19 (ten years ago)

fuck that.

micah, Saturday, 9 May 2015 01:19 (ten years ago)

i mean the rose thing wasn't even close, he was backpedaling defending a fast break and tried to slide in front of lebron at the last moment. not a basketball play

JD watches too much college, lol

k3vin k., Saturday, 9 May 2015 01:21 (ten years ago)

JC*

k3vin k., Saturday, 9 May 2015 01:21 (ten years ago)

yeah for sure.

micah, Saturday, 9 May 2015 01:22 (ten years ago)

yea tbf i have no idea what the rule is, just was convinced he like "had position" in super slomo idk

johnny crunch, Saturday, 9 May 2015 01:29 (ten years ago)

d-rose heating up

slothroprhymes, Saturday, 9 May 2015 01:29 (ten years ago)

oh great, a noah/lebron beef. how exciting

k3vin k., Saturday, 9 May 2015 01:30 (ten years ago)

delavedova has a v nice ft form fyi

head clowning instructor (art), Saturday, 9 May 2015 01:57 (ten years ago)

wait what, i was just thinking how delavedova has one of the ugliest shot hitches i've ever seen

k3vin k., Saturday, 9 May 2015 02:01 (ten years ago)

accidental close up of lebron's hairline above the headband was like looking at images from the mars rovers

Clay, Saturday, 9 May 2015 02:05 (ten years ago)

Xp really? maybe it's the deep bend but the ball looks like it is moving continuously starting at the floor. also i now think its possible i have been shooting fts wrong for a while

head clowning instructor (art), Saturday, 9 May 2015 02:10 (ten years ago)

That jalen kindle commercial is kinda funny

Keep gettin them checks jalen!

juice college (agent hibachi), Saturday, 9 May 2015 02:12 (ten years ago)

Xp really? maybe it's the deep bend but the ball looks like it is moving continuously starting at the floor. also i now think its possible i have been shooting fts wrong for a while

― head clowning instructor (art), Friday, May 8, 2015 10:10 PM (9 minutes ago)

he has that little hiccup and his head jerks down when he releases

k3vin k., Saturday, 9 May 2015 02:19 (ten years ago)

bron-bulls deathmatches >> 1-16 playoff bracket

J0rdan S., Saturday, 9 May 2015 02:26 (ten years ago)

does it say more about bron or rose when rose blows by him off the dribble

J0rdan S., Saturday, 9 May 2015 02:26 (ten years ago)

so now pau's out huh when do they make the season 50 games long this is ridiculous

Clay, Saturday, 9 May 2015 02:28 (ten years ago)

heinrich and dunleavy out there........

J0rdan S., Saturday, 9 May 2015 02:33 (ten years ago)

man the reffing in this game has been horrific

J0rdan S., Saturday, 9 May 2015 02:36 (ten years ago)

yup

k3vin k., Saturday, 9 May 2015 02:36 (ten years ago)

smithhhh

head clowning instructor (art), Saturday, 9 May 2015 02:39 (ten years ago)

omg

johnny crunch, Saturday, 9 May 2015 02:40 (ten years ago)

SICK!

schwantz, Saturday, 9 May 2015 02:40 (ten years ago)

ahhhh

k3vin k., Saturday, 9 May 2015 02:41 (ten years ago)

hmm

brownie, Saturday, 9 May 2015 02:41 (ten years ago)

I swore there was no way that was going in but maybe d rose hero baller is alive and well

juice college (agent hibachi), Saturday, 9 May 2015 02:41 (ten years ago)

heck of a shot

call all destroyer, Saturday, 9 May 2015 02:42 (ten years ago)

Yeeesssss

Sufjan Grafton, Saturday, 9 May 2015 02:42 (ten years ago)

Holy shit I can't believe that happened

head clowning instructor (art), Saturday, 9 May 2015 02:42 (ten years ago)

the refs tried so hard to give that one to the cavs

J0rdan S., Saturday, 9 May 2015 02:45 (ten years ago)

moment of silence for jordan who has to watch chris paul play tonight

k3vin k., Saturday, 9 May 2015 02:46 (ten years ago)

lol rockets have no idea how to defend that roll

k3vin k., Saturday, 9 May 2015 02:50 (ten years ago)

god that was a really dumb foul by blake

k3vin k., Saturday, 9 May 2015 02:55 (ten years ago)

moment of silence for jordan who has to watch chris paul play tonight

marlins are on the west coast tonight so im covered

J0rdan S., Saturday, 9 May 2015 02:56 (ten years ago)

lol

call all destroyer, Saturday, 9 May 2015 03:01 (ten years ago)

lol that lob from hawes to DAJ

k3vin k., Saturday, 9 May 2015 03:06 (ten years ago)

d-rose 30-7-7 with a steal and a block, the man is not fucking around

slothroprhymes, Saturday, 9 May 2015 03:43 (ten years ago)

sometimes i wonder if elite players will just start taking the regular season off in an egregious manner

Clay, Saturday, 9 May 2015 03:46 (ten years ago)

I mean if it was any coach but thibs you would think derrick had been popoviched all season! he wavered in game 2 but otherwise has been legit

slothroprhymes, Saturday, 9 May 2015 03:48 (ten years ago)

griffin gotta stop bringing the ball up

micah, Saturday, 9 May 2015 04:35 (ten years ago)

austin rivers getting a liiiitle overconfident but he's had a great game

k3vin k., Saturday, 9 May 2015 04:36 (ten years ago)

hey jordan just cuz i dont post on ilx about basketball doesnt mean i never pay attention to basketball

but anyway whats with all the flip flopping on ILH about derrick rose

deej loaf (D-40), Saturday, 9 May 2015 04:37 (ten years ago)

how did we flip flop

k3vin k., Saturday, 9 May 2015 04:39 (ten years ago)

wait holy shit... is Austin Rivers' game lifted by the presence of J.J. Redick? is that what that graphic just suggested/made me realize?

Heroic melancholy continues to have a forceful grip on (bernard snowy), Saturday, 9 May 2015 04:39 (ten years ago)

oh boy

omg they're chanting austin's name!!!

slothroprhymes, Saturday, 9 May 2015 04:39 (ten years ago)

imagine Doc playing mindgames w/ Austin, always praising JJ's shot in front of him & shit

Heroic melancholy continues to have a forceful grip on (bernard snowy), Saturday, 9 May 2015 04:41 (ten years ago)

I literally never thought about the fact that they were both dookies, until ~just now~

Heroic melancholy continues to have a forceful grip on (bernard snowy), Saturday, 9 May 2015 04:43 (ten years ago)

holy shitttt

slothroprhymes, Saturday, 9 May 2015 04:45 (ten years ago)

this rockets team has no soul. when austin rivers drops 22 and jj redick shuts down your best player... thats trouble

micah, Saturday, 9 May 2015 04:46 (ten years ago)

hahaha he stole the cooking gag!!

slothroprhymes, Saturday, 9 May 2015 04:46 (ten years ago)

griffin should probably get tf out this game

k3vin k., Saturday, 9 May 2015 04:46 (ten years ago)

oh.

slothroprhymes, Saturday, 9 May 2015 04:47 (ten years ago)

he just austined

slothroprhymes, Saturday, 9 May 2015 04:47 (ten years ago)

lol what was I thinking

slothroprhymes, Saturday, 9 May 2015 04:48 (ten years ago)

why is chris paul checking in

k3vin k., Saturday, 9 May 2015 04:48 (ten years ago)

Houston appear to have given up, btw. I'm pretty sure they just had dudes lay down on the floor & stay there to trip Blek Griffin up in hopes of crippling him

Heroic melancholy continues to have a forceful grip on (bernard snowy), Saturday, 9 May 2015 04:49 (ten years ago)

austin rivers stirring the pot.gif

micah, Saturday, 9 May 2015 04:52 (ten years ago)

lol thgat shit was spooky cuz after they replayed it I started paying attention to doc's coaching hand gestures
& then the referees' official hand gestures
*one of which looked kinda like making it rain #Lol

Heroic melancholy continues to have a forceful grip on (bernard snowy), Saturday, 9 May 2015 04:55 (ten years ago)

but anyway whats with all the flip flopping on ILH about derrick rose

― deej loaf (D-40), Friday, May 8, 2015 9:37 PM (17 minutes ago) Bookmark Flag Post Permalink

he had an awful regular season and he's been great in the playoffs, i think we've been pretty consistent with measuring him by how well he's been playing.

Clay, Saturday, 9 May 2015 04:58 (ten years ago)

I's at work & didn't get to see any of the Chicago win except the last two three-pointers. which was kinda cool, in a way... I'm happy Rose had a good game, both teams played hard & neither team broke 100 #defensewinschampionships

Heroic melancholy continues to have a forceful grip on (bernard snowy), Saturday, 9 May 2015 05:02 (ten years ago)

i thought the ilh vibe on rose was a bit too mean spirited when he returned

micah, Saturday, 9 May 2015 05:04 (ten years ago)

it's legume's vibe iirc

Sufjan Grafton, Saturday, 9 May 2015 05:07 (ten years ago)

i was definitely driving the "rose is toast" train in the offseason and he hadn't really made a believer out of me until v recently. i don't think it was mean as much as kind of pitying and sad and trying to accept the inevitable non-contact career-ending trip up.

Clay, Saturday, 9 May 2015 05:07 (ten years ago)

Calling people cooked is fun.

#wegonnabechampionship (Spottie), Saturday, 9 May 2015 05:08 (ten years ago)

Calling people cooked is funcooked.

Sufjan Grafton, Saturday, 9 May 2015 05:09 (ten years ago)

after that last warriors loss wondering if steph is cooked :(

Clay, Saturday, 9 May 2015 05:10 (ten years ago)

That's not fun

#wegonnabechampionship (Spottie), Saturday, 9 May 2015 05:10 (ten years ago)

most cooked player

Sufjan Grafton, Saturday, 9 May 2015 05:10 (ten years ago)

If anything, tony Allen cooked klay.

#wegonnabechampionship (Spottie), Saturday, 9 May 2015 05:11 (ten years ago)

cooked in austin rivers pot

micah, Saturday, 9 May 2015 05:18 (ten years ago)

Clay
Posted: May 9, 2015 at 12:58:02 AM
but anyway whats with all the flip flopping on ILH about derrick rose

― deej loaf (D-40), Friday, May 8, 2015 9:37 PM (17 minutes ago) Bookmark Flag Post Permalink

he had an awful regular season and he's been great in the playoffs, i think we've been pretty consistent with measuring him by how well he's been playing.

hah just checking out the 4th quarter of the bulls (who i am def rooting for btw) and rose is def a great bad shot maker but every shot he takes is bad, a dece defensive team cld lure him into 5/17 shooting nights in perpetuity, cavs obvs not that team, think this is the worst eastern conf ive seen since the nets represented back2back

lag∞n, Saturday, 9 May 2015 05:41 (ten years ago)

he's been a little better in my view but yes in reality he should prob be going 6-19 most every night

Clay, Saturday, 9 May 2015 05:42 (ten years ago)

Sufjan Grafton
Posted: May 9, 2015 at 1:07:16 AM
it's legume's vibe iirc

this is called understanding basketball, where"legume" is a signifier of being down with forks

lag∞n, Saturday, 9 May 2015 05:44 (ten years ago)

if bulls win ship, u must eat a delicious baklava that has been absolutely ruined with rosewater

Sufjan Grafton, Saturday, 9 May 2015 05:46 (ten years ago)

lol wldnt worry too much abt that

lag∞n, Saturday, 9 May 2015 05:47 (ten years ago)

good bc I tremble at the thought of ruining that delicious baklava

Sufjan Grafton, Saturday, 9 May 2015 05:49 (ten years ago)

the nba needs to remove thibs for health reasons

lag∞n, Saturday, 9 May 2015 05:53 (ten years ago)

lol rise literally banked in a game winning heave and this is whats bringing out the partisans smh

lag∞n, Saturday, 9 May 2015 05:54 (ten years ago)

i shall now watch the forth quarter of the game from the good conf

lag∞n, Saturday, 9 May 2015 05:55 (ten years ago)

He had a good second half finally driving and getting fouled. First half rose was the chucker. Bank three was lucky but w/e he made it

#wegonnabechampionship (Spottie), Saturday, 9 May 2015 05:56 (ten years ago)

rose aint never drawn a foul in his career be srs

lag∞n, Saturday, 9 May 2015 05:58 (ten years ago)

clips r already up 30 rivers has 25 lol

lag∞n, Saturday, 9 May 2015 05:59 (ten years ago)

rockets wld stampede through the east btw

lag∞n, Saturday, 9 May 2015 05:59 (ten years ago)

Btw brons headband def got thicker yet again. Things gotta be 3" thick at this point. Two more years we'll be in full beanie mode.

#wegonnabechampionship (Spottie), Saturday, 9 May 2015 06:01 (ten years ago)

i was in a restaurant during the third and the clips were up by 5 what the heck

lag∞n, Saturday, 9 May 2015 06:01 (ten years ago)

austin got the post-game interview!

Clay, Saturday, 9 May 2015 06:01 (ten years ago)

xxp should probably just wear a joey mcintyre hat

Sufjan Grafton, Saturday, 9 May 2015 06:02 (ten years ago)

Rivers has had more positive impact in these playoffs than anyone ever dreamed

#wegonnabechampionship (Spottie), Saturday, 9 May 2015 06:02 (ten years ago)

i rewond to the third

lag∞n, Saturday, 9 May 2015 06:05 (ten years ago)

cp3 one leg > rose two legs

lag∞n, Saturday, 9 May 2015 06:07 (ten years ago)

clips still only up by 8 they abt to score 20 straight points

lag∞n, Saturday, 9 May 2015 06:14 (ten years ago)

in 3 mins?

lag∞n, Saturday, 9 May 2015 06:14 (ten years ago)

watching austin rivers succeed disgusts me

lag∞n, Saturday, 9 May 2015 06:15 (ten years ago)

omg harden is a borderline garbage player but austin coopting his lame cooking celebration is unconscionable

lag∞n, Saturday, 9 May 2015 06:29 (ten years ago)

"Derrick Rose proves he's back, banking in 3 pointer to beat the Cavs"

Matt Armstrong, Saturday, 9 May 2015 06:34 (ten years ago)

"sportswriters"

micah, Saturday, 9 May 2015 06:56 (ten years ago)

omg harden is a borderline garbage player but austin coopting his lame cooking celebration is unconscionable
this is a hilariously cheesy diss

Nhex, Saturday, 9 May 2015 07:11 (ten years ago)

harden getting his celebration stolen by the worst player the game after another dude literally told his mom to suck his dick is some all time punk shit

J0rdan S., Saturday, 9 May 2015 07:50 (ten years ago)

deej is talking about ILH posts from 2011 btw

J0rdan S., Saturday, 9 May 2015 07:52 (ten years ago)

when rose's jumper is going he's a very dangerous player, when it's not he can disappear a bit but he's kinda crafty around the rim even if he doesn't have the same athleticism

good thing for the bulls is butler and pau can carry stretches offensively and like mirotic or hell even dunleavy (first part of game 1) can heat up enough to swing a game. and then when rose is feeling it he can still takeover inna vintage style.

J0rdan S., Saturday, 9 May 2015 07:55 (ten years ago)

rose is most likely going to be a good nights/bad nights type of player from here on out, i never cared for his game but given what he's been through i'm rooting for him to have more of the good nights

call all destroyer, Saturday, 9 May 2015 13:54 (ten years ago)

http://giant.gfycat.com/LastingFittingDuck.gif

Jeff, Saturday, 9 May 2015 14:31 (ten years ago)

btw announcers falling all over themselves to compliment tristan thompsons offensive rebounding last nite really shd know that when a player is way better at offensive rebounding than anything else it just means no one is guarding them

lag∞n, Saturday, 9 May 2015 15:51 (ten years ago)

yeah JVG saying tristan is gonna get "the max" was incredible. i mean maybe he will bcuz lol cavs/rich paul but if your one elite skill is offensive rebounding that's only good to a point.

J0rdan S., Saturday, 9 May 2015 15:54 (ten years ago)

I thought tristan already did get a max deal along with the varejao extension or was it just varejao?

slothroprhymes, Saturday, 9 May 2015 17:01 (ten years ago)

precisely for the rich paul/lebron mafia reasons. but could be remembering it wrong

slothroprhymes, Saturday, 9 May 2015 17:02 (ten years ago)

nah he turned down 4/52

J0rdan S., Saturday, 9 May 2015 17:08 (ten years ago)

the thing about Rose is that he's uncoachable w/r/t 3s and he's a terrible defender. So yeah he could still be pretty damn good if he just was an iso slashing machine but the things you have to swallow to get that from him are pretty gross.

Matt Armstrong, Saturday, 9 May 2015 21:21 (ten years ago)

john wall looking sharp

micah, Saturday, 9 May 2015 21:23 (ten years ago)

xp
http://ep.yimg.com/ay/cjgo/baklava-flavored-coffee-1lb-bag-2.png

Sufjan Grafton, Saturday, 9 May 2015 21:24 (ten years ago)

Otto Porter probably still overdrafted but he looks like he's gonna be a nice player

Matt Armstrong, Saturday, 9 May 2015 21:32 (ten years ago)

I m/l turned on rose in the sense that I wasn't gonna buy that he is back for real until he plays like 70 games two seasons in a row and looks like an all-star

Also the cult of sports media rooting for him and over-covering every sprained ankle and utterance from his third cousin once removed grosses me out but that's mostly not his fault

I like watching him mostly when he's on and didn't expect him to blow up in the offs after a meh regular season so that's nice but the generally ill-advised long range shooting bothers me, like I think he could accidentally turn into Bad late career Stephon Marbury if he's not careful

juice college (agent hibachi), Saturday, 9 May 2015 21:34 (ten years ago)

Btw Austin rivers swinging like three western playoff games so far while playing for his dad might be the single least likely thing to happen this year

Maybe Hassan whiteside existed is slightly less probable

juice college (agent hibachi), Saturday, 9 May 2015 21:36 (ten years ago)

wtf hawks

slothroprhymes, Saturday, 9 May 2015 21:36 (ten years ago)

pierce with his first victim of the game

slothroprhymes, Saturday, 9 May 2015 21:37 (ten years ago)

Listening to pj carlesimo is mad annoying

juice college (agent hibachi), Saturday, 9 May 2015 21:38 (ten years ago)

maybe I shouldn't have bet the hawks on this series - by no means a lot of money but how did you deceive me randy wittman

slothroprhymes, Saturday, 9 May 2015 21:40 (ten years ago)

I feel dumb as hell

slothroprhymes, Saturday, 9 May 2015 21:41 (ten years ago)

Pierce injected him with that playoff rondo obv

juice college (agent hibachi), Saturday, 9 May 2015 21:44 (ten years ago)

http://twitter.com/APkrawczynski/status/597154961483505664

appreciated this for its simple truth

Clay, Saturday, 9 May 2015 22:11 (ten years ago)

wow hawks

Matt Armstrong, Saturday, 9 May 2015 23:10 (ten years ago)

the enigmatic Nene Hilario

Matt Armstrong, Saturday, 9 May 2015 23:16 (ten years ago)

lol down 5

johnny crunch, Saturday, 9 May 2015 23:27 (ten years ago)

damn I gave up on this game but just checked in, 30 points in Q4!

slothroprhymes, Saturday, 9 May 2015 23:37 (ten years ago)

Steve Javie you fucking idiot

Matt Armstrong, Saturday, 9 May 2015 23:41 (ten years ago)

Omfg this call is so bad

Matt Armstrong, Saturday, 9 May 2015 23:41 (ten years ago)

wow bad call

k3vin k., Saturday, 9 May 2015 23:43 (ten years ago)

korver is strugglin

johnny crunch, Saturday, 9 May 2015 23:43 (ten years ago)

Like what is your perception of how physics works if you think that was off sessions

Matt Armstrong, Saturday, 9 May 2015 23:44 (ten years ago)

MUSCALA

johnny crunch, Saturday, 9 May 2015 23:47 (ten years ago)

PIERCE

k3vin k., Saturday, 9 May 2015 23:49 (ten years ago)

an old paul pierce is better than no paul pierce

slothroprhymes, Saturday, 9 May 2015 23:49 (ten years ago)

haha how tight is muscala

k3vin k., Saturday, 9 May 2015 23:49 (ten years ago)

get outta here w/ that wow

johnny crunch, Saturday, 9 May 2015 23:50 (ten years ago)

as soon as piece got the ball i knew

balls, Saturday, 9 May 2015 23:50 (ten years ago)

Glad the wiz won after that bogus call

Matt Armstrong, Saturday, 9 May 2015 23:51 (ten years ago)

lol lovin' pierce these 'offs

Clay, Saturday, 9 May 2015 23:52 (ten years ago)

that's why they brought him here

slothroprhymes, Saturday, 9 May 2015 23:54 (ten years ago)

Playoff Otto Porter was pretty rad tonight

Matt Armstrong, Saturday, 9 May 2015 23:54 (ten years ago)

still think the wiz blowing the lead is more characteristic of their team, not writing the hawks off just yet

slothroprhymes, Saturday, 9 May 2015 23:54 (ten years ago)

Haha I almost turned this off when it was a 20 point lead and thought for sure shook ass Ramon sessions and Martin gortat were going to give this one away but whoops the mf'in TRUTH

juice college (agent hibachi), Saturday, 9 May 2015 23:54 (ten years ago)

I think the Hawks are winning this like 80%

Matt Armstrong, Saturday, 9 May 2015 23:55 (ten years ago)

yeah i was watching every time he came off or to the bench tuesday and there was a point just after halftime when he and wall were sitting on the bench talking and the rest of the team taking warmup shots and i was like totally 'man i wish paul pierce was on our side'

balls, Saturday, 9 May 2015 23:55 (ten years ago)

Although if horford is hurt...

Matt Armstrong, Saturday, 9 May 2015 23:56 (ten years ago)

Like what is your perception of how physics works if you think that was off sessions

― Matt Armstrong, Saturday, May 9, 2015 7:44 PM (10 minutes ago) Bookmark Flag Post Permalink

The only thing I could think was maybe it grazed his shin just as it was coming down but i probably wouldn't have overturned the call at least with the angles ESPN had on it

juice college (agent hibachi), Saturday, 9 May 2015 23:56 (ten years ago)

i thought for sure it was off sessions until i saw the replays. watching w/o audio so no idea what was said but i figured they just decided they didn't have enough to conclusively overturn the call but man what i saw looked pretty damn conclusive.

balls, Saturday, 9 May 2015 23:58 (ten years ago)

Alright well that's enough of the JV squads lets get to the real game

Doris Burke gets fired up for Memphis I like it

juice college (agent hibachi), Sunday, 10 May 2015 00:01 (ten years ago)

air vince sideline dance dot gif

slothroprhymes, Sunday, 10 May 2015 00:33 (ten years ago)

dare i say curry looks a little shook

k3vin k., Sunday, 10 May 2015 00:39 (ten years ago)

lotta dubs turnovers

slothroprhymes, Sunday, 10 May 2015 00:49 (ten years ago)

i am nervous abt this, dubs are all i have left

Clay, Sunday, 10 May 2015 00:49 (ten years ago)

guess this is where we find out if steve kerr is actually good or not. one problem the warriors have here is they haven't really played in this kind of condition much all year. does the team/coach know how to mount a comeback in a critical situation?

Clay, Sunday, 10 May 2015 00:58 (ten years ago)

Yeah I'm just getting the feeling that curry is a lil off this game and tony is smothering klay, so they're a little discombobulated and Memphis is ferocious on offense right now

juice college (agent hibachi), Sunday, 10 May 2015 01:00 (ten years ago)

that conley/allen/gasol triptych is just nearly impossible to score on when they're locked in

Clay, Sunday, 10 May 2015 01:02 (ten years ago)

I ultimately want the dubs to win it all, they should be rewarded for how dominant they were in all ways during the season

that said the grizz are pretty great

slothroprhymes, Sunday, 10 May 2015 01:06 (ten years ago)

really love the conley/lee backcourt feel like it's underrated (altho conley on his own is generally well praised)

slothroprhymes, Sunday, 10 May 2015 01:07 (ten years ago)

steph has the legit yips

k3vin k., Sunday, 10 May 2015 01:08 (ten years ago)

honestly can't believe my eyes

Clay, Sunday, 10 May 2015 01:08 (ten years ago)

grizz bulls finals please

Allen (etaeoe), Sunday, 10 May 2015 01:08 (ten years ago)

steph making lazy passes right into his defender's fingertips, austin rivers destroying the rockets singlehanded, the gods mock me

Clay, Sunday, 10 May 2015 01:09 (ten years ago)

steph is winded and there's four minutes left in the half. i don't understand.

Allen (etaeoe), Sunday, 10 May 2015 01:09 (ten years ago)

griz wiz synergy imo xps

Clay, Sunday, 10 May 2015 01:10 (ten years ago)

well my dubs -5.5 bet ain't looking too hot

k3vin k., Sunday, 10 May 2015 01:11 (ten years ago)

when did ilh becoming this gambling hotbed, feel like i'm in some kinda internet speakeasy

Clay, Sunday, 10 May 2015 01:14 (ten years ago)

tony allen just scarred klay thompson's psyche for years

Clay, Sunday, 10 May 2015 01:16 (ten years ago)

the crowd is chanting first-team defense!!!!!!

Clay, Sunday, 10 May 2015 01:16 (ten years ago)

o my god tony

slothroprhymes, Sunday, 10 May 2015 01:18 (ten years ago)

hyped the warriors so much to my friends that only pay attention to the playoffs. feeling 😬.

Allen (etaeoe), Sunday, 10 May 2015 01:18 (ten years ago)

first-team defense chat is amazing. going to bandwagon this team so hard.

Allen (etaeoe), Sunday, 10 May 2015 01:18 (ten years ago)

i've never seen anything like what tony allen did in those last few minutes

Clay, Sunday, 10 May 2015 01:19 (ten years ago)

he's ruining childhoods in the bay area

slothroprhymes, Sunday, 10 May 2015 01:19 (ten years ago)

sprint presents the ESPN Cut Your Bill in Half halftime show

Clay, Sunday, 10 May 2015 01:23 (ten years ago)

amazing energy in memphis crowd

moullet, Sunday, 10 May 2015 01:29 (ten years ago)

When we all said the Western Conference was crazy and unpredictable, did we not really believe ourselves?

Aimless, Sunday, 10 May 2015 01:31 (ten years ago)

I def assumed once the playoffs came around the paths would be fairly predictable yea, like dubs would wash everyone, get to like a dubs spurs conference finals as a final test for the dubs inevitable triumph

slothroprhymes, Sunday, 10 May 2015 01:33 (ten years ago)

which can of course still happen except for the spurs part but yea no one has tested them like the grizz are now

slothroprhymes, Sunday, 10 May 2015 01:34 (ten years ago)

the only thing that's going as scripted is that the rockets are trash

Clay, Sunday, 10 May 2015 01:41 (ten years ago)

I m/l turned on rose in the sense that I wasn't gonna buy that he is back for real until he plays like 70 games two seasons in a row and looks like an all-star
agreed here

Nhex, Sunday, 10 May 2015 01:45 (ten years ago)

oh here come the warriors

slothroprhymes, Sunday, 10 May 2015 01:46 (ten years ago)

klay's shookedness extending to dumb fouls though

slothroprhymes, Sunday, 10 May 2015 01:47 (ten years ago)

TONYYYYY

slothroprhymes, Sunday, 10 May 2015 01:48 (ten years ago)

wow klay is bad now

Clay, Sunday, 10 May 2015 01:49 (ten years ago)

yea it's kinda hard to believe he has 17 points on 7/11 shooting given how stilted and panicked he's looking

slothroprhymes, Sunday, 10 May 2015 01:54 (ten years ago)

is this an off night or is memphis' post offense just a secret foil to golden state or other explanations

head clowning instructor (art), Sunday, 10 May 2015 01:56 (ten years ago)

http://i.imgur.com/RTCHCb3.png

micah, Sunday, 10 May 2015 01:58 (ten years ago)

what is pp gonna do when he retires? i hope it is write hilarious books where he just disses everyone he ever played against alphabetically.

Clay, Sunday, 10 May 2015 02:00 (ten years ago)

xxp they've had a bit too much rest and practice time for it to be just an off night I think, grizz are a legit problem for them.

slothroprhymes, Sunday, 10 May 2015 02:03 (ten years ago)

grizz are a matchup problem for pretty much everyone tho? it might be their main strength.

Clay, Sunday, 10 May 2015 02:04 (ten years ago)

curry has straight up shit his pants, there's no sugarcoating it

k3vin k., Sunday, 10 May 2015 02:04 (ten years ago)

curry airball ._.

Clay, Sunday, 10 May 2015 02:05 (ten years ago)

dont think zbo was even looking at the basket on that shot

head clowning instructor (art), Sunday, 10 May 2015 02:05 (ten years ago)

the grizz lost a game to the celtics so they clearly have some holes but yea in theory they can beat any team to shit

slothroprhymes, Sunday, 10 May 2015 02:08 (ten years ago)

and often do in execution, maybe their semi-swoon was more fluke than indicator of real problems

will they let steph change his shorts

slothroprhymes, Sunday, 10 May 2015 02:09 (ten years ago)

would be pretty cool if the four finalists ended up a collection of least hyped teams from the reg season

head clowning instructor (art), Sunday, 10 May 2015 02:11 (ten years ago)

do any of these east teams look like they can take more than a game from dubs/grizz/clips? not sure how much the finals are even gonna be a big deal.

Clay, Sunday, 10 May 2015 02:13 (ten years ago)

the western conference finals should probably be the end of the season imo

head clowning instructor (art), Sunday, 10 May 2015 02:14 (ten years ago)

there's no way anybody from the east makes as compelling a matchup as the clippers v dubs/griz

head clowning instructor (art), Sunday, 10 May 2015 02:15 (ten years ago)

this festus ezeli iso offense isn't working

polyphonic, Sunday, 10 May 2015 02:19 (ten years ago)

sprint presents the ESPN Cut Your Bill in Half halftime show

― Clay, Saturday, May 9, 2015 9:23 PM (58 minutes ago) Bookmark Flag Post Permalink

lol

It works on so many levels

juice college (agent hibachi), Sunday, 10 May 2015 02:23 (ten years ago)

dubs just getting destroyed on the offensive glass

k3vin k., Sunday, 10 May 2015 02:24 (ten years ago)

I watched the 1st half with my parents (thanks ABC!), think they might be legit Griz bandwagon fans now

Heroic melancholy continues to have a forceful grip on (bernard snowy), Sunday, 10 May 2015 02:26 (ten years ago)

klay 0-2 from the line, great work

k3vin k., Sunday, 10 May 2015 02:26 (ten years ago)

i will def root for the grizz over the clippers, rockets, cavs, & bulls.

Clay, Sunday, 10 May 2015 02:27 (ten years ago)

we prob shouldn't act like this series is over bc the dubs two reliable best scorers had a shitty game

Clay, Sunday, 10 May 2015 02:28 (ten years ago)

just that it's even a possibility is notable

head clowning instructor (art), Sunday, 10 May 2015 02:28 (ten years ago)

i still don't count them out of this game

head clowning instructor (art), Sunday, 10 May 2015 02:29 (ten years ago)

Ya I approve of any orphaned ilhers rejoining our old grizz bandwagon, most of us have been up on tony Allen since he was a Celtic or on Marc since he was just pau's fat lil brother

juice college (agent hibachi), Sunday, 10 May 2015 02:29 (ten years ago)

yeah they keep nipping it down to 10. if they cut it to single digits they prob might some steam goin

Clay, Sunday, 10 May 2015 02:30 (ten years ago)

It's definitely not over in any way when a team goes up 2-1 tho of course

juice college (agent hibachi), Sunday, 10 May 2015 02:30 (ten years ago)

Ya I approve of any orphaned ilhers rejoining our old grizz bandwagon

"z-bo with the z-bound" never forget

Clay, Sunday, 10 May 2015 02:30 (ten years ago)

clippers beat san antonio so they have my full faith and confidence the rest of their run

head clowning instructor (art), Sunday, 10 May 2015 02:31 (ten years ago)

Z-Bo valentine .jpg

juice college (agent hibachi), Sunday, 10 May 2015 02:31 (ten years ago)

My father & I marveled at the effortless dominance of Ohio-born big man Kostas Koufos; we scowled at the Warriors sprinting down the floor & missing semi-open looks with 19 seconds left on the shot clock, because they didn't (couldn't?) wait for a Quality Shot. I made the point about Griz being dangerous over a long series because they don't blow leads once they take them. I will feel kinda silly if they end up blowing this one, but I badly need a shower before bed

Heroic melancholy continues to have a forceful grip on (bernard snowy), Sunday, 10 May 2015 02:34 (ten years ago)

google for z-bound brings up maybe the most diverse search results i've seen in years, from z-bo to physics to coding stuff to footwear to jay-z to michelle obama.

Clay, Sunday, 10 May 2015 02:34 (ten years ago)

http://i.imgur.com/ABTSVxL.jpg

head clowning instructor (art), Sunday, 10 May 2015 02:35 (ten years ago)

xps

head clowning instructor (art), Sunday, 10 May 2015 02:35 (ten years ago)

usually search results have been ground away like a shoreline, it is strange to encounter the hairier days of grabbag search xp to myself

Clay, Sunday, 10 May 2015 02:35 (ten years ago)

when did ilh becoming this gambling hotbed, feel like i'm in some kinda internet speakeasy

― Clay, Saturday, May 9, 2015 9:14 PM (1 hour ago)

1st round was so depressing man had to spice it up a little

k3vin k., Sunday, 10 May 2015 02:36 (ten years ago)

btw i might have put a few bucks on dubs +1100 a few minutes ago

k3vin k., Sunday, 10 May 2015 02:36 (ten years ago)

these refs man

micah, Sunday, 10 May 2015 02:37 (ten years ago)

http://i32.photobucket.com/albums/d33/tracedoutdreamer/zach-randolph-happy-valentines-day-.jpg

the canonical z-bo valentine image is this lil guy, however i will not plug the dam of multiple z-bo valentines

Clay, Sunday, 10 May 2015 02:37 (ten years ago)

lol 4 point game ilh otm

Clay, Sunday, 10 May 2015 02:37 (ten years ago)

wow, why would you leave early on a steph FT

k3vin k., Sunday, 10 May 2015 02:37 (ten years ago)

would really dig if dubs clawed back up but then grizz buried it with our 3rd buzzer beater of the weekend

slothroprhymes, Sunday, 10 May 2015 02:38 (ten years ago)

courtney!! shine on you onetime celtics diamond

slothroprhymes, Sunday, 10 May 2015 02:39 (ten years ago)

jesus christ
looks like I won't get that shower after all
'less I'm up pouring gatorade on myself as time expires

Heroic melancholy continues to have a forceful grip on (bernard snowy), Sunday, 10 May 2015 02:39 (ten years ago)

memo to tony allen: u are first team all-defense not first team all-dribbling

Clay, Sunday, 10 May 2015 02:39 (ten years ago)

my tream is apparently at least a couple minutes behind fuck what kind of world is this

head clowning instructor (art), Sunday, 10 May 2015 02:39 (ten years ago)

I would like to think the courtney lee shot buried the dubs but I'm still legit afraid of what their offense can do in 2:45

Heroic melancholy continues to have a forceful grip on (bernard snowy), Sunday, 10 May 2015 02:40 (ten years ago)

& also want to share w/u my secret playoff metric which is to pick the team that holds the other team under 100 pts most of the time

Heroic melancholy continues to have a forceful grip on (bernard snowy), Sunday, 10 May 2015 02:41 (ten years ago)

wow dubs getting every whistle

k3vin k., Sunday, 10 May 2015 02:42 (ten years ago)

fuckin hogwash foul call tbh

slothroprhymes, Sunday, 10 May 2015 02:42 (ten years ago)

WHOA MARC

slothroprhymes, Sunday, 10 May 2015 02:43 (ten years ago)

oh fuck off gasol

k3vin k., Sunday, 10 May 2015 02:43 (ten years ago)

that's a 2

k3vin k., Sunday, 10 May 2015 02:43 (ten years ago)

Haha what is up with the crazy bank shots this weekend

juice college (agent hibachi), Sunday, 10 May 2015 02:44 (ten years ago)

nah that's the shadow of the shoe

Heroic melancholy continues to have a forceful grip on (bernard snowy), Sunday, 10 May 2015 02:44 (ten years ago)

oh shit didn't know marc fouled out that's huge

Clay, Sunday, 10 May 2015 02:45 (ten years ago)

my tream is apparently at least a couple minutes behind fuck what kind of world is this

― head clowning instructor (art), Sunday, May 10, 2015 12:39 PM

pretty sure the dvr tream is at least 10 minutes delayed

micah, Sunday, 10 May 2015 02:45 (ten years ago)

jesus dray

k3vin k., Sunday, 10 May 2015 02:46 (ten years ago)

did zach not murder klay on that rebound?

Clay, Sunday, 10 May 2015 02:46 (ten years ago)

Draymond losing this game for dubs

juice college (agent hibachi), Sunday, 10 May 2015 02:46 (ten years ago)

why are the commercials 5 times as loud as the game, managing the volume is a fucking chore stop it

Clay, Sunday, 10 May 2015 02:47 (ten years ago)

that is a constant trend on like all networks but abc is a major offender in particular

slothroprhymes, Sunday, 10 May 2015 02:48 (ten years ago)

i just got rid of my sound system and am using straight tv volume so maybe the mids and highs are more noticeable w/o decent equipment but yeah it's been ridiculous

Clay, Sunday, 10 May 2015 02:49 (ten years ago)

free throws this quarter: gsw 18, mem 4

micah, Sunday, 10 May 2015 02:51 (ten years ago)

condolences to spottie and leee :(

Clay, Sunday, 10 May 2015 02:52 (ten years ago)

every series is 2-1 and the lower seed leads in every one huh

Clay, Sunday, 10 May 2015 04:09 (ten years ago)

warriors three point shooting is the one and only single problem (and a few free throws i guess). curry shooting threes poorly twice in a row is the last thing i expected.

#wegonnabechampionship (Spottie), Sunday, 10 May 2015 06:05 (ten years ago)

v bummed

#wegonnabechampionship (Spottie), Sunday, 10 May 2015 06:05 (ten years ago)

why do they have mvp ceremonies in the middle of playoffs i hate that.

#wegonnabechampionship (Spottie), Sunday, 10 May 2015 06:06 (ten years ago)

multiple deadspin commenters suggesting that officiating was fixed to give dubs an advantage at the free throw line bc they want dubs in the finals

ban kinja commenters bc A. fat lot of good the foul trouble on memphis did for the dubs and B. do people really exist who think officiating is regularly fixed and not just frequently flawed bc it is a task done by human beings

slothroprhymes, Sunday, 10 May 2015 13:26 (ten years ago)

ban yourself for reading deadspin comments

J0rdan S., Sunday, 10 May 2015 13:32 (ten years ago)

nah

I don't usually read comments in general, deadspin's are occasionally funny, can't say I have any plans to go back to that well in the immediate future

slothroprhymes, Sunday, 10 May 2015 13:42 (ten years ago)

Grizz pulled some Sons of the Harpy shit on the Dubs lmao

, Sunday, 10 May 2015 13:44 (ten years ago)

Could we get Grey Worm to play Steph Curry in the biopic

, Sunday, 10 May 2015 13:45 (ten years ago)

the mvp award is cursed now guys its is a thing

lag∞n, Sunday, 10 May 2015 14:26 (ten years ago)

is KD to blame for this or did bron merely supersede the general preexisting trend in his heat championship years

slothroprhymes, Sunday, 10 May 2015 14:45 (ten years ago)

bron is being weird again:

"It's an emergency every playoff game. As the leader of the team, I can't be down about anything," James said Saturday after the team had a film session.

"Even though I hate losing -- it was tough for me to sleep last night -- I'm not going to be shattered, not around these guys. They need my leadership more than ever, more than anybody on the team. I will not show any weakness."

call all destroyer, Sunday, 10 May 2015 15:01 (ten years ago)

Translation u guys kind of suck and I wish Chris bosh was here

juice college (agent hibachi), Sunday, 10 May 2015 17:06 (ten years ago)

Btw

Kyrie Irving, PG 38 3-13 3-4 2-2 1 3 4 0 2 1 2 3 -8 11

That's a zero in the assist column a few months after bron told him he could never have a game with zero assists again

juice college (agent hibachi), Sunday, 10 May 2015 17:07 (ten years ago)

kyrie is playing on a bad ankle fyi

micah, Sunday, 10 May 2015 17:25 (ten years ago)

https://twitter.com/PhilJackson11/status/597453125297917953

Phil JacksonVerified account
‏@PhilJackson11
NBA analysts give me some diagnostics on how 3pt oriented teams are faring this playoffs...seriously, how's it goink?

Damn Phil

, Sunday, 10 May 2015 17:29 (ten years ago)

goink goink goink

“audience participation” otherwise known as “touching” (forksclovetofu), Sunday, 10 May 2015 17:36 (ten years ago)

Phil Jackson give me some diagnostics on how the NY Knicks are faring this playoffs...seriously, how's it goink?

Aimless, Sunday, 10 May 2015 17:41 (ten years ago)

how bout some diagnostics on how many playoff series they've won in 10 years (1) and how useless the triangle is in the modern NBA (totally useless)

slothroprhymes, Sunday, 10 May 2015 17:43 (ten years ago)

going small in the second half worked for the dubs last night wonder if well see that quicker 2moro

lag∞n, Sunday, 10 May 2015 17:51 (ten years ago)

iggy played more minutes than bogut

lag∞n, Sunday, 10 May 2015 17:51 (ten years ago)

bogut/green defensive player of the years top five finisher front line got shredded by gasol and randolph in the 1st

lag∞n, Sunday, 10 May 2015 17:52 (ten years ago)

Pau out.

Jeff, Sunday, 10 May 2015 17:54 (ten years ago)

dang

lag∞n, Sunday, 10 May 2015 17:55 (ten years ago)

Z bo has hit some insane shots too

#wegonnabechampionship (Spottie), Sunday, 10 May 2015 18:05 (ten years ago)

I thought last night that one major downside of the Warriors falling anywhere short of the title means another year of Chuck et al banging the sad old "jump shooting teams can't win championships" nonsense

juice college (agent hibachi), Sunday, 10 May 2015 18:28 (ten years ago)

Yeah :( grizz are just a rough team. Two low post offensive threats on the same team is hard for anyone to cover.

#wegonnabechampionship (Spottie), Sunday, 10 May 2015 18:32 (ten years ago)

mo speights out a week

slothroprhymes, Sunday, 10 May 2015 19:21 (ten years ago)

https://twitter.com/SherwoodStrauss/status/597480200750829569

Ethan Strauss
‏@SherwoodStrauss
Interesting that Curry's teammates got him out of the hotel to relax last night. Rare thing that Curry goes out

Feel like we have a potential "Barney Gumble has first sip of beer" moment here

, Sunday, 10 May 2015 19:22 (ten years ago)

yeah i was hesitating rooting for the grizz cuz of yr anti-analytics morons but i'm not sure that the warriors (or say the hawks) winning would shut them up anyway. the red sox winning didn't shut up yr joe morgans.

balls, Sunday, 10 May 2015 19:28 (ten years ago)

kyrie looks actively bad

J0rdan S., Sunday, 10 May 2015 19:46 (ten years ago)

when rose has that little cp3 midrange jumper off the PNR going in he almost looks as good as ever

J0rdan S., Sunday, 10 May 2015 19:49 (ten years ago)

bron has the killer bron game jumper going tho

J0rdan S., Sunday, 10 May 2015 19:49 (ten years ago)

the bulls really miss pau tho, joakim and taj look really helpless on offense. hopefully thibs lets mirotic fly today.

J0rdan S., Sunday, 10 May 2015 19:50 (ten years ago)

I don't think he has a choice

slothroprhymes, Sunday, 10 May 2015 19:55 (ten years ago)

old blind man kirk threes are never not entertaining

slothroprhymes, Sunday, 10 May 2015 19:57 (ten years ago)

tristan doing to the bulls what taj did to the heat all those years

J0rdan S., Sunday, 10 May 2015 20:24 (ten years ago)

these broken teams are a pretty tight matchup

micah, Sunday, 10 May 2015 20:58 (ten years ago)

Wth does rose do that jump pass.

Jeff, Sunday, 10 May 2015 21:00 (ten years ago)

Wow that sprain looked bad

, Sunday, 10 May 2015 21:09 (ten years ago)

Fast Break (@GSWFastBreak)
5/10/15, 8:16 AM
This would mark the fewest 3s the Warriors made in a 2 game stretch since (wait for it) playoff Games 2 and 3 against the Clippers

#wegonnabechampionship (Spottie), Sunday, 10 May 2015 21:26 (ten years ago)

considering the stakes this has been a dreadful game from bron

J0rdan S., Sunday, 10 May 2015 21:26 (ten years ago)

neither of these teams know how to make the ball go into the basket

lag∞n, Sunday, 10 May 2015 21:29 (ten years ago)

this is a LOT of matthew kevinkellavadova

J0rdan S., Sunday, 10 May 2015 21:35 (ten years ago)

https://vine.co/v/emDgErZEEDV

This is perhaps my favorite thing that Kanye has ever done, including Yeezus

, Sunday, 10 May 2015 21:37 (ten years ago)

moz.gov fired up, also awkward

juice college (agent hibachi), Sunday, 10 May 2015 21:46 (ten years ago)

JR :--------------[

J0rdan S., Sunday, 10 May 2015 21:47 (ten years ago)

how many times do u think "not a smart play by jr smith" has been said

lag∞n, Sunday, 10 May 2015 21:48 (ten years ago)

half the players in this game can't walk

J0rdan S., Sunday, 10 May 2015 21:49 (ten years ago)

how many times do u think "not a smart play by jr smith" has been said

by Mike Breen alone

J0rdan S., Sunday, 10 May 2015 21:49 (ten years ago)

Mark Jackson with the bold theory that excessive yoga is causing NBA injuries

Matt Armstrong, Sunday, 10 May 2015 21:50 (ten years ago)

Jeez are they playing on AstroTurf or something w all these turned ankles

juice college (agent hibachi), Sunday, 10 May 2015 21:50 (ten years ago)

Lebron playoff flop

Matt Armstrong, Sunday, 10 May 2015 21:50 (ten years ago)

rose should've passed that off instead of trying for the tie himself

that is yr cue everyone btw

slothroprhymes, Sunday, 10 May 2015 21:57 (ten years ago)

Kyrie looks legit injured huh

Matt Armstrong, Sunday, 10 May 2015 21:58 (ten years ago)

Cavs just burned 3
Timeouts on same play lmao

, Sunday, 10 May 2015 22:02 (ten years ago)

omg lol

johnny crunch, Sunday, 10 May 2015 22:03 (ten years ago)

this is a LOT of matthew kevinkellavadova

― J0rdan S., Sunday, May 10, 2015 5:35 PM (26 minutes ago)

lol

k3vin k., Sunday, 10 May 2015 22:03 (ten years ago)

good call tbh

k3vin k., Sunday, 10 May 2015 22:03 (ten years ago)

bron srsly losing his cool

slothroprhymes, Sunday, 10 May 2015 22:04 (ten years ago)

no foul imo

J0rdan S., Sunday, 10 May 2015 22:04 (ten years ago)

bron has been real bad

J0rdan S., Sunday, 10 May 2015 22:05 (ten years ago)

Bron wtf dude

Matt Armstrong, Sunday, 10 May 2015 22:05 (ten years ago)

Will there be a Ray Allen to bail him out here

Matt Armstrong, Sunday, 10 May 2015 22:05 (ten years ago)

he had shump open in the corner

k3vin k., Sunday, 10 May 2015 22:05 (ten years ago)

Dunleavy's chin, player of the game

Jeff, Sunday, 10 May 2015 22:05 (ten years ago)

weekend of the buzzer beater

slothroprhymes, Sunday, 10 May 2015 22:06 (ten years ago)

DAAAAAAMN

k3vin k., Sunday, 10 May 2015 22:06 (ten years ago)

YO

J0rdan S., Sunday, 10 May 2015 22:06 (ten years ago)

wow

lag∞n, Sunday, 10 May 2015 22:07 (ten years ago)

Haha this playoffs is so fun

Matt Armstrong, Sunday, 10 May 2015 22:07 (ten years ago)

Mother's Day ruined.

Jeff, Sunday, 10 May 2015 22:07 (ten years ago)

yeah this second round is turning out alright

balls, Sunday, 10 May 2015 22:07 (ten years ago)

I'm glad the cavs evened things out with a buzzer beater that wasn't pure luck

Matt Armstrong, Sunday, 10 May 2015 22:07 (ten years ago)

this is a real good series albeit not always bc the basketball itself is good lol

slothroprhymes, Sunday, 10 May 2015 22:08 (ten years ago)

jvg absolutely right about that replay advantage. so dumb. bulls played that last minute perfectly.

Allen (etaeoe), Sunday, 10 May 2015 22:08 (ten years ago)

These buzzer beaters are making up for the cruddy first round outside clips Spurs

Van Gundy so mad about the effective timeouts during instant replay

juice college (agent hibachi), Sunday, 10 May 2015 22:08 (ten years ago)

anyway, this cavs team is still an embarrassment.

Allen (etaeoe), Sunday, 10 May 2015 22:08 (ten years ago)

bron still in his weird mindspace i see

lag∞n, Sunday, 10 May 2015 22:09 (ten years ago)

Lebron says dunleavy dove to the floor, apparently in a way that made Lebron fall directly onto him

Matt Armstrong, Sunday, 10 May 2015 22:09 (ten years ago)

this series too lit

, Sunday, 10 May 2015 22:09 (ten years ago)

I don't understand how you could argue with jvg. the cavs ran a set after the bulls perfectly burned the cavs remaining time outs.

Allen (etaeoe), Sunday, 10 May 2015 22:10 (ten years ago)

the cavs didn't even run a play, jimmy just lost lebron off like one jab step

J0rdan S., Sunday, 10 May 2015 22:10 (ten years ago)

Lebron says dunleavy dove to the floor, apparently in a way that made Lebron fall directly onto him

when does weird lebron become u mad lebron. i'm so over him.

Allen (etaeoe), Sunday, 10 May 2015 22:11 (ten years ago)

regardless if they ran a play or not they had time to gather themselves and talk where the alternative is inbounding the ball immediately after it went out jvg otm

lag∞n, Sunday, 10 May 2015 22:12 (ten years ago)

the cavs didn't even run a play, jimmy just lost lebron off like one jab step

huh. did you miss that inbound?

Allen (etaeoe), Sunday, 10 May 2015 22:13 (ten years ago)

Unbelievable the Bulls can't beat the Cavs after this performance.

brownie, Sunday, 10 May 2015 22:14 (ten years ago)

_the cavs didn't even run a play, jimmy just lost lebron off like one jab step_

huh. did you miss that inbound?

the point is that the cavs got time to draw up a play but they didn't actually run anything. thompson who was never getting the ball ran to the rim but the players on the opposite side of the floor didn't move. bron gave jimmy a little nudge and that was it.

J0rdan S., Sunday, 10 May 2015 22:18 (ten years ago)

which isn't to say that it isn't a dumb situation, just that in this instance it didn't end up really happening

J0rdan S., Sunday, 10 May 2015 22:19 (ten years ago)

wldve been extremely easy to double bron there and have one player cover two on the weakside considering the time/inbounding location btw

lag∞n, Sunday, 10 May 2015 22:21 (ten years ago)

tony knows https://twitter.com/aa000g9/status/597524730598412289

J0rdan S., Sunday, 10 May 2015 22:22 (ten years ago)

yup

lag∞n, Sunday, 10 May 2015 22:23 (ten years ago)

refs missing blatt clearly calling timeouts he didn't have adds a nice layer of conspiracy to this game

J0rdan S., Sunday, 10 May 2015 22:30 (ten years ago)

lol blatt my god

lag∞n, Sunday, 10 May 2015 22:32 (ten years ago)

I don't understand how you could argue with jvg. the cavs ran a set after the bulls perfectly burned the cavs remaining time outs.

― Allen (etaeoe), Sunday, May 10, 2015 6:10 PM (20 minutes ago) Bookmark Flag Post Permalink

Oh I'm not arguing and I think we all agree that was dumb and should be fixed

I am just always amused when jvg gets mad about something

juice college (agent hibachi), Sunday, 10 May 2015 22:32 (ten years ago)

is that a T in the NBA?

k3vin k., Sunday, 10 May 2015 22:32 (ten years ago)

refs missing blatt clearly calling timeouts he didn't have adds a nice layer of conspiracy to this game

― J0rdan S., Sunday, May 10, 2015 6:30 PM (1 minute ago) Bookmark Flag Post Permalink

Yeah that was horrible, what happens if the coach does that? I forget

juice college (agent hibachi), Sunday, 10 May 2015 22:33 (ten years ago)

Right I think it's a T, I know I've seen it happen in the last few years

juice college (agent hibachi), Sunday, 10 May 2015 22:34 (ten years ago)

the buzzerbeaters have been great, but they're kinda masking what is otherwise a pretty godawful series

k3vin k., Sunday, 10 May 2015 22:34 (ten years ago)

yeah it was an awful game

lag∞n, Sunday, 10 May 2015 22:35 (ten years ago)

neither team can do offense and half the players are dead

lag∞n, Sunday, 10 May 2015 22:36 (ten years ago)

that game was fun you guys are crazy

J0rdan S., Sunday, 10 May 2015 22:39 (ten years ago)

the offense wasn't great but it was a tight game with some big runs and a bunch of huge shots, dramatic throughout

J0rdan S., Sunday, 10 May 2015 22:40 (ten years ago)

neither team cracked 40% from the field, half the players were limping, idk hard to care too much under those conditions

lag∞n, Sunday, 10 May 2015 22:43 (ten years ago)

lol hugging

https://pbs.twimg.com/media/CErVNlOWYAEImLh.jpg

lag∞n, Sunday, 10 May 2015 22:45 (ten years ago)

neither team cracked 40% from the field, half the players were limping, idk hard to care too much under those conditions

this is insane

J0rdan S., Sunday, 10 May 2015 22:50 (ten years ago)

im sorry i just feel like basketball is better when the teams playing are good

lag∞n, Sunday, 10 May 2015 22:52 (ten years ago)

i mean any game can be intense or have runs, quality basketball would be nice tho

k3vin k., Sunday, 10 May 2015 22:52 (ten years ago)

blatt timeout https://vine.co/v/emDlHMqHb1a

lag∞n, Sunday, 10 May 2015 22:59 (ten years ago)

That's literally the view from the grassy knoll

, Sunday, 10 May 2015 23:08 (ten years ago)

refs missing blatt clearly calling timeouts he didn't have adds a nice layer of conspiracy to this game
--J0rdan S.

idk think it was just a dumb blatt move (one of many) that didn't get noticed

slothroprhymes, Sunday, 10 May 2015 23:13 (ten years ago)

this has def been a fun series but that kind of stems from the inherent parity of two teams not playing their best, rather than them both playing lights out

slothroprhymes, Sunday, 10 May 2015 23:15 (ten years ago)

Cody Westerlund ‏@CodyWesterlund 31s31 seconds ago

LeBron on benefit of free timeout: "To be honest, the play that was drawn up, I scratched it."

Matt Armstrong, Sunday, 10 May 2015 23:16 (ten years ago)

Man he just cannot pass up an opportunity to take a shot at his coach anymore huh

juice college (agent hibachi), Sunday, 10 May 2015 23:17 (ten years ago)

blatt is such a clown

J0rdan S., Sunday, 10 May 2015 23:17 (ten years ago)

if LeBron wasn't so weird and crazy I'd dislike him

Matt Armstrong, Sunday, 10 May 2015 23:18 (ten years ago)

as an aside, the league needs to stop this bullshit with coaches waltzing onto the court for timeouts. It's shameless grandstanding most of the time anyway.

Matt Armstrong, Sunday, 10 May 2015 23:19 (ten years ago)

"quality basketball"

J0rdan S., Sunday, 10 May 2015 23:20 (ten years ago)

I watch about 100000 NBA games a year and this game was def. in the top 10%

Matt Armstrong, Sunday, 10 May 2015 23:21 (ten years ago)

dude come on you watch basketball you know what i'm talking about. the drama is great but two teams failing to hit 40% of their shots leaves a lot to be desired xp

k3vin k., Sunday, 10 May 2015 23:21 (ten years ago)

you're making up an arbitrary stat that defines whether a game was good

J0rdan S., Sunday, 10 May 2015 23:23 (ten years ago)

come on

k3vin k., Sunday, 10 May 2015 23:23 (ten years ago)

you're being willfully dense

k3vin k., Sunday, 10 May 2015 23:23 (ten years ago)

i was def way less excited by the game tying game winning sequence because both teams played so poorly there were long stretches where neither of them could really dribble let alone shoot thats my experience and i demand you respect it also derrick rose takes comically terrible shots constantly

lag∞n, Sunday, 10 May 2015 23:24 (ten years ago)

i mean most of that game was objectly bad basketball

lag∞n, Sunday, 10 May 2015 23:24 (ten years ago)

i mean it's one thing if it's a true defensive struggle, like maybe the pacers/heat playoff games. but neither of these teams is exactly great on defense. it was just bad offense

k3vin k., Sunday, 10 May 2015 23:26 (ten years ago)

i'm not being dense i just have a capacity to enjoy a basketball game in which both teams may or may not shoot 40%

J0rdan S., Sunday, 10 May 2015 23:26 (ten years ago)

"shooting 40%" is obv a surrogate for "bad offense"

k3vin k., Sunday, 10 May 2015 23:28 (ten years ago)

the offense was very bad its true

lag∞n, Sunday, 10 May 2015 23:28 (ten years ago)

you guys should be forced to watch replays of the rockets-mavs series for the next month

J0rdan S., Sunday, 10 May 2015 23:30 (ten years ago)

no one enjoyed that series either. the first round was mostly very bad

k3vin k., Sunday, 10 May 2015 23:31 (ten years ago)

we all agreed the first round was bad except for the spurs-clips instant classic

lag∞n, Sunday, 10 May 2015 23:32 (ten years ago)

it was a fun game, there were also egregiously bad stretches of offense - especially those two bulls droughts

I would still hazard a guess that rockets clippers will end up be a worse game and not just because the rox will almost without a doubt play like garbage

slothroprhymes, Sunday, 10 May 2015 23:32 (ten years ago)

too many injuries in bulls-cavs both teams are totally off kilter

lag∞n, Sunday, 10 May 2015 23:33 (ten years ago)

*being, jeez

slothroprhymes, Sunday, 10 May 2015 23:33 (ten years ago)

also derrick rose takes comically terrible shots constantly

― lag∞n, Sunday, May 10, 2015 11:24 PM (8 minutes ago) Bookmark Flag Post Permalink

he does it with humility and grit. Not like that little fucker Isaiah Thomas (who makes more of them)

Matt Armstrong, Sunday, 10 May 2015 23:34 (ten years ago)

there was one towards the end of the fourth where he pulled up early in the clock for a long contested three that was totally flat and bricked off the front rim that was just like wow why does he do that

lag∞n, Sunday, 10 May 2015 23:36 (ten years ago)

it was a jr smith type shot except smith is at least a much better shooter and known lunatic

lag∞n, Sunday, 10 May 2015 23:37 (ten years ago)

games with bad offense can still be fun!!! open your minds

J0rdan S., Sunday, 10 May 2015 23:38 (ten years ago)

im willing to acknowledge the possibility tho i did not find this game fun

lag∞n, Sunday, 10 May 2015 23:39 (ten years ago)

its just frustrating and lame when the teams play basketball bad is how i break it down

lag∞n, Sunday, 10 May 2015 23:39 (ten years ago)

the bad version of that game was every bulls playoff game without rose because you knew they had no chance of making any real noise in the playoffs so they were boring to no end

but if you can't enjoy a bron dogfight vs the bulls with real shit on the line i feel bad for you son

J0rdan S., Sunday, 10 May 2015 23:45 (ten years ago)

Rose is the only healthy PG in the NBA rn

polyphonic, Sunday, 10 May 2015 23:46 (ten years ago)

but if you can't enjoy a bron dogfight vs the bulls with real shit on the line i feel bad for you son

― J0rdan S., Sunday, May 10, 2015 7:45 PM (28 seconds ago) Bookmark Flag Post Permalink

i feel the same way abt yr cp3 loathing (he is actually good at basketball btw)

lag∞n, Sunday, 10 May 2015 23:47 (ten years ago)

also that game was not really a dog fight, more of a clown car

lag∞n, Sunday, 10 May 2015 23:47 (ten years ago)

there was one towards the end of the fourth where he pulled up early in the clock for a long contested three that was totally flat and bricked off the front rim that was just like wow why does he do that

― lag∞n, Sunday, May 10, 2015 11:36 PM (11 minutes ago) Bookmark Flag Post Permalink

because he's a selfish moron with a tough, no-nonsense coach who mysteriously can't stand up to a player who actually does something wrong.

Matt Armstrong, Sunday, 10 May 2015 23:49 (ten years ago)

and like is "real shit on the line" really, the east is drawing dead prob has something to do with it being hard to get too excited abt this series

lag∞n, Sunday, 10 May 2015 23:51 (ten years ago)

As a cbball fan, I'm ok with teams shooting less than 40%.

Jeff, Sunday, 10 May 2015 23:51 (ten years ago)

tho tbh i am curious who will climb to the top of the trash heap

lag∞n, Sunday, 10 May 2015 23:52 (ten years ago)

rose 3 pointer thing reminds me that the only guy who solved the riddle of how to get Baron Davis to stop shooting 3s was.... Donald Sterling

Matt Armstrong, Sunday, 10 May 2015 23:52 (ten years ago)

also derrick rose takes comically terrible shots constantly

― lag∞n, Sunday, May 10, 2015 11:24 PM (8 minutes ago) Bookmark Flag Post Permalink

he does it with humility and grit. Not like that little fucker Isaiah Thomas (who makes more of them)
--Matt Armstrong

shut yr fuckin pie hole about it2

slothroprhymes, Sunday, 10 May 2015 23:53 (ten years ago)

p sure that was a pro thomas post

lag∞n, Sunday, 10 May 2015 23:54 (ten years ago)

As a cbball fan, I'm ok with teams shooting less than 40%.

― Jeff, Sunday, May 10, 2015 7:51 PM (2 minutes ago) Bookmark Flag Post Permalink

game was about as collegesque as the pros get

lag∞n, Sunday, 10 May 2015 23:55 (ten years ago)

Rose is the only healthy PG in the NBA rn

― polyphonic, Sunday, May 10, 2015 7:46 PM (6 minutes ago) Bookmark Flag Post Permalink

Sad lol

juice college (agent hibachi), Sunday, 10 May 2015 23:55 (ten years ago)

can't even risk the possibility xxp

slothroprhymes, Sunday, 10 May 2015 23:56 (ten years ago)

mozgov for tsar

brownie, Sunday, 10 May 2015 23:56 (ten years ago)

rose 3 pointer thing reminds me that the only guy who solved the riddle of how to get Baron Davis to stop shooting 3s was.... Donald Sterling

― Matt Armstrong, Sunday, May 10, 2015 7:52 PM (5 minutes ago) Bookmark Flag Post Permalink

have a feeling rose wld prob be susceptible to sustained public ridicule from his boss

lag∞n, Sunday, 10 May 2015 23:59 (ten years ago)

rose takes some selfish shots but with pau out he's only ever playing with max one player who has a chance in hell of creating a shot

J0rdan S., Monday, 11 May 2015 00:01 (ten years ago)

w kyrie hobbled might not be a bad idea to goto the rose/brooks backcourt more

lag∞n, Monday, 11 May 2015 00:03 (ten years ago)

btw i don't dislike watching chris paul play (let's dig up some ILH posts from hornets-lakers first round). i just don't like him.

J0rdan S., Monday, 11 May 2015 00:03 (ten years ago)

omg u said u liked watching the clippers more w/o him in this very thread!

lag∞n, Monday, 11 May 2015 00:04 (ten years ago)

thru the lens of me wanting to root for them

J0rdan S., Monday, 11 May 2015 00:07 (ten years ago)

Kenny Smith and Charles Barkley struggling to figure out why a team that went from Pat Beverley to Jason Terry as starting pg is having defensive issues

Matt Armstrong, Monday, 11 May 2015 00:07 (ten years ago)

i want the clippers to win begrudgingly bcuz clips-warriors is the best possible west finals and i thought their no-cp underdog vibe was fun which made it easier to root for them

J0rdan S., Monday, 11 May 2015 00:08 (ten years ago)

thru the lens of me wanting to root for them

― J0rdan S., Sunday, May 10, 2015 8:07 PM (50 seconds ago) Bookmark Flag Post Permalink

u shd see the skeptical face im making at this post

lag∞n, Monday, 11 May 2015 00:08 (ten years ago)

: D

J0rdan S., Monday, 11 May 2015 00:15 (ten years ago)

blatt should quit man https://twitter.com/mcten/status/597552813745545216

J0rdan S., Monday, 11 May 2015 00:15 (ten years ago)

rose takes some selfish shots but with pau out he's only ever playing with max one player who has a chance in hell of creating a shot

― J0rdan S., Monday, May 11, 2015 12:01 AM (6 minutes ago) Bookmark Flag Post Permalink

he takes a LOT of bad, dumb 3 pointers that would be called "selfish" if he hadn't been sanctified by the media for whatever fucking reason

http://bkref.com/tiny/XKGU7

Matt Armstrong, Monday, 11 May 2015 00:17 (ten years ago)

it would seem coaching international ball does not in fact prepare you for the NBA, least not by default

slothroprhymes, Monday, 11 May 2015 00:18 (ten years ago)

lol matt if you can't understand why rose is viewed the way he is in spite of the flaws he clearly has I dunno man it seems obvious

slothroprhymes, Monday, 11 May 2015 00:19 (ten years ago)

what is it. What is the great thing about Derrick Rose

Matt Armstrong, Monday, 11 May 2015 00:20 (ten years ago)

did he rescue a family from a fire

Matt Armstrong, Monday, 11 May 2015 00:20 (ten years ago)

chris paul is everything right in the world

― J0rdan S., Sunday, April 17, 2011 6:00 PM (4 years ago) Bookmark Flag Post Permalink

k3vin k., Monday, 11 May 2015 00:20 (ten years ago)

what a time

J0rdan S., Monday, 11 May 2015 00:21 (ten years ago)

my life really went downhill that year, I think I started posting on here too

Matt Armstrong, Monday, 11 May 2015 00:22 (ten years ago)

I'm not even going to say he's great because Iiterally I just said he had clear flaws, he has all the #narrative and native son of the city stuff behind him that the media obviously eats up, if that stuff annoys you, ok, but it's pretty obvious why he gets put on a pedestal and pretending not to understand that seems deliberately obtuse

slothroprhymes, Monday, 11 May 2015 00:22 (ten years ago)

he's put on a pedestal because he's from Chicago? That's it?

Matt Armstrong, Monday, 11 May 2015 00:23 (ten years ago)

Stephon Marbury was from Coney Island

Matt Armstrong, Monday, 11 May 2015 00:23 (ten years ago)

obviously there's some reasons they treat him like a basketball angel but they can't be good reasons

Matt Armstrong, Monday, 11 May 2015 00:24 (ten years ago)

ohhhhh myyyyy gooddddd you're trolling, you have to be, this is like when people would say they didn't understand why jeter was as huge as he was because jeter kinda sucked in various ways (which he did)

slothroprhymes, Monday, 11 May 2015 00:25 (ten years ago)

in jordan's defense as incredible as chris paul is, Young chris paul was even better. watching some old highlights now, and man

the clippers environment def has something to do with the perception of him too

k3vin k., Monday, 11 May 2015 00:26 (ten years ago)

still wonder what lakers cp3 would've been like, maybe they never run into their 2012/13 wall

thank god that didn't happen

slothroprhymes, Monday, 11 May 2015 00:32 (ten years ago)

rereading that 2011 thread is a blast. fun times

k3vin k., Monday, 11 May 2015 00:37 (ten years ago)

whoa howard is pretty lucky it's the playoffs or he might have been ejected for that

k3vin k., Monday, 11 May 2015 00:39 (ten years ago)

Haha Barnes was like one crack away from getting Dwight ejected in less than four minutes

juice college (agent hibachi), Monday, 11 May 2015 00:39 (ten years ago)

yo dwight just pushed that ref away twice!

lag∞n, Monday, 11 May 2015 00:39 (ten years ago)

ikr

k3vin k., Monday, 11 May 2015 00:40 (ten years ago)

hackajordan part 4: it begins

slothroprhymes, Monday, 11 May 2015 00:41 (ten years ago)

o good the hacka starts early

lag∞n, Monday, 11 May 2015 00:41 (ten years ago)

:|

slothroprhymes, Monday, 11 May 2015 00:42 (ten years ago)

clips letting ariza take any shot he wants is p funny

lag∞n, Monday, 11 May 2015 00:43 (ten years ago)

cp3 looking much more mobile

lag∞n, Monday, 11 May 2015 00:45 (ten years ago)

what is it. What is the great thing about Derrick Rose

― Matt Armstrong, Sunday, May 10, 2015 8:20 PM (24 minutes ago) Bookmark Flag Post Permalink

I frankly don't really get the Cult of Rose either, but I think swooping in and getting the MVP Karl Malone style in the year that Lebron was the big bad villain for having gone to Miami is still a big part of it for old out of touch (white) sportswriters

juice college (agent hibachi), Monday, 11 May 2015 00:47 (ten years ago)

can't wait for the massive cheers austin will receive when he goes in for the first time

which will prob be followed by a pratfall

slothroprhymes, Monday, 11 May 2015 00:47 (ten years ago)

xp the out of touch white sportswriters don't like rose much though

slothroprhymes, Monday, 11 May 2015 00:48 (ten years ago)

i think a lot of it is just that nobody knows how to evaluate a player of rose's caliber coming back from the injuries he's had

J0rdan S., Monday, 11 May 2015 00:50 (ten years ago)

Ok I'm fine with the hack strategy but man does it threaten to turn these games into sox-yanks 4 hour jerkfests

juice college (agent hibachi), Monday, 11 May 2015 00:52 (ten years ago)

the only reason i can think for rose getting the treatment he gets is the weird solemnity with which he carries himself, like he never looks like he's enjoying anything so he must be "important"

call all destroyer, Monday, 11 May 2015 00:52 (ten years ago)

poor Austin's dunk doesn't count

slothroprhymes, Monday, 11 May 2015 00:56 (ten years ago)

lol kept going despite like 3 dudes tapping jordan repeatedly

slothroprhymes, Monday, 11 May 2015 00:56 (ten years ago)

hawse sighting

lag∞n, Monday, 11 May 2015 01:00 (ten years ago)

Still can't get used to idea of Blake as point forward no matter how many times he dribbled behind the back

, Monday, 11 May 2015 01:01 (ten years ago)

Hawes needs some tattoos.

Jeff, Monday, 11 May 2015 01:14 (ten years ago)

i do wonder if rose's lack of development can be tied to the injuries or would have been the case anyway. seems like so many sportswriters/whoever were looking for signs of the old rose or bemoaning what could've been, they weren't noticing the lack of development or if they were it was tangentially, another wrinkle to the late great derrick rose narrative. contrast to the speculation around blake griffin who came in the league two years later really (drafted a year later but missed rookie season) and the nitpicking until recently about him not taking his game to another level. ie if rose turns into marbury or steve francis or insert name here it's gonna get chalked up to the tragedy of derrick rose but isn't it possible this is close to the player he would've been anyway?

balls, Monday, 11 May 2015 01:15 (ten years ago)

yeah possible tho obvs w an accelerated athletic decline

lag∞n, Monday, 11 May 2015 01:18 (ten years ago)

xp oh for sure, one part imo is that the bulls never asked him to do anything other than carry their entire offense in a v. inefficient fashion and the other part is that rose doesn't act like marbury or francis and dumbass sportswriters think all those guys are of the same easily-identified type

call all destroyer, Monday, 11 May 2015 01:19 (ten years ago)

the austin rivers thing is getting a little out of control

k3vin k., Monday, 11 May 2015 01:21 (ten years ago)

ok that austin crossover was pretty legit

slothroprhymes, Monday, 11 May 2015 01:21 (ten years ago)

Uh so Austin rivers guys

juice college (agent hibachi), Monday, 11 May 2015 01:21 (ten years ago)

Taking over.

Jeff, Monday, 11 May 2015 01:22 (ten years ago)

I may be saying that bc he was pratfalling on a fast break 2 games ago and it's like grading on a curve but still

slothroprhymes, Monday, 11 May 2015 01:23 (ten years ago)

watching austin rivers for clues on how to get ppl to celebrate u every time u do one lil thing competently

lag∞n, Monday, 11 May 2015 01:28 (ten years ago)

So many fouls...

schwantz, Monday, 11 May 2015 01:29 (ten years ago)

watching austin rivers for clues on how to get ppl to celebrate u every time u do one lil thing competently
--lag∞n

we are all austin rivers

slothroprhymes, Monday, 11 May 2015 01:29 (ten years ago)

Hack a dj really works they're gonna be tied by halftime

, Monday, 11 May 2015 01:34 (ten years ago)

wow i didn't realize shaq took 25 FTs in a QUARTER once

k3vin k., Monday, 11 May 2015 01:41 (ten years ago)

hahahaha brewer

k3vin k., Monday, 11 May 2015 01:43 (ten years ago)

Brewer 😭😭😭

, Monday, 11 May 2015 01:44 (ten years ago)

this is just sadistic

slothroprhymes, Monday, 11 May 2015 01:44 (ten years ago)

Show that Blake crossover again plz

, Monday, 11 May 2015 01:48 (ten years ago)

I don't think redick actually knows how to shoot

, Monday, 11 May 2015 01:50 (ten years ago)

jordan staying in the backcourt three straight possessions

lag∞n, Monday, 11 May 2015 01:51 (ten years ago)

houston playing scrubs to hack jordan prob counter productive

lag∞n, Monday, 11 May 2015 01:53 (ten years ago)

lol shaq taking this hacka stuff personal

lag∞n, Monday, 11 May 2015 02:08 (ten years ago)

Roy Orbison wrapped in clingfilm

, Monday, 11 May 2015 02:10 (ten years ago)

i think i'm done with inside it is just a straight up bad watch these days

Clay, Monday, 11 May 2015 02:13 (ten years ago)

yea man not worth it even with EJ still being awesome

slothroprhymes, Monday, 11 May 2015 02:18 (ten years ago)

maybe if they swapped shaq for c-webb?

slothroprhymes, Monday, 11 May 2015 02:19 (ten years ago)

rockets need to hack more jordan its their only hope

lag∞n, Monday, 11 May 2015 02:19 (ten years ago)

lots of people really love shaq i guess, like there has to be a reason they let him run roughshod over what was once an untouchable institution

Clay, Monday, 11 May 2015 02:21 (ten years ago)

prob just someones bad idea

lag∞n, Monday, 11 May 2015 02:23 (ten years ago)

man that's a weak T

k3vin k., Monday, 11 May 2015 02:26 (ten years ago)

lmao blake grabbed him on the way down!

lag∞n, Monday, 11 May 2015 02:26 (ten years ago)

mchale waiting til theyre down 20 to call a timeout... its too late man

lag∞n, Monday, 11 May 2015 02:30 (ten years ago)

Sick pass by blake

, Monday, 11 May 2015 02:30 (ten years ago)

shdve kept hacking

lag∞n, Monday, 11 May 2015 02:30 (ten years ago)

my favorite player is austin rivers

Clay, Monday, 11 May 2015 02:35 (ten years ago)

adios dwight

k3vin k., Monday, 11 May 2015 02:38 (ten years ago)

take pity upon dwight and eject him from the earth

lag∞n, Monday, 11 May 2015 02:40 (ten years ago)

lol they did

lag∞n, Monday, 11 May 2015 03:02 (ten years ago)

paul and griffin REALLY do not need to be in this game

k3vin k., Monday, 11 May 2015 03:04 (ten years ago)

doc needs to clear the bench what the heck

lag∞n, Monday, 11 May 2015 03:04 (ten years ago)

lol xp

lag∞n, Monday, 11 May 2015 03:04 (ten years ago)

average margin of victory for the clips since paul came back is a million zillion

lag∞n, Monday, 11 May 2015 03:14 (ten years ago)

chris paul is a good basketball player

k3vin k., Monday, 11 May 2015 03:16 (ten years ago)

laying points on the clippers has been the easiest money this playoffs by far

k3vin k., Monday, 11 May 2015 03:30 (ten years ago)

chuck and kenny both know what furries are and they wldnt tell shaq

lag∞n, Monday, 11 May 2015 04:32 (ten years ago)

my favorite player is austin rivers
--Clay

austin rivers is legit like benji in the sound & the fury/representing all humanity

slothroprhymes, Monday, 11 May 2015 04:46 (ten years ago)

I'm so nervous about tomorrows game :/

#wegonnabechampionship (Spottie), Monday, 11 May 2015 05:36 (ten years ago)

I am too!

Clay, Monday, 11 May 2015 05:57 (ten years ago)

https://vine.co/v/emIQtuzb0DV

lag∞n, Monday, 11 May 2015 13:59 (ten years ago)

https://pbs.twimg.com/media/CEuzS0TWoAA9g3t.jpg

lag∞n, Monday, 11 May 2015 14:23 (ten years ago)

when the other team is psyched to destroy u psychologically http://probasketballtalk.nbcsports.com/2015/05/11/chris-paul-reportedly-lobbied-for-referees-not-to-eject-dwight-howard

lag∞n, Monday, 11 May 2015 14:31 (ten years ago)

lol what a dick
https://www.youtube.com/watch?v=EXa8CwbCIOU

"To be honest, the play that was drawn up, I scratched it," James said after the game. "I told coach to give me the ball ... we were either going to overtime or I was going to win it for us. It was that simple."

“audience participation” otherwise known as “touching” (forksclovetofu), Monday, 11 May 2015 14:33 (ten years ago)

throwing your coach under the bus at your conference semi-finals press conference is pretty next level but to do it when you're winning

“audience participation” otherwise known as “touching” (forksclovetofu), Monday, 11 May 2015 14:35 (ten years ago)

hope Blatt drew up a play giving LeBron the ball before LeBron dumped a Sprite LeBron's mix over the whiteboard saying "give me the ball"

Sufjan Grafton, Monday, 11 May 2015 15:03 (ten years ago)

basically hope LeBron is secretly a Will Forte character

Sufjan Grafton, Monday, 11 May 2015 15:03 (ten years ago)

prob what happened tbh

lag∞n, Monday, 11 May 2015 15:04 (ten years ago)

i will say, in blatt's defense, that if he was drawing up a play for JR, considering how well he's been shooting this series, it wouldn't have been the stupidest thing in the world

J0rdan S., Monday, 11 May 2015 15:05 (ten years ago)

especially because bron shot like 35% in that game

J0rdan S., Monday, 11 May 2015 15:05 (ten years ago)

was thinking is bron the streakiest shooter in the league, like sometimes he cant miss looks like ray allen then other times hes nowhere close its weird, a lot of his misses are just total bricks too and his form is not the smoothest

lag∞n, Monday, 11 May 2015 15:09 (ten years ago)

btw just noticed in his google+ profile pic he is playing the violin lol

http://i.imgur.com/kJsoKOn.png

lag∞n, Monday, 11 May 2015 15:11 (ten years ago)

in theory they could win the championship and blatt could get fired

call all destroyer, Monday, 11 May 2015 15:14 (ten years ago)

wonder who brons coach of choice is

lag∞n, Monday, 11 May 2015 15:15 (ten years ago)

lmao

lag∞n, Monday, 11 May 2015 15:17 (ten years ago)

no looking: who leads the NBA in assists so far this playoffs?

k3vin k., Monday, 11 May 2015 15:19 (ten years ago)

gonna guess cp3

slothroprhymes, Monday, 11 May 2015 15:20 (ten years ago)

(did not look)

slothroprhymes, Monday, 11 May 2015 15:20 (ten years ago)

blake griffin

k3vin k., Monday, 11 May 2015 15:21 (ten years ago)

tbf that's total assists, wall has almost twice as many ast/g but has played fewer games. but still!

k3vin k., Monday, 11 May 2015 15:23 (ten years ago)

blake is good

lag∞n, Monday, 11 May 2015 15:30 (ten years ago)

well rounded player

lag∞n, Monday, 11 May 2015 15:31 (ten years ago)

he plays what you could call quality basketball

slothroprhymes, Monday, 11 May 2015 15:31 (ten years ago)

still way too careless w the ball sometimes tho

lag∞n, Monday, 11 May 2015 15:31 (ten years ago)

lol @ bron, assman

call all destroyer, Monday, 11 May 2015 15:45 (ten years ago)

normally i'd call bron an ass for doing that shit to Blatt but... eh? it probably happens all the time already

Nhex, Monday, 11 May 2015 16:09 (ten years ago)

bron has certainly made it clear that it happens all the time

lag∞n, Monday, 11 May 2015 16:12 (ten years ago)

https://instagram.com/p/2jO4yiwC1a/

polyphonic, Monday, 11 May 2015 17:49 (ten years ago)

are those like all memes

lag∞n, Monday, 11 May 2015 17:49 (ten years ago)

the girls need a better work ethic

Nhex, Monday, 11 May 2015 17:53 (ten years ago)

kyrie has tendinitis in his left knee

slothroprhymes, Monday, 11 May 2015 18:17 (ten years ago)

https://pbs.twimg.com/media/CEv0j9OVAAAVAby.jpg

polyphonic, Monday, 11 May 2015 19:11 (ten years ago)

- David Blatt

polyphonic, Monday, 11 May 2015 19:12 (ten years ago)

lol

lag∞n, Monday, 11 May 2015 19:12 (ten years ago)

bob marley, surely

“audience participation” otherwise known as “touching” (forksclovetofu), Monday, 11 May 2015 19:18 (ten years ago)

http://i.imgur.com/CSqTfeA.gif

moullet, Monday, 11 May 2015 19:33 (ten years ago)

lol otm

“audience participation” otherwise known as “touching” (forksclovetofu), Monday, 11 May 2015 19:35 (ten years ago)

https://vine.co/v/emDgErZEEDV

😂 (am0n), Monday, 11 May 2015 22:33 (ten years ago)

james harden welcome to playoffs

http://streamable.com/4ite

(he has actually been good and p in line with the regular season but lol still)

lag∞n, Monday, 11 May 2015 23:00 (ten years ago)

feel like maybe the clips are doing a good job of not over helping on him tho even as hes putting up numbers it doesnt feel like hes dominating at all

lag∞n, Monday, 11 May 2015 23:02 (ten years ago)

Harden always struggles vs. the clips

Matt Armstrong, Monday, 11 May 2015 23:52 (ten years ago)

That sideline report from David Aldridge about Millsap expanding his game in Atlanta was total fucking bullshit

Matt Armstrong, Monday, 11 May 2015 23:53 (ten years ago)

http://i.imgur.com/z0oJ89U.png

That last line *am0n face*

, Monday, 11 May 2015 23:56 (ten years ago)

http://i.imgur.com/lGaOSOj.jpg

, Monday, 11 May 2015 23:58 (ten years ago)

This is kinda like the revelation that Derek Jeter had the most vanilla sex life in the world

, Monday, 11 May 2015 23:58 (ten years ago)

was prob a tap from his his assistant who thought he was logged into his own account tbf

lag∞n, Tuesday, 12 May 2015 00:02 (ten years ago)

was prob a tap from his his assistant who thought he was logged into his own account tbf

Mr. Snrub, please confirm.

Madison Dumbbarfer (Leee), Tuesday, 12 May 2015 00:03 (ten years ago)

lol

lag∞n, Tuesday, 12 May 2015 00:03 (ten years ago)

I like fuck it all mode Lebron

juice college (agent hibachi), Tuesday, 12 May 2015 00:25 (ten years ago)

feel like maybe the clips are doing a good job of not over helping on him tho even as hes putting up numbers it doesnt feel like hes dominating at all

― lag∞n, Monday, May 11, 2015 7:02 PM (1 hour ago) Bookmark Flag Post Permalink

Otm I seriously have to keep reminding myself that he's out there

Blake otoh just has his fingerprints on every minute he plays right now

juice college (agent hibachi), Tuesday, 12 May 2015 00:27 (ten years ago)

teague being relentless, I can dig it

slothroprhymes, Tuesday, 12 May 2015 01:05 (ten years ago)

This is kinda like the revelation that Derek Jeter had the most vanilla sex life in the world

― 龜, Monday, May 11, 2015 11:58 PM (Yesterday) Bookmark Flag Post Permalink

idk, isn't he super into rimjobs? just receiving, but still not totally vanilla.

Matt Armstrong, Tuesday, 12 May 2015 01:17 (ten years ago)

I'm getting close to rooting against the hawks with all this "player development program" talk

Matt Armstrong, Tuesday, 12 May 2015 01:20 (ten years ago)

teeeeeeeaaaaaaaaaagggggguuuuuuuuueeeeee

Heez, Tuesday, 12 May 2015 01:21 (ten years ago)

walls jacket is outrageous

lag∞n, Tuesday, 12 May 2015 01:22 (ten years ago)

beal now huh everyone gonna be dead by the end of these playoffs

lag∞n, Tuesday, 12 May 2015 01:25 (ten years ago)

east representative just gon be paul pierce and nene

lag∞n, Tuesday, 12 May 2015 01:25 (ten years ago)

omfgggg hawks just remember how to bury a game jeez

slothroprhymes, Tuesday, 12 May 2015 01:26 (ten years ago)

act like you been here before!

slothroprhymes, Tuesday, 12 May 2015 01:27 (ten years ago)

idk, isn't he super into rimjobs? just receiving, but still not totally vanilla.

― Matt Armstrong, Monday, May 11, 2015 9:17 PM (8 minutes ago) Bookmark

BAsing my judgment off that anonymous 'what are your hopes, what are your dreams" post

, Tuesday, 12 May 2015 01:27 (ten years ago)

that pass by pierce was ice cold he dgaf

lag∞n, Tuesday, 12 May 2015 01:27 (ten years ago)

Also haven't you haerd, in 2015 you gotta eat the booty like groceries

, Tuesday, 12 May 2015 01:27 (ten years ago)

omg paul u had such a good look!

lag∞n, Tuesday, 12 May 2015 01:28 (ten years ago)

he was just standing there for like 10 mins

lag∞n, Tuesday, 12 May 2015 01:28 (ten years ago)

i jinxed him (am rooting for atl tho :)

lag∞n, Tuesday, 12 May 2015 01:28 (ten years ago)

aw, thought that pierce 3 was good for sure

Clay, Tuesday, 12 May 2015 01:28 (ten years ago)

I think Pierce should have gotten 3 FTs there?

Matt Armstrong, Tuesday, 12 May 2015 01:29 (ten years ago)

yea I'm shocked that didn't go in

slothroprhymes, Tuesday, 12 May 2015 01:29 (ten years ago)

lol i am rooting for atlanta too but i guess my ilh roots have me rooting for pierce to do the godly shit when the moment comes

Clay, Tuesday, 12 May 2015 01:29 (ten years ago)

I think Pierce should have gotten 3 FTs there?

― Matt Armstrong, Monday, May 11, 2015 9:29 PM (40 seconds ago) Bookmark Flag Post Permalink

def fouled on the way down after the release, cn understand the refs not calling it

lag∞n, Tuesday, 12 May 2015 01:30 (ten years ago)

only not rooting for pierce bc the wiz were so rotten to watch for such long stretches but it still makes me joyous to see him do crazy shit

slothroprhymes, Tuesday, 12 May 2015 01:31 (ten years ago)

if the dubs dont come out and stomp all over mem tonight i might start to lose faith in them

lag∞n, Tuesday, 12 May 2015 01:31 (ten years ago)

I think Pierce should have gotten 3 FTs there?

― Matt Armstrong, Monday, May 11, 2015 9:29 PM (26 seconds ago) Bookmark Flag Post Permalink

I think they let it go m/l bc nene threw Carroll onto the floor and slid

juice college (agent hibachi), Tuesday, 12 May 2015 01:31 (ten years ago)

dubs gotta do the right thing now and tie up all four series at 2-2

Clay, Tuesday, 12 May 2015 01:32 (ten years ago)

ya nene fouled the hell out of carroll on the "screen"

lag∞n, Tuesday, 12 May 2015 01:33 (ten years ago)

Heard Korver traveled *waits patiently for vine *

, Tuesday, 12 May 2015 01:41 (ten years ago)

god bless u griz but theres a reason tony allen is open in the corner

lag∞n, Tuesday, 12 May 2015 01:48 (ten years ago)

This crowd sounds loud

, Tuesday, 12 May 2015 01:48 (ten years ago)

they loud

lag∞n, Tuesday, 12 May 2015 01:49 (ten years ago)

+ gritty

lag∞n, Tuesday, 12 May 2015 01:49 (ten years ago)

Frizz think they're the dubs it's cute

, Tuesday, 12 May 2015 01:50 (ten years ago)

both teams r geeked the f up rn

lag∞n, Tuesday, 12 May 2015 01:51 (ten years ago)

Tony Allen took 29 threes in the 2014-15 regular season

Matt Armstrong, Tuesday, 12 May 2015 01:53 (ten years ago)

this is definitely the best series

slothroprhymes, Tuesday, 12 May 2015 01:54 (ten years ago)

This crowd sounds loud

― 龜, Monday, May 11, 2015 6:48 PM (7 minutes ago) Bookmark Flag Post Permalink

game 3 the crowd was so loud it was kinda fucking with the mic levels for the announcers a lil

Clay, Tuesday, 12 May 2015 01:57 (ten years ago)

conley just shook the hell out of steph

lag∞n, Tuesday, 12 May 2015 01:57 (ten years ago)

Conley closest to the rip Hamilton face mask ideal

, Tuesday, 12 May 2015 01:58 (ten years ago)

griz prob p comfortable with green and barnes taking every shot

lag∞n, Tuesday, 12 May 2015 02:04 (ten years ago)

Sparely!!!

, Tuesday, 12 May 2015 02:07 (ten years ago)

Sorry that was supposed to be steph

, Tuesday, 12 May 2015 02:07 (ten years ago)

loll

lag∞n, Tuesday, 12 May 2015 02:07 (ten years ago)

griz need to chill

lag∞n, Tuesday, 12 May 2015 02:07 (ten years ago)

you've gotta call that foul on Iguodala, that was like an open field tackle

Matt Armstrong, Tuesday, 12 May 2015 02:08 (ten years ago)

damn steph

k3vin k., Tuesday, 12 May 2015 02:08 (ten years ago)

its a good thing that stephs missed open court dunk somehow rolled in cause he wldve had to retire

lag∞n, Tuesday, 12 May 2015 02:09 (ten years ago)

which is pretty much unprecedented for an mvp winner in the middle of the playoffs iirc

lag∞n, Tuesday, 12 May 2015 02:09 (ten years ago)

lol yeah that was p funny

k3vin k., Tuesday, 12 May 2015 02:10 (ten years ago)

whoever wins tonight wins the series bank it

lag∞n, Tuesday, 12 May 2015 02:11 (ten years ago)

my god grix cant buy a shot

lag∞n, Tuesday, 12 May 2015 02:12 (ten years ago)

hey david lee is playing

lag∞n, Tuesday, 12 May 2015 02:16 (ten years ago)

i rly dont like this neil patrick harris heineken commercial where he is like "we'll give you your money back, uh heineken will give you your money back, who knows but someone will give u some cash homie" like i feel like really fake forced awkwardness-as-humor is well past the sell-by date

Clay, Tuesday, 12 May 2015 02:18 (ten years ago)

it makes me angry how bad that commercial is! everything is bad about it!

Clay, Tuesday, 12 May 2015 02:18 (ten years ago)

don't tell blog writers and aspiring sitcom scribes that it will shatter their world

slothroprhymes, Tuesday, 12 May 2015 02:19 (ten years ago)

yeah poor commercial

k3vin k., Tuesday, 12 May 2015 02:20 (ten years ago)

yeah they couldve at least rehearsed it and gone over the basic rules of the deal before they started filming

lag∞n, Tuesday, 12 May 2015 02:20 (ten years ago)

rough year for doogs in general

balls, Tuesday, 12 May 2015 02:21 (ten years ago)

he really peaked early when he was a child doctor

lag∞n, Tuesday, 12 May 2015 02:22 (ten years ago)

christ whats next livingston hitting threes

lag∞n, Tuesday, 12 May 2015 02:23 (ten years ago)

on one hand it's cool that a big national beer company is using a non-straight as its big celeb icon, otoh they let a high school sophomore write the ad between composing texts about how there is just too much drama right now lol

Clay, Tuesday, 12 May 2015 02:23 (ten years ago)

i accidentally watched the series finale of doogie howser a few months back one night. his hair was dyed black and he gave up medicine to move to italy w/ vinnie and become an actor.

balls, Tuesday, 12 May 2015 02:24 (ten years ago)

wut srs

lag∞n, Tuesday, 12 May 2015 02:25 (ten years ago)

that's kinda heavy to me idk why

Clay, Tuesday, 12 May 2015 02:26 (ten years ago)

always knew that piece of shit vinnie was a bad influence

lag∞n, Tuesday, 12 May 2015 02:27 (ten years ago)

oh wait i know why it's cuz my dad made me dress up like doogie one year for halloween bc he was super transparent like that (he bought me HARVARD sweatshirts for my birthday every year) and when i never became a doctor he was probably v disappointed so it is like seeing what happened in some weird alternate projection of my life, thx doc, carry on xp

Clay, Tuesday, 12 May 2015 02:27 (ten years ago)

maybe i should go to med school

Clay, Tuesday, 12 May 2015 02:28 (ten years ago)

doogie what have we become

Clay, Tuesday, 12 May 2015 02:28 (ten years ago)

yeah seriously. i'd just gotten in and was in a stupor and after ten minutes was like 'wait - is this the last doogie howser?', i think there was even a scene where after his goodbye party a rush comes in and he's watching the doctors and nurses scurrying around and is like 'this is not my life anymore'.

balls, Tuesday, 12 May 2015 02:29 (ten years ago)

clay come to med school with me i'm gonna be all stressed out and i need someone to watch hoops w/

k3vin k., Tuesday, 12 May 2015 02:29 (ten years ago)

haha curry flushes this one

k3vin k., Tuesday, 12 May 2015 02:30 (ten years ago)

heineken commercial is real weird given that they asked him to do exactly what no one enjoyed him doing at the oscars.

call all destroyer, Tuesday, 12 May 2015 02:31 (ten years ago)

lmao just watched that final scene good stuff

lag∞n, Tuesday, 12 May 2015 02:34 (ten years ago)

clay come to med school with me i'm gonna be all stressed out and i need someone to watch hoops w/

― k3vin k., Monday, May 11, 2015 7:29 PM (30 seconds ago) Bookmark Flag Post Permalink

i will promise to do this if someone can guarantee it will be exactly like a bill murray 70's comedy sorta thing

Clay, Tuesday, 12 May 2015 02:34 (ten years ago)

http://arcade.stanford.edu/sites/default/files/u81/Ramis%20Book%201.png

balls, Tuesday, 12 May 2015 02:36 (ten years ago)

also i do not have the stomach to be a doctor so i will probably become one of those super neurotic psychiatrists

Clay, Tuesday, 12 May 2015 02:36 (ten years ago)

cn either of u write prescriptions yet

lag∞n, Tuesday, 12 May 2015 02:38 (ten years ago)

love coach izzo

call all destroyer, Tuesday, 12 May 2015 02:39 (ten years ago)

brb guys writing my "guy in his 30's goes back to school to be a doctor... but it doesn't turn out the way you'd think!" buddy college comedy starring bill murray and john belushi in 1978.

Clay, Tuesday, 12 May 2015 02:39 (ten years ago)

it's a little irreverent, but it has a lot of heart

Clay, Tuesday, 12 May 2015 02:39 (ten years ago)

https://vine.co/v/emEDWQmw9IH

lol ed malloy is such a doof

k3vin k., Tuesday, 12 May 2015 02:40 (ten years ago)

cn either of u write prescriptions yet

― lag∞n, Monday, May 11, 2015 7:38 PM (1 minute ago) Bookmark Flag Post Permalink

whatchoo need boss i got u

Clay, Tuesday, 12 May 2015 02:40 (ten years ago)

refs really letting them play

k3vin k., Tuesday, 12 May 2015 02:40 (ten years ago)

anything groovy, generic preferably

lag∞n, Tuesday, 12 May 2015 02:40 (ten years ago)

izzo is a true master

lag∞n, Tuesday, 12 May 2015 02:40 (ten years ago)

https://twitter.com/bronzehammer/status/597951064101490689

Is anybody else hearing this lady all over their cast

, Tuesday, 12 May 2015 02:41 (ten years ago)

wow and the calls they do make are bad

k3vin k., Tuesday, 12 May 2015 02:41 (ten years ago)

omg nothing will go in for the griz this shd be like a 5 point game

lag∞n, Tuesday, 12 May 2015 02:41 (ten years ago)

yeah the grizz aren't playing as bad as the score suggests

slothroprhymes, Tuesday, 12 May 2015 02:43 (ten years ago)

That is a loud lady! Might have re-aimed the mic during halftime though...

schwantz, Tuesday, 12 May 2015 03:04 (ten years ago)

ugh this game is garb

lag∞n, Tuesday, 12 May 2015 03:07 (ten years ago)

yeah i picked a bad time to finally stay up for the late game

call all destroyer, Tuesday, 12 May 2015 03:10 (ten years ago)

She's back.

schwantz, Tuesday, 12 May 2015 03:12 (ten years ago)

sooo many griz turnovers on interior passes tonight

lag∞n, Tuesday, 12 May 2015 03:14 (ten years ago)

bout to opt out

lag∞n, Tuesday, 12 May 2015 03:15 (ten years ago)

this is officially a joke, like the grizz are not this shook almost ever and shit's just not going in that usually does

slothroprhymes, Tuesday, 12 May 2015 03:15 (ten years ago)

was really only a matter of time until what is happening right now happened

k3vin k., Tuesday, 12 May 2015 03:15 (ten years ago)

yup

lag∞n, Tuesday, 12 May 2015 03:16 (ten years ago)

just a compounding effect, they missed some shots and got some bad bounces and let it snowball

call all destroyer, Tuesday, 12 May 2015 03:16 (ten years ago)

then again all those things I just said were said about the dubs not long ago

slothroprhymes, Tuesday, 12 May 2015 03:16 (ten years ago)

sucks to be too amped up at home

call all destroyer, Tuesday, 12 May 2015 03:16 (ten years ago)

this is such a dope win for the warriors

J0rdan S., Tuesday, 12 May 2015 03:20 (ten years ago)

game 4s with the favorite down 2-1 on the road are the best games

J0rdan S., Tuesday, 12 May 2015 03:20 (ten years ago)

good win boring game

lag∞n, Tuesday, 12 May 2015 03:21 (ten years ago)

yeah not the best tho when the warriors go off it's pretty fun for a few minutes

J0rdan S., Tuesday, 12 May 2015 03:24 (ten years ago)

i feel like even the way they were going off was kinda weird and disjointed

lag∞n, Tuesday, 12 May 2015 03:26 (ten years ago)

memphis D affects u even when its not effective

lag∞n, Tuesday, 12 May 2015 03:28 (ten years ago)

not gonna lie starting to want a memphis comeback for watch-the-world-burn reasons but it's all kinds of improbable

slothroprhymes, Tuesday, 12 May 2015 03:30 (ten years ago)

i turned it off

lag∞n, Tuesday, 12 May 2015 03:31 (ten years ago)

not a bad decision by any means

slothroprhymes, Tuesday, 12 May 2015 03:32 (ten years ago)

Zach Lowe ‏@ZachLowe_NBA 41s41 seconds ago
"Let's just put a big guy on Tony Allen" = the kind of adjustment that doesn't happen in the regular-season/makes the playoffs great.

tru

lag∞n, Tuesday, 12 May 2015 03:33 (ten years ago)

two of the Inside guys have said "stephortless" in the last 15 seconds

Clay, Tuesday, 12 May 2015 04:13 (ten years ago)

Defensive adjustments were good. Front zbo w barnes have bogues guard tony so he can help on either zbo or Marc. Have klay guard Conley so he feels engaged again. Pack the paint. Let em shoot threes.

Offense still not quite humming but way better movement. Draymond needs to chill on the turnovers. 22 turns is bad

#wegonnabechampionship (Spottie), Tuesday, 12 May 2015 04:15 (ten years ago)

Ugh stephortless no guys no

#wegonnabechampionship (Spottie), Tuesday, 12 May 2015 04:21 (ten years ago)

what does that mean

lag∞n, Tuesday, 12 May 2015 04:24 (ten years ago)

without stephort

brosario nawson (m bison), Tuesday, 12 May 2015 04:27 (ten years ago)

o jeez

lag∞n, Tuesday, 12 May 2015 04:29 (ten years ago)

gerald stephort was may favorite member of the o'jays

brosario nawson (m bison), Tuesday, 12 May 2015 04:31 (ten years ago)

why would anyone want to be stephortless, hasnt the stephort family suffered enough? #nowthatwefoundlove #whatarewegonnado #withthis

brosario nawson (m bison), Tuesday, 12 May 2015 04:31 (ten years ago)

Chuck so dumb. Warriors out score the grizz in the paint Kenny points out they were the 1 and 2 teams in the paint all year chuck ignores it. Chuck says the grizz outplayed the Warriors in the 2nd half with small ball.

#wegonnabechampionship (Spottie), Tuesday, 12 May 2015 04:34 (ten years ago)

check was talking abt how he stopped watching a game to visit his mother on mothers day and i was honestly surprised he was watching a game on his own time

lag∞n, Tuesday, 12 May 2015 04:36 (ten years ago)

haha

#wegonnabechampionship (Spottie), Tuesday, 12 May 2015 04:39 (ten years ago)

prob had some money on it

Clay, Tuesday, 12 May 2015 04:40 (ten years ago)

tru

lag∞n, Tuesday, 12 May 2015 04:41 (ten years ago)

http://i.imgur.com/tjDIjV3.png

😂 (am0n), Tuesday, 12 May 2015 14:39 (ten years ago)

hahahah

k3vin k., Tuesday, 12 May 2015 14:53 (ten years ago)

v nice

Sufjan Grafton, Tuesday, 12 May 2015 15:26 (ten years ago)

Noah with the Wilhelm scream on that dunk

Mr. Murphy in the wine bar. (Sufjan Grafton), Tuesday, 12 May 2015 23:05 (ten years ago)

/rose attempts to bank in an elbow jumper for some reason and misses badly/

lag∞n, Tuesday, 12 May 2015 23:25 (ten years ago)

https://lh3.googleusercontent.com/-aY7W7jNia1s/AAAAAAAAAAI/AAAAAAAAABw/bQ5DOb6Xawg/s46-c-k-no/photo.jpg

Mr. Murphy in the wine bar. (Sufjan Grafton), Tuesday, 12 May 2015 23:29 (ten years ago)

this timeout talk with Webber is a bit awkward

Mr. Murphy in the wine bar. (Sufjan Grafton), Tuesday, 12 May 2015 23:41 (ten years ago)

he handled it really well!

Matt Armstrong, Tuesday, 12 May 2015 23:42 (ten years ago)

Rachel Nichols with sideline report about how supportive LeBron was re: Blatt

Matt Armstrong, Tuesday, 12 May 2015 23:42 (ten years ago)

i like this coach very much he is good i am not definitely going to fire him in the offseason

lag∞n, Tuesday, 12 May 2015 23:45 (ten years ago)

lol jr smith gets a flukey dunk and immediately goes into heat check mode

Clay, Tuesday, 12 May 2015 23:46 (ten years ago)

look how fucking terrifying Rose is when he doesn't take dumb jumpshots

Matt Armstrong, Tuesday, 12 May 2015 23:47 (ten years ago)

so mysterious how LeBron lost weight and somehow ended up with worse stamina, it's what happened to Roy Jones in boxing tho

Matt Armstrong, Tuesday, 12 May 2015 23:49 (ten years ago)

cldve just stopped training as hard

lag∞n, Tuesday, 12 May 2015 23:50 (ten years ago)

maybe substituted dieting for training?

Matt Armstrong, Tuesday, 12 May 2015 23:51 (ten years ago)

possible i guess

lag∞n, Tuesday, 12 May 2015 23:51 (ten years ago)

maybe hes a secret vegan now or something

lag∞n, Tuesday, 12 May 2015 23:52 (ten years ago)

mozgov looks like someone rocky would have beat the hell out of in 1985

Clay, Tuesday, 12 May 2015 23:52 (ten years ago)

lol of course theres no such thing tho xp self

lag∞n, Tuesday, 12 May 2015 23:52 (ten years ago)

mozgov looks like someone rocky would have beat the hell out of in 1985

― Clay, Tuesday, May 12, 2015 11:52 PM (2 seconds ago) Bookmark Flag Post Permalink

DRAGO WAS WAY UP ON THE CARDS

Matt Armstrong, Tuesday, 12 May 2015 23:53 (ten years ago)

possible he just got old

k3vin k., Tuesday, 12 May 2015 23:53 (ten years ago)

just such a generic american movie russian bad guy look xps

Clay, Tuesday, 12 May 2015 23:53 (ten years ago)

wow rose drives all the way instead of taking a wide open corner three

Matt Armstrong, Tuesday, 12 May 2015 23:54 (ten years ago)

yeah Mozgov is sort of an 80s euro bad guy while pekovic and gortat are more new school

Matt Armstrong, Tuesday, 12 May 2015 23:55 (ten years ago)

amazing what happens why u attack the close out xp

lag∞n, Tuesday, 12 May 2015 23:55 (ten years ago)

as to why they close out on him idk

lag∞n, Tuesday, 12 May 2015 23:55 (ten years ago)

it's really crazy isn't it, how people close out on bad 3 point shooters in the NBA? It's why Antic shooting 3s isn't so bad, because teams honor it.

Matt Armstrong, Wednesday, 13 May 2015 00:01 (ten years ago)

yeah its just a hard to overcome habit i think

lag∞n, Wednesday, 13 May 2015 00:01 (ten years ago)

wow Perkins

Matt Armstrong, Wednesday, 13 May 2015 00:02 (ten years ago)

I feel like you can find a better guy than Perkins in the ACB without a lot of effort

Matt Armstrong, Wednesday, 13 May 2015 00:03 (ten years ago)

perk is very bad

lag∞n, Wednesday, 13 May 2015 00:04 (ten years ago)

omfg perkins

Matt Armstrong, Wednesday, 13 May 2015 00:05 (ten years ago)

lol

lag∞n, Wednesday, 13 May 2015 00:05 (ten years ago)

they better give Shumpert a block on that rose heave #fantasyposts

Matt Armstrong, Wednesday, 13 May 2015 00:06 (ten years ago)

smh statkeepers

Matt Armstrong, Wednesday, 13 May 2015 00:10 (ten years ago)

i accidentally watched the series finale of doogie howser a few months back one night. his hair was dyed black and he gave up medicine to move to italy w/ vinnie and become an actor.

― balls, Monday, May 11, 2015 10:24 PM (Yesterday) Bookmark Flag Post Permalink

I'd never heard of this, weird

Almost as bizarre as the whole final season of roseanne

juice college (agent hibachi), Wednesday, 13 May 2015 00:29 (ten years ago)

don't like taking mozgov out here

Matt Armstrong, Wednesday, 13 May 2015 00:30 (ten years ago)

yeah Mozgov is sort of an 80s euro bad guy while pekovic and gortat are more new school

― Matt Armstrong, Tuesday, May 12, 2015 7:55 PM (34 minutes ago) Bookmark Flag Post Permalink

Ya it's those wide blank planes of his face also he has barely any facial expressions, perfect for punching

Pek and gortat are more from the tatted up grimy type 2000s euro baddie school

juice college (agent hibachi), Wednesday, 13 May 2015 00:31 (ten years ago)

yeah like a guy Vin Diesel fights in XXX

Matt Armstrong, Wednesday, 13 May 2015 00:32 (ten years ago)

i love this photo
https://pbs.twimg.com/media/B6xzB1JCUAAU1V2.png

brimstead, Wednesday, 13 May 2015 00:35 (ten years ago)

Can this series go five exciting minutes without someone limping off the court in pain? Jesus

juice college (agent hibachi), Wednesday, 13 May 2015 00:36 (ten years ago)

Vincent Goodwill ‏@vgoodwill 12m12 minutes ago

LeBron is HEATED after that last turnover and score. Bounced ball high in the air after coach LeBron called timeout. 54-50

Matt Armstrong, Wednesday, 13 May 2015 00:38 (ten years ago)

it's against the law iirc

slothroprhymes, Wednesday, 13 May 2015 00:39 (ten years ago)

arrest this man

lag∞n, Wednesday, 13 May 2015 00:40 (ten years ago)

did bron go back to cleveland just cause he wanted to coach again

lag∞n, Wednesday, 13 May 2015 00:40 (ten years ago)

bron with an excellent series of travels

lag∞n, Wednesday, 13 May 2015 00:41 (ten years ago)

lol it could be!

and in that case why bother getting rid of blatt you can clearly push him around xp

slothroprhymes, Wednesday, 13 May 2015 00:42 (ten years ago)

and in the clutch blatt will do valuable personal stuff like take you bowling

slothroprhymes, Wednesday, 13 May 2015 00:43 (ten years ago)

remember that one season where Dunleavy was sort of a star

Matt Armstrong, Wednesday, 13 May 2015 00:45 (ten years ago)

nikooooo

slothroprhymes, Wednesday, 13 May 2015 00:48 (ten years ago)

this is a pretty bananas game from bron

Matt Armstrong, Wednesday, 13 May 2015 00:49 (ten years ago)

mods delete that

slothroprhymes, Wednesday, 13 May 2015 00:49 (ten years ago)

(xp self)

slothroprhymes, Wednesday, 13 May 2015 00:50 (ten years ago)

i think i decided i don't like lebron again

Clay, Wednesday, 13 May 2015 00:50 (ten years ago)

whoa mirotic!!

Clay, Wednesday, 13 May 2015 00:50 (ten years ago)

omfg niko

Matt Armstrong, Wednesday, 13 May 2015 00:50 (ten years ago)

NEVERMIND

slothroprhymes, Wednesday, 13 May 2015 00:51 (ten years ago)

wowwww wow wow

slothroprhymes, Wednesday, 13 May 2015 00:51 (ten years ago)

so casual abt it

Clay, Wednesday, 13 May 2015 00:51 (ten years ago)

yeah he shot it like it was in his range

Matt Armstrong, Wednesday, 13 May 2015 00:52 (ten years ago)

Haha he totally swished that

juice college (agent hibachi), Wednesday, 13 May 2015 00:52 (ten years ago)

mirotic hitting a half court shot after antagonizing lebron all quarter was a great troll moment

J0rdan S., Wednesday, 13 May 2015 00:52 (ten years ago)

I always thought it was boss how stephon marbury would shoot 50 footers by just jumping higher on his usual shooting form

Matt Armstrong, Wednesday, 13 May 2015 00:53 (ten years ago)

also decided I don't like LeBron again. would be nice if bulls could beat him in a series just once before father time does. hard to do when the only guy on your team who appears to have any sort of alpha dogness has the offensive skills of jo noah.

A True White Kid that can Jump (Granny Dainger), Wednesday, 13 May 2015 00:54 (ten years ago)

prima donna lebron this year has just been nagl, sick of it

holy shit what's happening now

Clay, Wednesday, 13 May 2015 00:57 (ten years ago)

this is the most pathetic fight ever

J0rdan S., Wednesday, 13 May 2015 00:58 (ten years ago)

SICK VALUE PLAY BY DELLY

Matt Armstrong, Wednesday, 13 May 2015 00:58 (ten years ago)

it should be totally okay and within the scope of the rules to kick delavedova

Clay, Wednesday, 13 May 2015 00:59 (ten years ago)

they should just announce that it's the playoffs and whatever

Matt Armstrong, Wednesday, 13 May 2015 01:00 (ten years ago)

i didn't think kevin had this in him

J0rdan S., Wednesday, 13 May 2015 01:00 (ten years ago)

oh joey

Matt Armstrong, Wednesday, 13 May 2015 01:01 (ten years ago)

Lol stay classy cleve

head clowning instructor (art), Wednesday, 13 May 2015 01:01 (ten years ago)

horseshit ejection imo

Clay, Wednesday, 13 May 2015 01:01 (ten years ago)

Dellavedova looks real kickable but that was pretty dirty by Gibson, the way he caught his leg could have totally injured him

juice college (agent hibachi), Wednesday, 13 May 2015 01:02 (ten years ago)

That said I agree with the idea that refs should just be like deal with it it's the offs mang

juice college (agent hibachi), Wednesday, 13 May 2015 01:03 (ten years ago)

you mean the way he caught the leg of the guy who was trying to leglock him???

A True White Kid that can Jump (Granny Dainger), Wednesday, 13 May 2015 01:04 (ten years ago)

seems reasonable to say there's such a kick as will get one ejected but also seems reasonable to observe that that one didn't quite meet the mark. esp w dellys leg lock in play

head clowning instructor (art), Wednesday, 13 May 2015 01:04 (ten years ago)

Ah I didn't catch that I kept looking up halfway thru the replay as Gibson was loading up on him, fair enough

juice college (agent hibachi), Wednesday, 13 May 2015 01:05 (ten years ago)

but idk can see other side is reasonable too. i assume the league will respond in some way

head clowning instructor (art), Wednesday, 13 May 2015 01:05 (ten years ago)

so thibs to new orleans huh

Clay, Wednesday, 13 May 2015 01:06 (ten years ago)

dell totally hooked taj's leg and baited him to start it but idk

slothroprhymes, Wednesday, 13 May 2015 01:13 (ten years ago)

it was rodmanesque baiting from delly

Matt Armstrong, Wednesday, 13 May 2015 01:22 (ten years ago)

wasn't that rose move a travel?

head clowning instructor (art), Wednesday, 13 May 2015 01:31 (ten years ago)

Yo this game got interesting

juice college (agent hibachi), Wednesday, 13 May 2015 01:31 (ten years ago)

hope the clips close out tonight

Clay, Wednesday, 13 May 2015 01:41 (ten years ago)

clips are approximately 0 for 1 million to start the night

k3vin k., Wednesday, 13 May 2015 01:55 (ten years ago)

SAGER!!

slothroprhymes, Wednesday, 13 May 2015 01:59 (ten years ago)

:D

slothroprhymes, Wednesday, 13 May 2015 01:59 (ten years ago)

i don't think blake really needs to bring the ball up every time

k3vin k., Wednesday, 13 May 2015 02:09 (ten years ago)

why...is doc playing the bench so much again

k3vin k., Wednesday, 13 May 2015 02:17 (ten years ago)

when will he learn

k3vin k., Wednesday, 13 May 2015 02:17 (ten years ago)

yea like I sort of understand the blake point power forward thing but like cp3 is there for a reason

slothroprhymes, Wednesday, 13 May 2015 02:17 (ten years ago)

the blake power point thing is fun (and works better) when it's spontaneous. he's not quite skilled enough to actually be lebron james by design

k3vin k., Wednesday, 13 May 2015 02:18 (ten years ago)

pat beverly is a dead ringer for the RZA

slothroprhymes, Wednesday, 13 May 2015 02:28 (ten years ago)

lol spawes from the parking lot

k3vin k., Wednesday, 13 May 2015 02:36 (ten years ago)

oh, spencer hawes

Clay, Wednesday, 13 May 2015 02:46 (ten years ago)

wow the rox can play without employing hack-a I'd forgotten

slothroprhymes, Wednesday, 13 May 2015 02:49 (ten years ago)

disastrous 1st half for the clips

k3vin k., Wednesday, 13 May 2015 02:51 (ten years ago)

did i miss anything in the first game? should i watch? when was the "fight"?

check out this insane slothroprhymes yall (Spottie), Wednesday, 13 May 2015 03:02 (ten years ago)

your screen name is rude man

it was in Q3 and stupid and bad

slothroprhymes, Wednesday, 13 May 2015 03:14 (ten years ago)

check out this insane sloth yall

Clay, Wednesday, 13 May 2015 03:27 (ten years ago)

lol I know what it's in ref to I'm not genuinely offended/to be fair I am a lunatic on here sometimes like getting bent out of shape about clickbait/deadspin etc that by rights should not frustrate me

slothroprhymes, Wednesday, 13 May 2015 03:28 (ten years ago)

*etc, shit that by rights

slothroprhymes, Wednesday, 13 May 2015 03:29 (ten years ago)

Blakely claims a "60-65% chance" that Matthews will be a Celtic next year. Toscano upped the ante to 75%. Then again, Blakely also said there's a 70% chance that Boston will land Detroit Pistons forward Greg Monroe. So far we're up to about a billion percent.

In a separate video with the same theme, Blakely drops the bombshell that the Celtics have a "35-40% chance" of landing Aldridge and will actively seek to land both Portland players.

lol is the boston sports media really this insane

Clay, Wednesday, 13 May 2015 03:33 (ten years ago)

jeez the rox can't miss when was the last time that was true - game 5 of the mavs series?

slothroprhymes, Wednesday, 13 May 2015 03:33 (ten years ago)

xp....yes it is :/

slothroprhymes, Wednesday, 13 May 2015 03:33 (ten years ago)

greg monroe is by no means implausible but that aside come onnnn

slothroprhymes, Wednesday, 13 May 2015 03:34 (ten years ago)

smart / matthews / turner / aldridge / monroe with thomas, sully, olynyk, zeller, bradley is a pretty killer fever dream lineup tbf

Clay, Wednesday, 13 May 2015 03:34 (ten years ago)

oh man this must be super hard for doc

Clay, Wednesday, 13 May 2015 03:37 (ten years ago)

oh shit

slothroprhymes, Wednesday, 13 May 2015 03:37 (ten years ago)

guess it was worse than it looked

slothroprhymes, Wednesday, 13 May 2015 03:42 (ten years ago)

I mean less worse jeez

slothroprhymes, Wednesday, 13 May 2015 03:42 (ten years ago)

*gives up typing forever*

slothroprhymes, Wednesday, 13 May 2015 03:43 (ten years ago)

just a hard fall, he'll be ok

call all destroyer, Wednesday, 13 May 2015 03:45 (ten years ago)

harden tripdub: 26-11-10

slothroprhymes, Wednesday, 13 May 2015 04:20 (ten years ago)

https://pbs.twimg.com/media/CE5URPjWgAMneBW.jpg

two gems in this screengrab

k3vin k., Wednesday, 13 May 2015 15:24 (ten years ago)

listening to lowe's podcast with JVG, and god JVG is such a save-a-coach, literally no coach ever deserves to be fired to him

k3vin k., Wednesday, 13 May 2015 15:37 (ten years ago)

haha i wondered if anyone else listened to that - he gets so heated! especially about spencer hawes's problems, apparently

obviously his bias is understandable and he's right to an extent in that sometimes player problems are attributed to coaches as if theyre solely coaching problems, but the coach is never not at least a partial factor and sometimes is the only problematic factor

slothroprhymes, Wednesday, 13 May 2015 17:18 (ten years ago)

ruh roh:

AP Sports ‏@AP_Sports 3m3 minutes ago
Police: Cavaliers forward Kendrick Perkins involved in verbal dispute with wife on side of road

slothroprhymes, Wednesday, 13 May 2015 17:19 (ten years ago)

his wife's name is vanity! also lol at this key detail -

Perkins played just 90 seconds in Cleveland's playoff win over Chicago on Tuesday night.

slothroprhymes, Wednesday, 13 May 2015 17:20 (ten years ago)

Taj Gibson is as handsome as Sam Cassell.

Madison Dumbbarfer (Leee), Wednesday, 13 May 2015 18:20 (ten years ago)

Kurt Helin ‏@basketballtalk 7s8 seconds ago
John Wall starting for Wizards in Game 5 tonight

lag∞n, Wednesday, 13 May 2015 23:13 (ten years ago)

listening to lowe's podcast with JVG, and god JVG is such a save-a-coach, literally no coach ever deserves to be fired to him

― k3vin k., Wednesday, May 13, 2015 11:37 AM (8 hours ago) Bookmark Flag Post Permalinkthis

This is jvg's sole weakness as a commentator, basketball mind and general crank, he's just a little too dedicated to the coaching fraternity code

On the upside he is a good voice for just how hard coaching guys at the NBA level is and usually points out some good things that guys who get piled on are actually doing

juice college (agent hibachi), Thursday, 14 May 2015 00:18 (ten years ago)

ya and coaches are fired all the time for organizational failures

lag∞n, Thursday, 14 May 2015 00:20 (ten years ago)

tho sometimes theyre fired cause theyre bad

lag∞n, Thursday, 14 May 2015 00:20 (ten years ago)

Or just too limited for what's needed like Monty Williams

Like Scott skiles was awesome at getting awful young teams to get their shit together but was probably never gonna coach a conference finalist

juice college (agent hibachi), Thursday, 14 May 2015 00:22 (ten years ago)

I know he's been doing some amount of good stuff but man...I just cannot get over the amount of burn Drew gooden gets for the Wizards

I thought picking up Dejuan Blair was going to solve that but he's been a healthy scratch all playoffs and barely played past the first two months of the season- did his no acl thing catch up with him or what?

juice college (agent hibachi), Thursday, 14 May 2015 00:25 (ten years ago)

and on cue gooden gets rejected by bazemore and commits a dumb foul on the other end

My problem with him is that he's invisible or fine a chunk of time but then has stretches where he duffs like three plays in a row with various easily preventable mistakes

juice college (agent hibachi), Thursday, 14 May 2015 00:27 (ten years ago)

there is a reason he was out the league the whole year!

slothroprhymes, Thursday, 14 May 2015 00:37 (ten years ago)

*a whole year

slothroprhymes, Thursday, 14 May 2015 00:37 (ten years ago)

literally who is muscala

lag∞n, Thursday, 14 May 2015 00:42 (ten years ago)

wall is ridiculous

Heez, Thursday, 14 May 2015 00:57 (ten years ago)

he made a good pass w his broken in five places hand

lag∞n, Thursday, 14 May 2015 00:59 (ten years ago)

rooting hard for the wiz, john wall is awesome

call all destroyer, Thursday, 14 May 2015 01:00 (ten years ago)

NBA on ESPN ‏@ESPNNBA 1m1 minute ago
Tony Allen is OUT for Game 5 tonight against Warriors with hamstring injury.

blah

lag∞n, Thursday, 14 May 2015 01:50 (ten years ago)

too many damn injuries

call all destroyer, Thursday, 14 May 2015 01:54 (ten years ago)

he was a waste of space anyway

check out this insane slothroprhymes yall (Spottie), Thursday, 14 May 2015 01:59 (ten years ago)

jk that does suck, klay gonna go for 30 tonight

check out this insane slothroprhymes yall (Spottie), Thursday, 14 May 2015 02:00 (ten years ago)

atl just looks...not great for a 60+ win team

not a garbageman, i am garbage, man (m bison), Thursday, 14 May 2015 02:05 (ten years ago)

Kevin Pelton ‏@kpelton 31s32 seconds ago
The Hawks need 13 points in the last 5:48 to avoid their lowest-scoring game of the season.

lag∞n, Thursday, 14 May 2015 02:07 (ten years ago)

...immediately score 8pts

lag∞n, Thursday, 14 May 2015 02:12 (ten years ago)

they shd just give it to korver for 30footers every play

lag∞n, Thursday, 14 May 2015 02:12 (ten years ago)

the hawks are playing like garbage but the wiz look so much better than they did most of this season

Heez, Thursday, 14 May 2015 02:13 (ten years ago)

tru

lag∞n, Thursday, 14 May 2015 02:14 (ten years ago)

looked at the score and don't think I can bear to watch this, sticking to the mad men marathon till dubs-grizz but go hawks

slothroprhymes, Thursday, 14 May 2015 02:14 (ten years ago)

john hamm is at the game

lag∞n, Thursday, 14 May 2015 02:15 (ten years ago)

how in the world is that a jump ball

call all destroyer, Thursday, 14 May 2015 02:16 (ten years ago)

got to learn how to draw contact on the break german rondo

lag∞n, Thursday, 14 May 2015 02:16 (ten years ago)

there's the ol defense i remember

Heez, Thursday, 14 May 2015 02:17 (ten years ago)

Hawks really got their act together quickly

juice college (agent hibachi), Thursday, 14 May 2015 02:18 (ten years ago)

i just can't bring myself to care one whit abt this series. like wow congrats to the team that will lose in 5 in the ECF.

Clay, Thursday, 14 May 2015 02:18 (ten years ago)

this game has been p good imo

lag∞n, Thursday, 14 May 2015 02:19 (ten years ago)

which side were you on in the "games w/ bad offense can't be good" argument from the other day

Clay, Thursday, 14 May 2015 02:19 (ten years ago)

i think you were in the "lol wrong" side tho so n/m

Clay, Thursday, 14 May 2015 02:20 (ten years ago)

excellent game ime

call all destroyer, Thursday, 14 May 2015 02:21 (ten years ago)

"games w/ bad offense can't be good"

wow the power of proaganda huh that was just a typically gross purposeful misconstruing of my argument by certain ilh unmentionables

lag∞n, Thursday, 14 May 2015 02:21 (ten years ago)

i like these teams, they're not like the best teams but they both have a lot of players i can get behind

call all destroyer, Thursday, 14 May 2015 02:22 (ten years ago)

he's been perry good but exactly how has schroder taken all the crunch time minutes from teague in this series

J0rdan S., Thursday, 14 May 2015 02:22 (ten years ago)

eh i really don't see the cavs or bulls taking anyone in 5

Heez, Thursday, 14 May 2015 02:22 (ten years ago)

teague has been bad, hes injured i guess

lag∞n, Thursday, 14 May 2015 02:22 (ten years ago)

teague has been kinda shook maybe

call all destroyer, Thursday, 14 May 2015 02:23 (ten years ago)

wow nene shit his pants there

k3vin k., Thursday, 14 May 2015 02:24 (ten years ago)

teague was great in the last game!

slothroprhymes, Thursday, 14 May 2015 02:25 (ten years ago)

teague's ankle has def been hurting him

Heez, Thursday, 14 May 2015 02:26 (ten years ago)

hes shooting 37% for the playoffs and cant get to the rim

lag∞n, Thursday, 14 May 2015 02:27 (ten years ago)

god everyone is hobbled and cranky

slothroprhymes, Thursday, 14 May 2015 02:27 (ten years ago)

"everything hurts and I'm tired" - the NBA

slothroprhymes, Thursday, 14 May 2015 02:27 (ten years ago)

looked at the score and don't think I can bear to watch this, sticking to the mad men marathon till dubs-grizz but go hawks

― slothroprhymes, Wednesday, May 13, 2015 10:14 PM (11 minutes ago) Bookmark Flag Post Permalink

Thnx for the tip I'm a year behind on mad men no one spoil it but he becomes king of westeros right?

juice college (agent hibachi), Thursday, 14 May 2015 02:27 (ten years ago)

invents a new use for the peanut via methylimine iirc

slothroprhymes, Thursday, 14 May 2015 02:28 (ten years ago)

hes shooting 37% for the playoffs and cant get to the rim

― lag∞n, Wednesday, May 13, 2015 10:27 PM (1 minute ago)

isn't that well above average for the 2015 playoffs tho

k3vin k., Thursday, 14 May 2015 02:28 (ten years ago)

the true mad men are chuck, ernie, kenny, and shaq.

Clay, Thursday, 14 May 2015 02:29 (ten years ago)

that's how we murder shaq - with a lawnmower in the turner broadcasting office

slothroprhymes, Thursday, 14 May 2015 02:30 (ten years ago)

man i love john wall

J0rdan S., Thursday, 14 May 2015 02:31 (ten years ago)

Thnx for the tip I'm a year behind on mad men no one spoil it but he becomes king of westeros right?

― juice college (agent hibachi), Wednesday, May 13, 2015 10:27 PM (2 minutes ago) Bookmark Flag Post Permalink

it actually turns out don draper is "the mad man"

lag∞n, Thursday, 14 May 2015 02:31 (ten years ago)

quick shot here?

k3vin k., Thursday, 14 May 2015 02:31 (ten years ago)

John wall doin big thangs with that busted hand, think I'm gonna look into getting some non displaced fractures next time I need a boost

juice college (agent hibachi), Thursday, 14 May 2015 02:31 (ten years ago)

wow great play wizards

k3vin k., Thursday, 14 May 2015 02:32 (ten years ago)

whoa, fastbreak buckets this late and this close are like rare pokemons

not a garbageman, i am garbage, man (m bison), Thursday, 14 May 2015 02:32 (ten years ago)

why the hell did pierce not pull up there

J0rdan S., Thursday, 14 May 2015 02:33 (ten years ago)

pierce's "what the hell, ref" face is one of the best nba faces

Clay, Thursday, 14 May 2015 02:33 (ten years ago)

yuuuuuuuuuuuup

Heez, Thursday, 14 May 2015 02:33 (ten years ago)

daaaamn

k3vin k., Thursday, 14 May 2015 02:35 (ten years ago)

vindication!

Clay, Thursday, 14 May 2015 02:35 (ten years ago)

great play

k3vin k., Thursday, 14 May 2015 02:35 (ten years ago)

GOAT

J0rdan S., Thursday, 14 May 2015 02:35 (ten years ago)

ok fuck pierce but he just laid wall out

Heez, Thursday, 14 May 2015 02:36 (ten years ago)

:O

k3vin k., Thursday, 14 May 2015 02:37 (ten years ago)

wowwwww

call all destroyer, Thursday, 14 May 2015 02:37 (ten years ago)

WHOA HORFORD

not a garbageman, i am garbage, man (m bison), Thursday, 14 May 2015 02:37 (ten years ago)

so much drama

Clay, Thursday, 14 May 2015 02:37 (ten years ago)

series of the buzzer beater!

slothroprhymes, Thursday, 14 May 2015 02:37 (ten years ago)

man nene's gotta hold onto that rebound

k3vin k., Thursday, 14 May 2015 02:37 (ten years ago)

!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Heez, Thursday, 14 May 2015 02:38 (ten years ago)

well, not technically in that case but just as good

slothroprhymes, Thursday, 14 May 2015 02:38 (ten years ago)

crazy

lag∞n, Thursday, 14 May 2015 02:38 (ten years ago)

jesus christ nene

J0rdan S., Thursday, 14 May 2015 02:38 (ten years ago)

nene seems like he might be kinda washed

slothroprhymes, Thursday, 14 May 2015 02:38 (ten years ago)

they called a play for schroeder!! this is incredible

J0rdan S., Thursday, 14 May 2015 02:38 (ten years ago)

al just fucking hustled his way to that win (and traveled but ill allow it)

not a garbageman, i am garbage, man (m bison), Thursday, 14 May 2015 02:38 (ten years ago)

nene not getting that rebound is unbelievable

J0rdan S., Thursday, 14 May 2015 02:39 (ten years ago)

rooting for golden state and all but it's garbage that tony allen is out

Clay, Thursday, 14 May 2015 02:41 (ten years ago)

Wiz just got muscled on that rebound, gotta get that

juice college (agent hibachi), Thursday, 14 May 2015 02:41 (ten years ago)

nene and horford got to the ball at basically the same time, nene had position but was off balance and horford just took it from him and knocked him over, sick own

lag∞n, Thursday, 14 May 2015 02:43 (ten years ago)

https://vine.co/v/eKip2ZqOp2T

lag∞n, Thursday, 14 May 2015 02:44 (ten years ago)

tremendous play by horford, he was a beast for the whole game

call all destroyer, Thursday, 14 May 2015 02:46 (ten years ago)

ya

lag∞n, Thursday, 14 May 2015 02:47 (ten years ago)

i'm not really sure nene could do much given horford's perfectly-timed flying leap to the ball

call all destroyer, Thursday, 14 May 2015 02:47 (ten years ago)

that had some video game aggressive rebound qualities which you don't see too often

Clay, Thursday, 14 May 2015 02:48 (ten years ago)

feel like what nene couldve done was be better balanced once he was back on his heels it was over

lag∞n, Thursday, 14 May 2015 02:49 (ten years ago)

i love the gasol/randolph partnership

lag∞n, Thursday, 14 May 2015 02:52 (ten years ago)

dubs dying in transition already

slothroprhymes, Thursday, 14 May 2015 02:53 (ten years ago)

https://twitter.com/rachel__nichols/status/598682872715837440

slothroprhymes, Thursday, 14 May 2015 02:56 (ten years ago)

i've never seen curry as tentative as he's been this series, this is really crazy

k3vin k., Thursday, 14 May 2015 03:04 (ten years ago)

mvp award is cursed

lag∞n, Thursday, 14 May 2015 03:05 (ten years ago)

cue curry with a gorgeous 3 followed by a steal

Clay, Thursday, 14 May 2015 03:06 (ten years ago)

so i got shitty rafter seats thinking maybe i could upgrade and then managed to get about 12 rows back from courtside for about $90 bucks total. hawks showed flashes of being the hawks i know and then more flashes of being the hawks we've seen in the playoffs. crowd was fired the fuck up the whole game. that last sequence from pierce to horford, that's one of the strongest emotional waves i've ever felt. cried literal tears of joy for like ten minutes and i'm on an ssri so that's something. hoarse as fuck. me and ti and jon hamm going to cheetahs, we gonna get drunk tonight y'all.

balls, Thursday, 14 May 2015 03:06 (ten years ago)

glad for u

call all destroyer, Thursday, 14 May 2015 03:07 (ten years ago)

lol that's awesome man glad you got to see it

slothroprhymes, Thursday, 14 May 2015 03:07 (ten years ago)

oh you gotta be joking grizz you can't let that happen

slothroprhymes, Thursday, 14 May 2015 03:08 (ten years ago)

golden state still seems like it can score at twice the rate of every other team

call all destroyer, Thursday, 14 May 2015 03:08 (ten years ago)

insane that grizz wind up losing the quarter

A True White Kid that can Jump (Granny Dainger), Thursday, 14 May 2015 03:08 (ten years ago)

i'm so fucking happy right now, everybody was hugging each other, everything is beautiful

balls, Thursday, 14 May 2015 03:09 (ten years ago)

grizz only real advantage is to keep trying to induce turnovers, they have a knack for doing so against the dubs that few teams have shown

slothroprhymes, Thursday, 14 May 2015 03:09 (ten years ago)

(also jon hamm actually was at the game? I thought goon was joking)

slothroprhymes, Thursday, 14 May 2015 03:10 (ten years ago)

wtf jaeger stop letting air vince shoot bad threes

slothroprhymes, Thursday, 14 May 2015 03:13 (ten years ago)

xp yup he was there

call all destroyer, Thursday, 14 May 2015 03:13 (ten years ago)

yes I am hamm I am the secret man who drinks at hawks games

slothroprhymes, Thursday, 14 May 2015 03:15 (ten years ago)

er, doesn't drink. too soon

slothroprhymes, Thursday, 14 May 2015 03:16 (ten years ago)

balls
Posted: May 13, 2015 at 11:09:04 PM
i'm so fucking happy right now, everybody was hugging each other, everything is beautiful

:)

lag∞n, Thursday, 14 May 2015 03:23 (ten years ago)

happy for balls

k3vin k., Thursday, 14 May 2015 03:25 (ten years ago)

ha wut i just got a ron paul commercial for some shady looking financial advice to survive the upcoming economic collapse isnt he still in congress is that shit legal

lag∞n, Thursday, 14 May 2015 03:30 (ten years ago)

he left congress i think?

Clay, Thursday, 14 May 2015 03:32 (ten years ago)

yeah he didn't seek reelection in 2012

Clay, Thursday, 14 May 2015 03:33 (ten years ago)

ah lol ok

lag∞n, Thursday, 14 May 2015 03:34 (ten years ago)

brb need to purchase gold coins to protect my family

lag∞n, Thursday, 14 May 2015 03:35 (ten years ago)

griz got no chance if theyre gonna brick layups

lag∞n, Thursday, 14 May 2015 03:39 (ten years ago)

wonder what ron paul does all day now

Clay, Thursday, 14 May 2015 03:47 (ten years ago)

probably mods r/bitcoin?

Clay, Thursday, 14 May 2015 03:47 (ten years ago)

lol this website the ad directs u to https://ronpaulmessage8.com

lag∞n, Thursday, 14 May 2015 03:51 (ten years ago)

ronpaulmessage8.com

lag∞n, Thursday, 14 May 2015 03:53 (ten years ago)

http://www.ronpaulcoin.com/

Clay, Thursday, 14 May 2015 03:59 (ten years ago)

still think the grizz has a chance but it'll take a minor miracle

Heroic melancholy continues to have a forceful grip on (bernard snowy), Thursday, 14 May 2015 04:02 (ten years ago)

dubs swarming the paint again and the griz arent generating good threes out of it

lag∞n, Thursday, 14 May 2015 04:04 (ten years ago)

LOL that possession

k3vin k., Thursday, 14 May 2015 04:04 (ten years ago)

man another bloodbath damn :/

slothroprhymes, Thursday, 14 May 2015 04:18 (ten years ago)

rip griz

lag∞n, Thursday, 14 May 2015 04:19 (ten years ago)

warriors officially shaken out of complacency by the 2-1 hole imo, bout to run the table now

not a garbageman, i am garbage, man (m bison), Thursday, 14 May 2015 04:20 (ten years ago)

eh it's going back to memphis for game 6, that could go either way esp if allen is back

Clay, Thursday, 14 May 2015 04:25 (ten years ago)

nah it aint they are shooooook af

not a garbageman, i am garbage, man (m bison), Thursday, 14 May 2015 04:26 (ten years ago)

not impossible for memphis to win but feel like the dubs have made the right adjustments/gotten their groove back

lag∞n, Thursday, 14 May 2015 05:07 (ten years ago)

also obvs they r the better team

lag∞n, Thursday, 14 May 2015 05:08 (ten years ago)

when did shaq start doing the chief keef bangbang constantly

lag∞n, Thursday, 14 May 2015 05:22 (ten years ago)

d-40 convinced him of how good the back from the dead 2 mixtape is, I believe

slothroprhymes, Thursday, 14 May 2015 10:49 (ten years ago)

lol

lag∞n, Thursday, 14 May 2015 13:28 (ten years ago)

bulls look solid thus far/joakim letting his hair down yikes hide ya daughters ppl

slothroprhymes, Friday, 15 May 2015 00:29 (ten years ago)

shit I think kyrie might be totally done & while I'm rooting for the bulls in this series that sucks

slothroprhymes, Friday, 15 May 2015 00:47 (ten years ago)

ya love watching him play, sad to see him gimpy.
kirk hinrich with the airball 3, plz retire at 1/2 time

A True White Kid that can Jump (Granny Dainger), Friday, 15 May 2015 00:48 (ten years ago)

LeBron the pioneer of the kneeldown flop

Matt Armstrong, Friday, 15 May 2015 00:55 (ten years ago)

flop

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 00:56 (ten years ago)

niko that was really dumb...

slothroprhymes, Friday, 15 May 2015 00:56 (ten years ago)

he mad

lag∞n, Friday, 15 May 2015 00:57 (ten years ago)

he reached, no big deal

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 00:57 (ten years ago)

shumps hair made it worse than it was

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 00:57 (ten years ago)

after the taj ejection idk anymore

Matt Armstrong, Friday, 15 May 2015 00:57 (ten years ago)

not saying it should be a big deal but given how the series is they're gonna be v strict with the calls

slothroprhymes, Friday, 15 May 2015 00:58 (ten years ago)

I think it's a flagrant 1 tbh

Matt Armstrong, Friday, 15 May 2015 00:59 (ten years ago)

I kinda endorse it tbh after the #tajwasframed incident but they gotta make em pay with buckets not beatdowns

slothroprhymes, Friday, 15 May 2015 00:59 (ten years ago)

you've softened matt

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 01:00 (ten years ago)

xxp contrarian swagger on a hundred thousand trillion

slothroprhymes, Friday, 15 May 2015 01:00 (ten years ago)

mirotic hasn't made a 3 since 1988

A True White Kid that can Jump (Granny Dainger), Friday, 15 May 2015 01:01 (ten years ago)

he made a beautifully effortless half courter in game 5!

Clay, Friday, 15 May 2015 01:01 (ten years ago)

rip bulls

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 01:07 (ten years ago)

why u die bulls

lag∞n, Friday, 15 May 2015 01:07 (ten years ago)

need game 7

lag∞n, Friday, 15 May 2015 01:07 (ten years ago)

think Bulls would lose a series to any team left in playoffs

A True White Kid that can Jump (Granny Dainger), Friday, 15 May 2015 01:08 (ten years ago)

really was hoping for game 7

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 01:11 (ten years ago)

it's not even halftime yet!

A True White Kid that can Jump (Granny Dainger), Friday, 15 May 2015 01:11 (ten years ago)

you know how we like to pretend things are cooked before they really are

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 01:13 (ten years ago)

these Bulls scoring doldrums are amazing

brownie, Friday, 15 May 2015 01:14 (ten years ago)

they've played poorly at home all season. thibs is incapable of snapping them out of their offensive lulls. he's gone.

A True White Kid that can Jump (Granny Dainger), Friday, 15 May 2015 01:15 (ten years ago)

idgi. they've had them for years, but made up for it with top notch d. figured with rose back, gasol signed, butler developing into a 20 ppg scorer those days would be behind them. and yet.

A True White Kid that can Jump (Granny Dainger), Friday, 15 May 2015 01:16 (ten years ago)

v weird

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 01:18 (ten years ago)

shumpert's eyes get huge when wite guy is guarding him

A True White Kid that can Jump (Granny Dainger), Friday, 15 May 2015 01:32 (ten years ago)

lol at both these terrible teams tonight

Clay, Friday, 15 May 2015 01:35 (ten years ago)

jesus, this 3rd quarter

brownie, Friday, 15 May 2015 01:35 (ten years ago)

every possession is laugh out loud funny

Clay, Friday, 15 May 2015 01:36 (ten years ago)

both teams hit up metta world peace's liquor store at the 1/2

A True White Kid that can Jump (Granny Dainger), Friday, 15 May 2015 01:36 (ten years ago)

shd start the next game now

lag∞n, Friday, 15 May 2015 01:59 (ten years ago)

adios bulls, you were not actually that good

k3vin k., Friday, 15 May 2015 02:00 (ten years ago)

this game is like a wasted slap bet

slothroprhymes, Friday, 15 May 2015 02:00 (ten years ago)

instead of a post game speech to the team thibs shd just hand out his resume

lag∞n, Friday, 15 May 2015 02:02 (ten years ago)

tv guys giving the lil wite a lot of credit for scoring 10 pts btw

lag∞n, Friday, 15 May 2015 02:02 (ten years ago)

how many years in a row has lebron been to the conference finals, this'll be what six or seven?

Clay, Friday, 15 May 2015 02:03 (ten years ago)

xp sports media never passes up a chance to praise a gritty wite

slothroprhymes, Friday, 15 May 2015 02:03 (ten years ago)

oh no his last cavs team lost in the semis

Clay, Friday, 15 May 2015 02:04 (ten years ago)

xp sports media never passes up a chance to praise a gritty wite

― slothroprhymes, Thursday, May 14, 2015 7:03 PM (46 seconds ago) Bookmark Flag Post Permalink

dellevadova for true detective season 3

Clay, Friday, 15 May 2015 02:05 (ten years ago)

Everyone ready for sad d rose press conference?

juice college (agent hibachi), Friday, 15 May 2015 02:09 (ten years ago)

Thibs should just keep them in the arena practicing until next fall to make sure they all die of exhaustion

juice college (agent hibachi), Friday, 15 May 2015 02:10 (ten years ago)

so who's the ideal candidate for the bulls new coach, i honestly have no idea, they're so thibsy i can't see them as anything else

Clay, Friday, 15 May 2015 02:11 (ten years ago)

Everyone ready for sad d rose press conference?

― juice college (agent hibachi), Thursday, May 14, 2015 10:09 PM (21 seconds ago) Bookmark Flag Post Permalink

need to prep by huffing one of the two athletes rehabbing from injury ad campaigns currently airing

lag∞n, Friday, 15 May 2015 02:11 (ten years ago)

death by kellavodva has got to be the wackest possible elimination

J0rdan S., Friday, 15 May 2015 02:14 (ten years ago)

The Kid Mero ‏@THEKIDMERO 26s27 seconds ago
BULLS GONNA HIRE SCOTT BROOKS FAV THIS TWEET WATCH

o...mg

lag∞n, Friday, 15 May 2015 02:24 (ten years ago)

sideline lady asking bron abt delverdover rn smh

lag∞n, Friday, 15 May 2015 02:26 (ten years ago)

lebron explain to me how one small wite can score 19pts in a game its... truly stunning

lag∞n, Friday, 15 May 2015 02:26 (ten years ago)

literally k3vin keller ended the thibs era, im distraught

J0rdan S., Friday, 15 May 2015 02:31 (ten years ago)

how cn u be so coldhearted kevin congrats tho btw great game

lag∞n, Friday, 15 May 2015 02:32 (ten years ago)

the breakout star of the playoffs

J0rdan S., Friday, 15 May 2015 02:35 (ten years ago)

*bows*

k3vin k., Friday, 15 May 2015 02:36 (ten years ago)

clips seem to have come out in not fn around mode

lag∞n, Friday, 15 May 2015 02:46 (ten years ago)

and u know good for them close these jokers out

lag∞n, Friday, 15 May 2015 02:46 (ten years ago)

ya one can only handle so much houston

head clowning instructor (art), Friday, 15 May 2015 02:48 (ten years ago)

the last game had a distinct feel of last hurrah before the better team shuts the series down

J0rdan S., Friday, 15 May 2015 02:48 (ten years ago)

ya

lag∞n, Friday, 15 May 2015 02:48 (ten years ago)

redick has been SO cold this series, wtf

k3vin k., Friday, 15 May 2015 02:52 (ten years ago)

it'll be fun to see the dubs wax them

slothroprhymes, Friday, 15 May 2015 02:52 (ten years ago)

rude

lag∞n, Friday, 15 May 2015 02:52 (ten years ago)

gonna be a good series, no love lost etc

head clowning instructor (art), Friday, 15 May 2015 02:53 (ten years ago)

blake gonna take some hard tumbles in the wcf for sure

Clay, Friday, 15 May 2015 02:54 (ten years ago)

would honestly be more fun if there was a grizz upset and we got to see zach randolph literally extract and eat blake griffin's heart on live television last of the mohicans style

totes gonna settle for watching their death by rain of 3 point fire tho

slothroprhymes, Friday, 15 May 2015 02:55 (ten years ago)

paul is unbelievable

lag∞n, Friday, 15 May 2015 03:06 (ten years ago)

announcers were just talking abt the developers developers developers video

lag∞n, Friday, 15 May 2015 03:08 (ten years ago)

this game has gotten weird since the benches came in theyre just like letting each other take whatever shot and missing

lag∞n, Friday, 15 May 2015 03:19 (ten years ago)

dre made a great catch of a very low rivers pass in traffic then went right up for the dunk it was nice

lag∞n, Friday, 15 May 2015 03:21 (ten years ago)

jeeze the rockets must really wanna lose game 7 in front of their fans :/

Heroic melancholy continues to have a forceful grip on (bernard snowy), Friday, 15 May 2015 03:28 (ten years ago)

how come the director never notices blake brought his kia to the shoot until after theyre rolling doesnt seem that realistic

lag∞n, Friday, 15 May 2015 03:31 (ten years ago)

how come james harden didn't notice he was in the playoffs until the 2nd quarter of game 6

Heroic melancholy continues to have a forceful grip on (bernard snowy), Friday, 15 May 2015 03:31 (ten years ago)

clips cant buy a three

lag∞n, Friday, 15 May 2015 03:32 (ten years ago)

how come james harden didn't notice he was in the playoffs until the 2nd quarter of game 6

― Heroic melancholy continues to have a forceful grip on (bernard snowy), Thursday, May 14, 2015 8:31 PM (1 minute ago) Bookmark Flag Post Permalink

harden's game doesn't translate as well to the playoffs as most other wings bc it's really rooted in a couple of gimmicks that can be compensated for when a coach has time to focus on it and drill his guys on it

Clay, Friday, 15 May 2015 03:34 (ten years ago)

@kpelton: The Clippers still don't seem to have come to terms with the Rockets actually trying.

lag∞n, Friday, 15 May 2015 03:35 (ten years ago)

harden's played relatively well all playoffs, i haven't really looked at his numbers but i'd guess his usage is down 4-5 points

k3vin k., Friday, 15 May 2015 03:36 (ten years ago)

ha yeah it is weird how the clippers kind of have an entitled sensibility as a team even tho they've never been there before xp

Clay, Friday, 15 May 2015 03:36 (ten years ago)

down about 3 points. he def seems to be dominating the ball a little less

k3vin k., Friday, 15 May 2015 03:37 (ten years ago)

harden has played well but at no point has dominated

lag∞n, Friday, 15 May 2015 03:39 (ten years ago)

I thought he was about to start dominating after those 3s earlier

15 points in a swingy quarter is p.good if not 'dominant'

Heroic melancholy continues to have a forceful grip on (bernard snowy), Friday, 15 May 2015 03:40 (ten years ago)

except maybe this quarter

lag∞n, Friday, 15 May 2015 03:40 (ten years ago)

man imagine if crawford knew what a good shot was

lag∞n, Friday, 15 May 2015 03:41 (ten years ago)

https://vine.co/v/eKOjluTn2nH

k3vin k., Friday, 15 May 2015 03:41 (ten years ago)

lol otm

lag∞n, Friday, 15 May 2015 03:42 (ten years ago)

ha that is exactly what i see every time harden drives

Clay, Friday, 15 May 2015 03:43 (ten years ago)

lol the LA crowd is more into Howard missing those 2 FTs than anything else all night

Heroic melancholy continues to have a forceful grip on (bernard snowy), Friday, 15 May 2015 03:44 (ten years ago)

those were exceptional misses tbf

lag∞n, Friday, 15 May 2015 03:45 (ten years ago)

ugh it would be redick

Heroic melancholy continues to have a forceful grip on (bernard snowy), Friday, 15 May 2015 03:46 (ten years ago)

sick play

k3vin k., Friday, 15 May 2015 03:48 (ten years ago)

lol this very important playoff game contains no defense

lag∞n, Friday, 15 May 2015 03:48 (ten years ago)

that's not true, the Clippers are already planning their title defense!

Heroic melancholy continues to have a forceful grip on (bernard snowy), Friday, 15 May 2015 03:50 (ten years ago)

clips played w such intensity and focus v the spurs now theyre just all ok whatever go out there and do stuff i guess

lag∞n, Friday, 15 May 2015 03:53 (ten years ago)

maybe got a lil over confident cause their bench wasnt utter garbage for a couple games

lag∞n, Friday, 15 May 2015 03:55 (ten years ago)

siiick rejection

lag∞n, Friday, 15 May 2015 04:07 (ten years ago)

clips look engaged now

Clay, Friday, 15 May 2015 04:08 (ten years ago)

howard smh

lag∞n, Friday, 15 May 2015 04:08 (ten years ago)

i'm not sure that's like *flagrant* flagrant but it is hugely dumb

Clay, Friday, 15 May 2015 04:09 (ten years ago)

howard cldve made a play on the ball too he he had good position

lag∞n, Friday, 15 May 2015 04:11 (ten years ago)

gj dwight

head clowning instructor (art), Friday, 15 May 2015 04:11 (ten years ago)

just one of those things that's like "oh right one of dwight's defining characteristics is his childlike petulance in the face of frustration or adversity"

Clay, Friday, 15 May 2015 04:13 (ten years ago)

hoops god gotta punish rockets for that

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:14 (ten years ago)

lol i press submit and he's called for a tech for elbowing like 2 seconds later

Clay, Friday, 15 May 2015 04:14 (ten years ago)

lol dwight losing his mind

lag∞n, Friday, 15 May 2015 04:14 (ten years ago)

started typing that before the tech lmaooooo

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:15 (ten years ago)

haha nice job both of u

lag∞n, Friday, 15 May 2015 04:16 (ten years ago)

dwight literally going to spend summer in therapy just crying about how deandre is a big meanie head

Clay, Friday, 15 May 2015 04:16 (ten years ago)

my god if barnes or reddick cld hit a three this game wld be iber

lag∞n, Friday, 15 May 2015 04:18 (ten years ago)

dwight literally going to spend summer in therapymaking vines just crying about how deandre is a big meanie head

― Clay, Thursday, May 14, 2015 11:16 PM (1 minute ago) Bookmark Flag Post Permalink

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:18 (ten years ago)

wow i think the rockets literally are nWo

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:21 (ten years ago)

there's ... an entourage... movie?

Clay, Friday, 15 May 2015 04:24 (ten years ago)

no ty

head clowning instructor (art), Friday, 15 May 2015 04:26 (ten years ago)

yeah man i might do terrorism against it just a heads up

lag∞n, Friday, 15 May 2015 04:26 (ten years ago)

WOW BLAKE

lag∞n, Friday, 15 May 2015 04:27 (ten years ago)

OMG THAT BLAKE LAYUP OMG

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:27 (ten years ago)

he tore the roof off the mothersucker

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:27 (ten years ago)

clippers are beautiful rn

Clay, Friday, 15 May 2015 04:28 (ten years ago)

ya, i cant believe how mature and advanced i am now as an adult that i can watch this game for pleasure and not for spite

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:29 (ten years ago)

every single game i love the juxtaposition b/w how ballmer is dressed and how much money he has

Clay, Friday, 15 May 2015 04:29 (ten years ago)

rockets came out this half with very weird bad energy

lag∞n, Friday, 15 May 2015 04:30 (ten years ago)

okay holy shit this real life video games movie

i wish i was not a human sometimes

Clay, Friday, 15 May 2015 04:30 (ten years ago)

human culture is... not great

lag∞n, Friday, 15 May 2015 04:31 (ten years ago)

it's kind of a bummer really

Clay, Friday, 15 May 2015 04:32 (ten years ago)

wow the spin paul put on that layup

k3vin k., Friday, 15 May 2015 04:33 (ten years ago)

i feel like the 80s video game movie irl could be done well in the right hands (nolan would be hilarious). but the idea fell in the hands of adam sandler and kevin james so it will be horrific and boring.

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:33 (ten years ago)

pablo pressing paul is not too wise

lag∞n, Friday, 15 May 2015 04:34 (ten years ago)

im really appreciating how...alomst normal the la clippers crowd is compared to the starfuckery of lakers games

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:34 (ten years ago)

harden is shook right now, clippers have taken him out psychologically

head clowning instructor (art), Friday, 15 May 2015 04:35 (ten years ago)

srsly can steve ballmer not pay somebody a one-time fee to teach him how to not dress like a high school biology teacher. even walter white knew that solids are more flattering to bald domes.

Clay, Friday, 15 May 2015 04:36 (ten years ago)

i think it is in keeping with microsoft dudes being sartorially inept, kinda how bill gates has more money than god and dresses like a university librarian

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:37 (ten years ago)

tech titans are so into being above it all which like fine give me ur money and i will buy beautiful clothes

lag∞n, Friday, 15 May 2015 04:39 (ten years ago)

2 ri¢h 2 ¢are about how he look$

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:40 (ten years ago)

guess i just dont have the mindset of the world's true geniuses and masters

Clay, Friday, 15 May 2015 04:43 (ten years ago)

lag∞n: lemme dress u
ballmer: i dont understand
lag∞n: u look lame af
ballmer: *scratches armpit* why should that matter
lag∞n: ppl will make fun of you at clippers
balmer: *removes roll of $100 bills from pleats* i will pay them to like me
lag∞n: u cant...
balmer: *shoves wad of cash in lag∞n's mouth*
lag∞n: *muffled* ilu

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:43 (ten years ago)

lmaooo

lag∞n, Friday, 15 May 2015 04:44 (ten years ago)

that miller lite commercial is kinda like "millenials u have no money and your life is meaningless but brewskis brahhhhhh"

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:45 (ten years ago)

hah @ bise

Clay, Friday, 15 May 2015 04:45 (ten years ago)

ballmer probably gonna have to suit up once cp3's legs fall off in rd 3

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:47 (ten years ago)

love the basket ballmer cover so much

lag∞n, Friday, 15 May 2015 04:48 (ten years ago)

god crawford take one more dribble and you have a layup why r u dumb

k3vin k., Friday, 15 May 2015 04:48 (ten years ago)

he is so dumb

lag∞n, Friday, 15 May 2015 04:49 (ten years ago)

and so lazy on defense. always late to rotate and then reaches

k3vin k., Friday, 15 May 2015 04:50 (ten years ago)

lol big baby is so shook around the basket refuses to shoot for fear of getting blocked

lag∞n, Friday, 15 May 2015 04:51 (ten years ago)

just like me on twitter

Clay, Friday, 15 May 2015 04:54 (ten years ago)

seems like mchale should put harden in

k3vin k., Friday, 15 May 2015 04:58 (ten years ago)

just when i thought i was gonna go to bed....

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 04:59 (ten years ago)

lol austin rivers standing up like dad am i going back in?

k3vin k., Friday, 15 May 2015 04:59 (ten years ago)

this game is bizarre

lag∞n, Friday, 15 May 2015 05:00 (ten years ago)

hahahaha the clippers jumbotron has a picture of ballmer yelling that says "I CAN'T HEAR YOU!"

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 05:04 (ten years ago)

this game, j smoove hitting so many shots rn

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 05:06 (ten years ago)

what's even happening

Clay, Friday, 15 May 2015 05:06 (ten years ago)

it is so weird that harden is not playing in an elimination game like this

k3vin k., Friday, 15 May 2015 05:06 (ten years ago)

hoops lucy having his way with this game

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 05:07 (ten years ago)

wow why would mchale call a timeout NOW??

k3vin k., Friday, 15 May 2015 05:08 (ten years ago)

tirico said dwight was calling for a breather

Clay, Friday, 15 May 2015 05:08 (ten years ago)

ah

k3vin k., Friday, 15 May 2015 05:09 (ten years ago)

clips go away from their sets when they get tight. so much ball stoppage

k3vin k., Friday, 15 May 2015 05:13 (ten years ago)

yeah also attempting to run out the clock for the whole quarter was not wise

lag∞n, Friday, 15 May 2015 05:14 (ten years ago)

harden on the bench too wow

lag∞n, Friday, 15 May 2015 05:15 (ten years ago)

you know who's played some pretty solid defense this series is terry

k3vin k., Friday, 15 May 2015 05:15 (ten years ago)

omg josh smith

k3vin k., Friday, 15 May 2015 05:16 (ten years ago)

josh smith is doing it all what

Clay, Friday, 15 May 2015 05:16 (ten years ago)

this is incredible

k3vin k., Friday, 15 May 2015 05:16 (ten years ago)

game 7 huh

head clowning instructor (art), Friday, 15 May 2015 05:16 (ten years ago)

humiliating!

lag∞n, Friday, 15 May 2015 05:16 (ten years ago)

this is like blazers vs lakers 2000 wcf level collapse

Clay, Friday, 15 May 2015 05:16 (ten years ago)

24-2 run by the rockets

k3vin k., Friday, 15 May 2015 05:18 (ten years ago)

gollyyyyyyyyy
clippers lack of gas caught the fuck up with them

not a garbageman, i am garbage, man (m bison), Friday, 15 May 2015 05:19 (ten years ago)

doc just put austin in

k3vin k., Friday, 15 May 2015 05:20 (ten years ago)

rockets shd bench harden for game 7

lag∞n, Friday, 15 May 2015 05:21 (ten years ago)

this game is bizarre

― lag∞n, Friday, May 15, 2015 1:00 AM (22 minutes ago) Bookmark Flag Post Permalink

lag∞n, Friday, 15 May 2015 05:23 (ten years ago)

rockets looked so ready for the offseason!

lag∞n, Friday, 15 May 2015 05:23 (ten years ago)

they really did look like they dngaf in q's 2 & 3

Clay, Friday, 15 May 2015 05:24 (ten years ago)

https://pbs.twimg.com/media/CFBdaU4UkAAaUBA.jpg

lag∞n, Friday, 15 May 2015 05:25 (ten years ago)

Hannibal Buress ‏@hannibalburess 8m8 minutes ago
I'm at staples center and people are leaving. It's because of a Josh Smith dagger step back 3. And two before that. That's crazy.

lag∞n, Friday, 15 May 2015 05:26 (ten years ago)

📎🔫

Clay, Friday, 15 May 2015 05:27 (ten years ago)

https://pbs.twimg.com/media/CFBfycgUEAApfzK.jpg

lag∞n, Friday, 15 May 2015 05:31 (ten years ago)

Wtf just happened! Crazy comeback. So happy for a game 7.

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 06:42 (ten years ago)

Clippers are so weird

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 06:43 (ten years ago)

No harden in the 4th blowing my mind

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 06:43 (ten years ago)

Reddick and Barnes slumping at the wrong time.

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 06:45 (ten years ago)

If the clips lose game 7 they have to fire doc

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 07:04 (ten years ago)

damn it I fell asleep and missed josh smith hero ball/a clippers collapse what the hell

I'm gonna have to watch a condensed game of this shit

slothroprhymes, Friday, 15 May 2015 10:35 (ten years ago)

floyd mayweather and shelly sterling were both there perhaps their inherent evil poisoned the clips

slothroprhymes, Friday, 15 May 2015 10:45 (ten years ago)

what the hell

J0rdan S., Friday, 15 May 2015 13:23 (ten years ago)

sick of both these teams

call all destroyer, Friday, 15 May 2015 13:53 (ten years ago)

this series has been not great but hey game seven who can really complain

lag∞n, Friday, 15 May 2015 13:54 (ten years ago)

Trendsmap LosAngeles ‏@TrendsLA
#chokecity is now trending in #LA http://trendsmap.com/us/los+angeles

slothroprhymes, Friday, 15 May 2015 14:34 (ten years ago)

can't believe how bad the Clips choked. i just wanted the series to be over!

Nhex, Friday, 15 May 2015 14:41 (ten years ago)

https://pbs.twimg.com/media/CFDlKl0UMAECFEw.jpg

good times, better days

lag∞n, Friday, 15 May 2015 15:14 (ten years ago)

This thread is too big! How do yall read all the posts from last night on an iphone without having to scroll 50000 times? Is there a way to change the number of messages that will appear when it's in "Skipping ##### message at this point. Click here if you want to load them all" mode?

Mr. Snrub, Friday, 15 May 2015 15:29 (ten years ago)

use bookmarks

lag∞n, Friday, 15 May 2015 15:30 (ten years ago)

thanks. ok so i bookmarked a message from a couple days ago and that's cool that i don't have to scroll as much. but it's not really a perfect solution because as the thread grows the bookmark will be filtering a less percentage of the total page. then i'll need to keep adding more bookmarks as the thread gets bigger and bigger. it would be really awesome if ilx had a preferences menu where i could change the default thread filter percentage.

Mr. Snrub, Friday, 15 May 2015 15:46 (ten years ago)

Bookmark just bookmarks the last post you've read. There's only one bookmark per thread (afaik).

schwantz, Friday, 15 May 2015 16:33 (ten years ago)

yea

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 16:36 (ten years ago)

thanks. ok so i bookmarked a message from a couple days ago and that's cool that i don't have to scroll as much. but it's not really a perfect solution because as the thread grows the bookmark will be filtering a less percentage of the total page. then i'll need to keep adding more bookmarks as the thread gets bigger and bigger. it would be really awesome if ilx had a preferences menu where i could change the default thread filter percentage.

― Mr. Snrub, Friday, May 15, 2015 11:46 AM (1 hour ago) Bookmark

my man

J0rdan S., Friday, 15 May 2015 16:57 (ten years ago)

jusr bookmark the last post u read everytime cmon folks

lag∞n, Friday, 15 May 2015 17:17 (ten years ago)

v simple

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 17:21 (ten years ago)

just don't ever read this trash on a phone v simple

A True White Kid that can Jump (Granny Dainger), Friday, 15 May 2015 18:18 (ten years ago)

if you're not going to read from your last bookmark, open the thread from SNA and just start from top of the current page. It is annoying that the current page is based on post # and not on a time difference between posts, though.

Mr. Murphy in the wine bar. (Sufjan Grafton), Friday, 15 May 2015 18:31 (ten years ago)

📎🔫

― Clay, Friday, May 15, 2015 1:27 AM (13 hours ago) Bookmark

otm

juice college (agent hibachi), Friday, 15 May 2015 19:12 (ten years ago)

i dont understand what happened in that game blake wanted no part of an entire quarter and josh smith turned into the mvp

juice college (agent hibachi), Friday, 15 May 2015 19:13 (ten years ago)

clippers just laid down and died

check out this insane slothroprhymes yall (Spottie), Friday, 15 May 2015 20:06 (ten years ago)

Thibodeau, he is stubborn in demanding of himself, meaning he feels he can do everything. Since Ron Adams was let go as an assistant, I know the Bulls have begged Thibodeau to add someone to run the offense, or at least be an offensive mind to work with. Thibodeau has declined.

feel like Thibs doesn't have the makeup to be a great coach, unless we're only counting reg season games.

A True White Kid that can Jump (Granny Dainger), Friday, 15 May 2015 22:16 (ten years ago)

Was Adams the offensive guy with Chicago? He's taking care of the D with the Warriors.

Madison Dumbbarfer (Leee), Friday, 15 May 2015 22:32 (ten years ago)

cawcaw

slothroprhymes, Saturday, 16 May 2015 00:38 (ten years ago)

wittman: "i coach by feel"

micah, Saturday, 16 May 2015 00:51 (ten years ago)

Hawks hawking again

Heez, Saturday, 16 May 2015 00:58 (ten years ago)

Beal wrecking shop here, tho a very Kobe esque unnecessary jumper with lots of time left a possession ago

juice college (agent hibachi), Saturday, 16 May 2015 01:15 (ten years ago)

oh come the fuck on

slothroprhymes, Saturday, 16 May 2015 01:18 (ten years ago)

why must the hawks make everything so fucking hard for themselves

slothroprhymes, Saturday, 16 May 2015 01:19 (ten years ago)

love the wiz relentless pushing down the stretch

lag∞n, Saturday, 16 May 2015 01:20 (ten years ago)

wiz should be up by 6 right now

micah, Saturday, 16 May 2015 01:22 (ten years ago)

but they're baaaddddddd inherently and should not be rewarded come on

slothroprhymes, Saturday, 16 May 2015 01:22 (ten years ago)

they're not that bad

call all destroyer, Saturday, 16 May 2015 01:23 (ten years ago)

they're a shittily coached long-2 taking archaic-ass team with one transcendent talent, one budding transcendent talent and the beloved paul pierce like wtf just roll over hawks earned this

slothroprhymes, Saturday, 16 May 2015 01:24 (ten years ago)

if they score more points they win is how i break it down

lag∞n, Saturday, 16 May 2015 01:24 (ten years ago)

like wittman found a genius offensive tactic in the raptors series and won't even use it now he's inherently dumb and bad

slothroprhymes, Saturday, 16 May 2015 01:25 (ten years ago)

if they score more points they win is how i break it down
--lag∞n

tbf this is an unarguable point but oy fuckin vey

slothroprhymes, Saturday, 16 May 2015 01:26 (ten years ago)

lol got home just in time for this huh

Clay, Saturday, 16 May 2015 01:26 (ten years ago)

one transcendent talent, one budding transcendent talent and the beloved paul pierce

you make them sound pretty fn' good here

call all destroyer, Saturday, 16 May 2015 01:26 (ten years ago)

right but then we have randy wittman coaching and how is that any better than brooksie coaching russ and KD?

slothroprhymes, Saturday, 16 May 2015 01:27 (ten years ago)

A little too much nene here though he's doing good rebounding work but handling the ball and shooting too much

juice college (agent hibachi), Saturday, 16 May 2015 01:28 (ten years ago)

i mean i mostly root for players, not coaches, i'm not rooting against the wiz b/c wittman is a dope. they have a bunch of good tough guys on their team.

call all destroyer, Saturday, 16 May 2015 01:29 (ten years ago)

Horford's been playing great on d

Heez, Saturday, 16 May 2015 01:30 (ten years ago)

dude no way

Clay, Saturday, 16 May 2015 01:34 (ten years ago)

o no

brownie, Saturday, 16 May 2015 01:34 (ten years ago)

AHHHHHHHHHHHHHHHHHHHH

k3vin k., Saturday, 16 May 2015 01:34 (ten years ago)

g;qwnfqiuwfbwilfbwifbwibfelwbwlbfwfs

k3vin k., Saturday, 16 May 2015 01:34 (ten years ago)

lol DA TROOF

juice college (agent hibachi), Saturday, 16 May 2015 01:35 (ten years ago)

no good!

k3vin k., Saturday, 16 May 2015 01:35 (ten years ago)

Oh no that's not gonna count

juice college (agent hibachi), Saturday, 16 May 2015 01:35 (ten years ago)

yea that's no basket

slothroprhymes, Saturday, 16 May 2015 01:36 (ten years ago)

pp is my personal jesus

lag∞n, Saturday, 16 May 2015 01:36 (ten years ago)

wow

brownie, Saturday, 16 May 2015 01:36 (ten years ago)

they shd count it just for fun

lag∞n, Saturday, 16 May 2015 01:36 (ten years ago)

well thats a shit way to lose a game

Clay, Saturday, 16 May 2015 01:37 (ten years ago)

what a way to lose

brownie, Saturday, 16 May 2015 01:37 (ten years ago)

holy shit omg

johnny crunch, Saturday, 16 May 2015 01:37 (ten years ago)

ah well

micah, Saturday, 16 May 2015 01:37 (ten years ago)

aww

call all destroyer, Saturday, 16 May 2015 01:37 (ten years ago)

they shd count it just for fun

― lag∞n, Friday, May 15, 2015 9:36 PM (33 seconds ago) Bookmark Flag Post Permalink

Otm should just be commissioners discretion just send them to game 7 why not

juice college (agent hibachi), Saturday, 16 May 2015 01:38 (ten years ago)

was in agony a few seconds ago but i think i like it better this way. SERIES.

balls, Saturday, 16 May 2015 01:38 (ten years ago)

go hawks u must beat the dreaded lebron

Clay, Saturday, 16 May 2015 01:38 (ten years ago)

Or let the wiz lend pierce to atl to go against Lebron

juice college (agent hibachi), Saturday, 16 May 2015 01:38 (ten years ago)

you knew that time would catch up w/ you someday you son of a bitch

balls, Saturday, 16 May 2015 01:38 (ten years ago)

was hoping 4 game7

lag∞n, Saturday, 16 May 2015 01:39 (ten years ago)

was in agony a few seconds ago but i think i like it better this way. SERIES.
--balls

this is historic for y'all and that's dope, congrats man

slothroprhymes, Saturday, 16 May 2015 01:40 (ten years ago)

hope hawks can find their form enough to beat teh cavs

lag∞n, Saturday, 16 May 2015 01:43 (ten years ago)

rip griz

Clay, Saturday, 16 May 2015 01:44 (ten years ago)

ha thinking the same

lag∞n, Saturday, 16 May 2015 01:44 (ten years ago)

As a DC resident I'm psyched about this becoming a rivalry. Gonna strut my shit around this town w my hawks gear on tmrw. Great series

Heez, Saturday, 16 May 2015 01:45 (ten years ago)

griz daring barnes to to beat them all series and he is

lag∞n, Saturday, 16 May 2015 01:46 (ten years ago)

barnes on zach? with bogut pretend guarding allen idgi

lag∞n, Saturday, 16 May 2015 01:48 (ten years ago)

guess the theory is bogut can just hang around the rim but barnes cant take zbo

lag∞n, Saturday, 16 May 2015 01:49 (ten years ago)

theyre just doubling int he post every time anyway i guess

lag∞n, Saturday, 16 May 2015 01:49 (ten years ago)

packing the paint seems like the only real strategy vs the griz

Clay, Saturday, 16 May 2015 01:52 (ten years ago)

dubs are rolling

k3vin k., Saturday, 16 May 2015 01:54 (ten years ago)

jesus idk bout this game

lag∞n, Saturday, 16 May 2015 01:54 (ten years ago)

oh man steph

k3vin k., Saturday, 16 May 2015 02:02 (ten years ago)

how did the griz win two games

lag∞n, Saturday, 16 May 2015 02:04 (ten years ago)

single digit game folks !!!!!!!!

lag∞n, Saturday, 16 May 2015 02:23 (ten years ago)

(now 13)

call all destroyer, Saturday, 16 May 2015 02:26 (ten years ago)

Hope Stephen isn't injured too bad

, Saturday, 16 May 2015 02:30 (ten years ago)

That was literally the ugliest shot I have ever seen

, Saturday, 16 May 2015 02:42 (ten years ago)

what was the beat on that adidas ad

johnny crunch, Saturday, 16 May 2015 02:52 (ten years ago)

4 pt game

lag∞n, Saturday, 16 May 2015 03:07 (ten years ago)

grizz are hanging around

call all destroyer, Saturday, 16 May 2015 03:10 (ten years ago)

david lee really needs to come out

k3vin k., Saturday, 16 May 2015 03:11 (ten years ago)

i have a date and might miss the end of this, why can't someone just blow someone out so i dont have to be anxious abt it later

Clay, Saturday, 16 May 2015 03:12 (ten years ago)

go on your date!

k3vin k., Saturday, 16 May 2015 03:14 (ten years ago)

still love z-bo

call all destroyer, Saturday, 16 May 2015 03:14 (ten years ago)

talk about NBA with her see how that goes over

k3vin k., Saturday, 16 May 2015 03:14 (ten years ago)

go on your date!

― k3vin k., Friday, May 15, 2015 11:14 PM (34 seconds ago) Bookmark Flag Post Permalink

just tream during the date and tell her u r "giving her a preview" of yr future relationship

lag∞n, Saturday, 16 May 2015 03:15 (ten years ago)

green have four fouls

lag∞n, Saturday, 16 May 2015 03:16 (ten years ago)

oh i don't have to leave for an hour or so but thx for your concern

Clay, Saturday, 16 May 2015 03:18 (ten years ago)

just tream during the date and tell her u r "giving her a preview" of yr future relationship

― lag∞n, Friday, May 15, 2015 8:15 PM (3 minutes ago) Bookmark Flag Post Permalink

lol aint that the truth.

prob dont wanna talk to civilians abt basketball too much bc i probably come across like idk what would an ilm person would sound like if u asked them what kind of music they like at a party

Clay, Saturday, 16 May 2015 03:21 (ten years ago)

lol otm

lag∞n, Saturday, 16 May 2015 03:22 (ten years ago)

i have a date and might miss the end of this, why can't someone just blow someone out so i dont have to be anxious abt it later

Wow sounds like you don't want to blow someone out later tn

, Saturday, 16 May 2015 03:24 (ten years ago)

OMG STEPH

k3vin k., Saturday, 16 May 2015 03:25 (ten years ago)

HELLO EVERYBODY

Clay, Saturday, 16 May 2015 03:25 (ten years ago)

that was bs

call all destroyer, Saturday, 16 May 2015 03:25 (ten years ago)

omg

johnny crunch, Saturday, 16 May 2015 03:25 (ten years ago)

Hahahahahahahahahahahahahahaha

, Saturday, 16 May 2015 03:25 (ten years ago)

lol steph is god

lag∞n, Saturday, 16 May 2015 03:26 (ten years ago)

lol refs

moullet, Saturday, 16 May 2015 03:26 (ten years ago)

ya srsly

lag∞n, Saturday, 16 May 2015 03:26 (ten years ago)

griz fans should be chanting mvp for steph after that like just out of respect

Clay, Saturday, 16 May 2015 03:26 (ten years ago)

i thought that was a clean block?

k3vin k., Saturday, 16 May 2015 03:27 (ten years ago)

i rewatched it and yeah it looks fairly clean, maybe there was contact on his body or something?

Clay, Saturday, 16 May 2015 03:29 (ten years ago)

seemed like a lot of body contact to me

call all destroyer, Saturday, 16 May 2015 03:31 (ten years ago)

wow terrible call

k3vin k., Saturday, 16 May 2015 03:48 (ten years ago)

steph is cruel

lag∞n, Saturday, 16 May 2015 03:48 (ten years ago)

look upon my works ye mighty and despair
-- steph curry

Clay, Saturday, 16 May 2015 03:50 (ten years ago)

Phil Jackson ‏@PhilJackson11 May 10
NBA analysts give me some diagnostics on how 3pt oriented teams are faring this playoffs...seriously, how's it goink?

k3vin k., Saturday, 16 May 2015 03:52 (ten years ago)

pretty good overall phil

lag∞n, Saturday, 16 May 2015 03:56 (ten years ago)

m bise can "how's it goink" plz be the new board description

k3vin k., Saturday, 16 May 2015 03:56 (ten years ago)

Marc Stein ‏@ESPNSteinLine 13s14 seconds ago
Grizzlies have three 3-pointers. Steph Curry has eight.

lag∞n, Saturday, 16 May 2015 03:57 (ten years ago)

rip grizz :(

call all destroyer, Saturday, 16 May 2015 03:58 (ten years ago)

they shd think abt acquiring some shooters

lag∞n, Saturday, 16 May 2015 03:59 (ten years ago)

seriously, conley/zbo/marc plus two guys who can shoot 3s well

call all destroyer, Saturday, 16 May 2015 04:01 (ten years ago)

Chris Herring ‏@HerringWSJ 4m4 minutes ago
We could end up with a conference finals matchups that feature tms that ranked No. 1, 2, 3 and 6 in regular season 3PT%. So how's it goink?

lag∞n, Saturday, 16 May 2015 04:02 (ten years ago)

2 out of the 3 longest conf finals droughts were broken tonight :)

lag∞n, Saturday, 16 May 2015 04:13 (ten years ago)

👍

balls, Saturday, 16 May 2015 04:19 (ten years ago)

my championship rooting interest atm: warriors>hawks>>>>>cavs>>>>>>>>>clippers>>>>>>>rockets

call all destroyer, Saturday, 16 May 2015 04:24 (ten years ago)

Phil Jackson ‏@PhilJackson11 May 10
NBA analysts give me some diagnostics on how 3pt oriented teams are faring this playoffs...seriously, how's it goink?

― k3vin k., Friday, May 15, 2015 8:52 PM (37 minutes ago) Bookmark Flag Post Permalink

Hubie rubbing it in too

check out this insane slothroprhymes yall (Spottie), Saturday, 16 May 2015 04:31 (ten years ago)

reasonable priorities imo

slothroprhymes, Saturday, 16 May 2015 04:32 (ten years ago)

(xp)

slothroprhymes, Saturday, 16 May 2015 04:33 (ten years ago)

#goink is popping up now

call all destroyer, Saturday, 16 May 2015 04:33 (ten years ago)

i hate phil jackson, i'm really just experiencing that feeling right now

call all destroyer, Saturday, 16 May 2015 04:33 (ten years ago)

Kerr made some primetime adjustments to swing the series back.

check out this insane slothroprhymes yall (Spottie), Saturday, 16 May 2015 04:35 (ten years ago)

this is unreal
https://vine.co/v/eKxx1nIQ9Ta

check out this insane slothroprhymes yall (Spottie), Saturday, 16 May 2015 04:59 (ten years ago)

poor grizz fans too

check out this insane slothroprhymes yall (Spottie), Saturday, 16 May 2015 04:59 (ten years ago)

the crowd shock reactions to that were so great

Nhex, Saturday, 16 May 2015 05:27 (ten years ago)

pierce sounding like retirement is very much a possibility in the postgame - http://www.monumentalnetwork.com/videos/paul-pierce-postgame-5-15-15. i don't think he's the 'final piece' or anything but from what i've seen this postseason this dude definitely would be useful on a contender next year. pierce on the grizz would be a fun team, very very easy to root for.

balls, Saturday, 16 May 2015 05:38 (ten years ago)

pierce is such a dickhead i can't really ever 100% root for him, but he was great for these playoffs

Nhex, Saturday, 16 May 2015 06:00 (ten years ago)

he should come back to boston as the prodigal celtic, brad can always get a lot out of grizzled vets

slothroprhymes, Saturday, 16 May 2015 12:55 (ten years ago)

2 out of the 3 longest conf finals droughts were broken tonight :)

― lag∞n, Saturday, May 16, 2015 12:13 AM (11 hours ago) Bookmark Flag Post Permalink

just realized the third one is... the clippers!

lag∞n, Saturday, 16 May 2015 15:31 (ten years ago)

(wiz is 4th btw)

lag∞n, Saturday, 16 May 2015 15:32 (ten years ago)

Washington Wiz Khalifahs.

Madison Dumbbarfer (Leee), Saturday, 16 May 2015 16:01 (ten years ago)

what a weird series

https://pbs.twimg.com/media/CFJxDTVUUAEATa3.jpg

Matt Armstrong, Saturday, 16 May 2015 21:16 (ten years ago)

https://twitter.com/sheaserrano/status/599960677982212096

slothroprhymes, Sunday, 17 May 2015 19:02 (ten years ago)

otm

lag∞n, Sunday, 17 May 2015 19:29 (ten years ago)

Feel like either clips or rocks gonna get blown the f out of the conf finals by the dubs

juice college (agent hibachi), Sunday, 17 May 2015 19:31 (ten years ago)

nervous for cp3

Clay, Sunday, 17 May 2015 19:32 (ten years ago)

if the clips lose today its gonna be super embarrassing for the spurs

lag∞n, Sunday, 17 May 2015 19:34 (ten years ago)

paul passed up like 5 open threes last game he need to take those today

lag∞n, Sunday, 17 May 2015 19:35 (ten years ago)

Would say lol Dwight /josh fast break but it worked

juice college (agent hibachi), Sunday, 17 May 2015 19:37 (ten years ago)

love the begining of a game seven when everyone is tripping balls

lag∞n, Sunday, 17 May 2015 19:39 (ten years ago)

clips need a 40-15-5 from cp3 today

lag∞n, Sunday, 17 May 2015 19:46 (ten years ago)

love this matchup

http://www3.pictures.gi.zimbio.com/Chris+Paul+Pablo+Prigioni+Olympics+Day+14+Ia78pnyKMuLl.jpg

moullet, Sunday, 17 May 2015 19:57 (ten years ago)

if the clips played like the did v the spurs they wldve swept this series

lag∞n, Sunday, 17 May 2015 20:05 (ten years ago)

idk maaaaan

lag∞n, Sunday, 17 May 2015 20:06 (ten years ago)

clippers have 21 points

lag∞n, Sunday, 17 May 2015 20:07 (ten years ago)

lol chris & blake emotional breakdown

moullet, Sunday, 17 May 2015 20:09 (ten years ago)

josh smith, unacceptable

lag∞n, Sunday, 17 May 2015 20:11 (ten years ago)

crawford keeping the clips in this lol

lag∞n, Sunday, 17 May 2015 20:12 (ten years ago)

the josh smith - dwight pairing power up boost is bonkers

moullet, Sunday, 17 May 2015 20:17 (ten years ago)

also brings out the best high school intensity from JET

moullet, Sunday, 17 May 2015 20:18 (ten years ago)

cp with 0 assists

micah, Sunday, 17 May 2015 20:22 (ten years ago)

I hope they call Clint acapella in the locker room

, Sunday, 17 May 2015 20:22 (ten years ago)

poor doc, desperately trying to inject heart into a soulless team

micah, Sunday, 17 May 2015 20:49 (ten years ago)

Reddixk has harden read

, Sunday, 17 May 2015 20:59 (ten years ago)

3 point gaame

lag∞n, Sunday, 17 May 2015 21:01 (ten years ago)

Feel like i should buy a lotto ticket every time I see josh smith hit a 3

, Sunday, 17 May 2015 21:07 (ten years ago)

Iike it just has to be my lucky day

, Sunday, 17 May 2015 21:07 (ten years ago)

this game es frustrate

lag∞n, Sunday, 17 May 2015 21:16 (ten years ago)

i ceed the rest of the playoffs to the dubs

lag∞n, Sunday, 17 May 2015 21:16 (ten years ago)

cede, dubs

lag∞n, Sunday, 17 May 2015 21:20 (ten years ago)

advice 2 blake (or anyone really) do throw oops to big babe

lag∞n, Sunday, 17 May 2015 21:22 (ten years ago)

do not

lag∞n, Sunday, 17 May 2015 21:22 (ten years ago)

wow what a shitshow for clips. blake is super predictable out there on offense.

A True White Kid that can Jump (Granny Dainger), Sunday, 17 May 2015 21:24 (ten years ago)

yung pablo doing everything right now

micah, Sunday, 17 May 2015 21:24 (ten years ago)

clips have looked exhausted for much of this series, beating the spurs w no bench was too much for them

lag∞n, Sunday, 17 May 2015 21:25 (ten years ago)

prigiii
monster!

moullet, Sunday, 17 May 2015 21:26 (ten years ago)

wow I got home from work just in time to watch the door slam shut in the Clippers' faces :/

Heroic melancholy continues to have a forceful grip on (bernard snowy), Sunday, 17 May 2015 21:27 (ten years ago)

Dj missing that dunk means this game is over

, Sunday, 17 May 2015 21:32 (ten years ago)

they're not necessarily playing more minutes than they did in the reg season (blake's playing a couple more and redick's playing a lot more) but def shows the limitations of a thin team.

call all destroyer, Sunday, 17 May 2015 21:37 (ten years ago)

in this game pablo prigioni ends chris paul career

moullet, Sunday, 17 May 2015 21:41 (ten years ago)

yeah but the playoffs just so much more intense, back to back seven game series they just looked at least for much of the series totally gassed

lag∞n, Sunday, 17 May 2015 21:44 (ten years ago)

gave up late leads in 2 games etc etc

lag∞n, Sunday, 17 May 2015 21:45 (ten years ago)

meanwhile the beat a much better team one round earlier by playing m/l flawless basketball

lag∞n, Sunday, 17 May 2015 21:47 (ten years ago)

lol I forgot this game was early :(

Clay, Sunday, 17 May 2015 22:00 (ten years ago)

ya they look phys/emo drained

A True White Kid that can Jump (Granny Dainger), Sunday, 17 May 2015 22:01 (ten years ago)

How is it an 11 point game now

, Sunday, 17 May 2015 22:01 (ten years ago)

over/under dubs games lost the rest of the way .5

lag∞n, Sunday, 17 May 2015 22:03 (ten years ago)

They'll lose one or two bc it happens but that's it

Clay, Sunday, 17 May 2015 22:03 (ten years ago)

ok i turned the game back on

lag∞n, Sunday, 17 May 2015 22:04 (ten years ago)

modified hacka

lag∞n, Sunday, 17 May 2015 22:07 (ten years ago)

gone fishin

A True White Kid that can Jump (Granny Dainger), Sunday, 17 May 2015 22:10 (ten years ago)

welp

lag∞n, Sunday, 17 May 2015 22:10 (ten years ago)

lol that reddick three

lag∞n, Sunday, 17 May 2015 22:10 (ten years ago)

I went to see mad max instead of watching this game feel like that was a solid choice

slothroprhymes, Sunday, 17 May 2015 22:11 (ten years ago)

def

lag∞n, Sunday, 17 May 2015 22:11 (ten years ago)

rip clips u played one great series and then um...

lag∞n, Sunday, 17 May 2015 22:12 (ten years ago)

http://streamable.com/iiqq

moullet, Sunday, 17 May 2015 22:12 (ten years ago)

can't believe this shit evil rockets team is gonna be in the wcf

Clay, Sunday, 17 May 2015 22:13 (ten years ago)

could not watch this game but ugh

k3vin k., Sunday, 17 May 2015 22:14 (ten years ago)

http://streamable.com/iiqq🔗

his nba epitaph should read "here lies chris paul, a transcendent talent who will instead be remembered as a borderline cheat. he never made the conference finals."

― le goon (J0rdan S.), Tuesday, May 13, 2014 9:53 PM (11 months ago) Bookmark Flag Post Permalink

not 2 rub it in but

Clay, Sunday, 17 May 2015 22:16 (ten years ago)

omg u alls enthusiasm for the stupidest shit is bottomless we shd just forward this url to a live espn feed

lag∞n, Sunday, 17 May 2015 22:18 (ten years ago)

http://streamable.com/iiqq

― moullet, Monday, 18 May 2015 08:12

all time

micah, Sunday, 17 May 2015 22:19 (ten years ago)

:)

Clay, Sunday, 17 May 2015 22:20 (ten years ago)

i personally think the clips didnt win because they didnt want it enough or maybe they dont have enough character not because their is a terrible gm who cldnt assemble anything resembling an nba bench

lag∞n, Sunday, 17 May 2015 22:20 (ten years ago)

also portland will never win anything because they have some sort of organizational knee injury

lag∞n, Sunday, 17 May 2015 22:21 (ten years ago)

I knew that would go over well

Clay, Sunday, 17 May 2015 22:23 (ten years ago)

here https://www.reddit.com/r/nba

lag∞n, Sunday, 17 May 2015 22:24 (ten years ago)

what more could Paul have done to improve the clips chances here legitimate q

only thing i can think is wrap up his time machine to go back and make sure doc doesn't get to assemble a bench of out of shape zombies

head clowning instructor (art), Sunday, 17 May 2015 22:24 (ten years ago)

https://vine.co/v/eAAAp5jzYUZ

, Sunday, 17 May 2015 22:26 (ten years ago)

memes r good love memes plz more memes itt

lag∞n, Sunday, 17 May 2015 22:27 (ten years ago)

u guys chill I was just poking the bear

tho losing game 6 was an unforgivable choke job, the clips mostly lost bc they had zero bench, Matt Barnes couldn't hit anything at all, and they were completely gassed.

Clay, Sunday, 17 May 2015 22:27 (ten years ago)

damn goon is bitter about this loss huh

balls, Sunday, 17 May 2015 22:28 (ten years ago)

memes r good love memes plz more memes itt

Are you talking about the video clip of cp3 looking silly because this isn't a meme per se

Matt Armstrong, Sunday, 17 May 2015 22:29 (ten years ago)

We should all move on and treat the State Farm ad guy with the respect he deserves RIP

Matt Armstrong, Sunday, 17 May 2015 22:30 (ten years ago)

p sure its already a meme cn tell by the comedy soundtracking of it

lag∞n, Sunday, 17 May 2015 22:31 (ten years ago)

damn goon is bitter about this loss huh

― balls, Sunday, May 17, 2015 6:28 PM (2 minutes ago) Bookmark Flag Post Permalink

wow u mad

lag∞n, Sunday, 17 May 2015 22:31 (ten years ago)

Wow I thought goon was the mad one but he says other guy is

Matt Armstrong, Sunday, 17 May 2015 22:33 (ten years ago)

this is def a collective late series collapse not any failure you could pin on one specific player

slothroprhymes, Sunday, 17 May 2015 22:34 (ten years ago)

im checking my internet manual for which sick own to employ in the case of a u mad standoff

lag∞n, Sunday, 17 May 2015 22:35 (ten years ago)

trying to google for trademark hawks superfan

lag∞n, Sunday, 17 May 2015 22:37 (ten years ago)

hopefully i can find one of those good pictures with the block lettering on it

lag∞n, Sunday, 17 May 2015 22:38 (ten years ago)

no games til Wednesday so at least we've got something contentious to bicker about for a couple days thank god

Clay, Sunday, 17 May 2015 22:39 (ten years ago)

clips got tight and bench was what we knew it was, rockets got some unlikely hotness. there can be that weird hangover when you blow a series ender, not to buy into momentum or whatever too much but it does seem like there can be this weird shift in pressure and if you're a team that's already buying into certain narratives (and chris paul after game 7 against the spurs would seem to indicate as much) then it could affect you i guess. gonna be so weird if the rockets do make the finals, i have a hard time thinking of another recent #2 seed that was given so little chance to make the finals w/o a huge injury or late season swoon.

balls, Sunday, 17 May 2015 22:39 (ten years ago)

i enjoy the work of chris tucker but idk

lag∞n, Sunday, 17 May 2015 22:41 (ten years ago)

no games til Wednesday so at least we've got something contentious to bicker about for a couple days thank god
--Clay

WCF begin Tuesday I thought?

slothroprhymes, Sunday, 17 May 2015 22:42 (ten years ago)

(1) warriors vs (2) rockets

(1) hawks vs (2) cavs

dubs in 4
hawks in 7

Clay, Sunday, 17 May 2015 22:43 (ten years ago)

same

lag∞n, Sunday, 17 May 2015 22:43 (ten years ago)

WCF begin Tuesday I thought?

oh that's def possible and my bad sports app just hasn't updated yet.

Clay, Sunday, 17 May 2015 22:44 (ten years ago)

chris tucker married (i think) one of the hot atlanta news anchors, he's practically retired as far as i can tell but he pops up on v103 alot. crowd went way crazier for him the other night than for jon hamm or some dudes from captain america 3.

balls, Sunday, 17 May 2015 22:46 (ten years ago)

only giving the rockets one day off after a seven game series is pretty rough, especially when they cldve just started the east series then

EASTERN CONFERENCE

Atlanta Hawks vs. Cleveland Cavaliers

Game 1 — Wednesday at Atlanta (8:30, TNT)
Game 2 — Friday at Atlanta (8:30, TNT)
Game 3 — May 24 at Cleveland (8:30, TNT)
Game 4 — May 26 at Cleveland (8:30, TNT)
Game 5 — May 28 at Atlanta* (8:30, TNT)
Game 6 — May 30 at Cleveland* (8:30, TNT)
Game 7 — June 1 at Atlanta* (8:30, TNT)
WESTERN CONFERENCE

Golden State Warriors vs. Houston Rockets

Game 1 — Tuesday at Golden State (9, ESPN)
Game 2 — Thursday at Golden State (9, ESPN)
Game 3 — Saturday at Houston (9, ESPN)
Game 4 — May 25 at Houston (9, ESPN)
Game 5 — May 27 at Golden State* (9, ESPN)
Game 6 — May 29 at Houston* (9, ESPN)
Game 7 — May 31 at Golden State* (9, ESPN)

lag∞n, Sunday, 17 May 2015 22:47 (ten years ago)

Kevin Pelton ‏@kpelton 52s53 seconds ago
Update on Josh Smith's playoff 3-point shooting.

Atlanta: 15-87 (17.2%)
Houston: 17-46 (37.0%)

brutal

lag∞n, Sunday, 17 May 2015 22:48 (ten years ago)

remember when not having josh smith was the key to success

lag∞n, Sunday, 17 May 2015 22:49 (ten years ago)

oh right my yearly reminder that ESPN gets the entirety of the wcf :(

Clay, Sunday, 17 May 2015 22:50 (ten years ago)

dubs in 4
hawks in 7

really hard to argue w this

head clowning instructor (art), Sunday, 17 May 2015 22:53 (ten years ago)

dubs in 5
hawks in 7

slothroprhymes, Sunday, 17 May 2015 22:55 (ten years ago)

wonder if it wld be sadder for bron to go down fighting in a close eastern conference finals or get run off the court by younger legs / a far superior team

lag∞n, Sunday, 17 May 2015 22:55 (ten years ago)

prob the latter

lag∞n, Sunday, 17 May 2015 22:55 (ten years ago)

definitely the latter

slothroprhymes, Sunday, 17 May 2015 22:56 (ten years ago)

what if he got swept in the finals just like his first trip there then never made it that far again, reasonably likely

lag∞n, Sunday, 17 May 2015 22:57 (ten years ago)

the clippers are kind of a perfect matchup for Smith and Ariza, I imagine Josh will be a liability in the next series.

Matt Armstrong, Sunday, 17 May 2015 22:58 (ten years ago)

yeah having to chase dray around the perimeter/deal w all sorts of weird switches will prob not be the best thing for him

lag∞n, Sunday, 17 May 2015 22:59 (ten years ago)

dubs 5, hawks 7 seems about right at this stage

“audience participation” otherwise known as “touching” (forksclovetofu), Sunday, 17 May 2015 23:01 (ten years ago)

i can definitely see them getting swept but i don't know about never making it that far again. this cavs team is pretty hobbled and you'd think would be better next year and the rest of the east is in flux - hawks could lose milsap and carroll, pacers definitely seem to be revamping in some fashion though george should be back, the bulls who knows what's going on, the bucks aren't there yet, the wizards might keep wittman and pierce could retire and beal and porter could regress to what they looked like in the regular season, the heat should be better and could somehow luck into someone great in the lottery but they're not gonna leap from out of the playoffs in the east to heavy favorite short of an amazing offseason.

balls, Sunday, 17 May 2015 23:04 (ten years ago)

dubs 5 hawks 6

A True White Kid that can Jump (Granny Dainger), Sunday, 17 May 2015 23:05 (ten years ago)

i can definitely see them getting swept but i don't know about never making it that far again. this cavs team is pretty hobbled and you'd think would be better next year and the rest of the east is in flux

― balls, Sunday, May 17, 2015 7:04 PM (2 minutes ago) Bookmark Flag Post Permalink

east is def staying weak but the ongoing precipitous decline of bron, loves uncertain future, their lack of any depth at all, the fact that the cavs organization has never made a good descision in its history makes their position pretty precarious

lag∞n, Sunday, 17 May 2015 23:11 (ten years ago)

other than winning it all is there a scenario where lebron doesn't fire blatt

Clay, Sunday, 17 May 2015 23:28 (ten years ago)

I really don't think Blatt is a problem at all, antics and embarrassments aside.

Matt Armstrong, Sunday, 17 May 2015 23:31 (ten years ago)

pretty sure bron thinks he is tho

Clay, Sunday, 17 May 2015 23:34 (ten years ago)

tho i guess having a guy he can run roughshod over is fine too

Clay, Sunday, 17 May 2015 23:34 (ten years ago)

LeBron has in general become a bizarre person and I have no idea what he really wants from the Cavs organization really

Matt Armstrong, Sunday, 17 May 2015 23:39 (ten years ago)

hawks aren't beating the cavs, come on.

Mr. Snrub, Monday, 18 May 2015 00:19 (ten years ago)

they're the better team, cavs have no love and irving is hobbled. if the hawks start clicking at all it'll take some super lebron shit to take the series. can you expect 4 batshit lebron performances in 7 games at this point? while he's also effectively being the only guy that can guard the hawks incredible perimeter game?

Clay, Monday, 18 May 2015 00:32 (ten years ago)

Lebron also literally cannot hit a 3 right now

, Monday, 18 May 2015 00:55 (ten years ago)

feel like the series is m/l a toss up, which everyone seems to agree by picking it to go 7 no?

lag∞n, Monday, 18 May 2015 00:58 (ten years ago)

if the hawks can at all regain their form they will win tho

lag∞n, Monday, 18 May 2015 00:58 (ten years ago)

yeah they looked to be almost there at the end of the Wizards series, though there are stretches where they don't look like they should be out there

Clay, Monday, 18 May 2015 01:01 (ten years ago)

GSW in 3, hawks in 7 for sure

, Monday, 18 May 2015 01:02 (ten years ago)

Who cares anymore.

Jeff, Monday, 18 May 2015 01:04 (ten years ago)

i love hoops message board regulars and the bandwagon fans of remaining teams

lag∞n, Monday, 18 May 2015 01:06 (ten years ago)

Since the Bulls are out, my last ditch care was the clippers. Oh well. Go Cubs.

Jeff, Monday, 18 May 2015 01:09 (ten years ago)

im checking my internet manual for which sick own to employ in the case of a u mad standoff
― lag∞n, Sunday, May 17, 2015 5:35 PM (2 hours ago) Bookmark Flag Post Permalink

trying to google for trademark hawks superfan
― lag∞n, Sunday, May 17, 2015 5:37 PM (2 hours ago) Bookmark Flag Post Permalink

hopefully i can find one of those good pictures with the block lettering on it
― lag∞n, Sunday, May 17, 2015 5:38 PM (2 hours ago) Bookmark Flag Post Permalink

💀💀💀💀💀

not a garbageman, i am garbage, man (m bison), Monday, 18 May 2015 01:11 (ten years ago)

Warriors in 4; Hawks in 4.

Allen (etaeoe), Monday, 18 May 2015 01:13 (ten years ago)

Future BuzzFeed article:

LeBron on Cavs: Diddy Kong
LeBron on Heat: Donkey Kong
LeBron on Cavs (redux): Kranky Kong

Allen (etaeoe), Monday, 18 May 2015 01:18 (ten years ago)

other than winning it all is there a scenario where lebron doesn't fire blatt

― Clay, Sunday, May 17, 2015 7:28 PM (1 hour ago) Bookmark Flag Post Permalink

I really don't think Blatt is a problem at all, antics and embarrassments aside.

― Matt Armstrong, Sunday, May 17, 2015 7:31 PM (1 hour ago) Bookmark Flag Post Permalink

pretty sure bron thinks he is tho

― Clay, Sunday, May 17, 2015 7:34 PM (1 hour ago) Bookmark Flag Post Permalink

ya seems like bron is ready to fire him wldnt bet on blatt being back

lag∞n, Monday, 18 May 2015 01:19 (ten years ago)

blatt doesnt seem great to me but but the cavs def have bigger problems

lag∞n, Monday, 18 May 2015 01:20 (ten years ago)

Dubs in 5
Hawks in 7

(Rockets will win one wacky game like 125-122)

juice college (agent hibachi), Monday, 18 May 2015 01:20 (ten years ago)

occurs to me the dubs have very good personnel to defend harden, multiple tall long perimeter players to check him with a rim protector behind them, where the rockets have got no one for steph and klay

lag∞n, Monday, 18 May 2015 01:24 (ten years ago)

lebron's contract is up after next season also, i guess ty lue would be the front runner right? i guess i'm glad ppl are picking hawks but man they've only shown flashes, korver has only rarely been 'kyle korver for threeeeee', and teague and schroder have both had some long iffy patches (plus schroder's damn near supplanted him in the fourth quarter). i can totally totally see the cavs winning that series. like 1.01 seconds go differently against the wiz and they're advancing right now.

balls, Monday, 18 May 2015 01:29 (ten years ago)

LeBron has in general become a bizarre person and I have no idea what he really wants from the Cavs organization really

― Matt Armstrong, Sunday, May 17, 2015 11:39 PM (Yesterday) Bookmark Flag Post Permalink

Want to see lebron become the Michael Jackson of the nba

panettone for the painfully alone (mayor jingleberries), Monday, 18 May 2015 01:31 (ten years ago)

feel like bron has always been a bit of a headcase but in an ambitious socially acceptable style, now that hes starting to see the downside of his career maybe that whole dynamic is souring a bit, his motivation for returning to clevland seems odd and overly conceptual, who knows what the hell hes thinking abt

lag∞n, Monday, 18 May 2015 01:37 (ten years ago)

maybe he was sick of being just one of the guys in miami and wanted another shot at being king james

lag∞n, Monday, 18 May 2015 01:39 (ten years ago)

http://giant.gfycat.com/MarvelousBigHalcyon.gif

wow

moullet, Monday, 18 May 2015 01:54 (ten years ago)

extremely beautiful

lag∞n, Monday, 18 May 2015 01:54 (ten years ago)

it's been kinda funny seeing the same ppl selling 'thibs can't get it done in the playoffs' also selling 'thibs actually won that championship, doc can't get it done in the playoffs'.

balls, Monday, 18 May 2015 02:08 (ten years ago)

why you phrase it that way it doesnt make too much sense but irl does

lag∞n, Monday, 18 May 2015 02:23 (ten years ago)

i mean the celtics had an alltime great defense which utilized innovative schemes as thought up/coached by thibs, which have now been adopted league wide, like a lot of defensive geniuses he doesnt coach offense that great tho

lag∞n, Monday, 18 May 2015 02:28 (ten years ago)

not to mention the whole player time management / injuries situation

lag∞n, Monday, 18 May 2015 02:29 (ten years ago)

maybe doc and thibs shd get the band back together, call danny to help them figure out some good players to get

lag∞n, Monday, 18 May 2015 02:30 (ten years ago)

yeah i can buy that it's not necessarily a true contradiction, i'm just wondering how many of these guys after a warriors-hawks finals will go 'see, toldja a 3 point shooting team can't win the championship' and point at whoever loses (humor me).

balls, Monday, 18 May 2015 03:10 (ten years ago)

lol tru

lag∞n, Monday, 18 May 2015 03:45 (ten years ago)

http://i.imgur.com/Tx33Ae9.gif

(•̪●) (carne asada), Monday, 18 May 2015 04:34 (ten years ago)

gonna go against the grain here and say Cavs will win that series in 6
hawks are a good team but i can't bet against Lebron willing the team into the finals again

dubs over griz, obv, but i hope it'll be a fun series

Nhex, Monday, 18 May 2015 04:41 (ten years ago)

Lol carne

check out this insane slothroprhymes yall (Spottie), Monday, 18 May 2015 05:55 (ten years ago)

maybe im a sucker but i don't think there's a great chance blatt gets axed unless they completely go up in flames in this series

J0rdan S., Monday, 18 May 2015 13:03 (ten years ago)

the hawks were only 11-9 in their final 20 games, looked horrible against by far the worst team in the playoffs, could barely beat a team that itself was a mess and whose best player was playing with one hand. i think whatever magic they had during that win streak is mostly gone, it looked like budenhozler was throwing shit against the wall in the wizards series with his end of game lineups.

basically the hawks go to player in the final 2 mins right now is dennis schroeder and for as impressive as he's looked for someone with his age/background i don't think that's getting it done vs lebron and even a one legged kyrie

J0rdan S., Monday, 18 May 2015 13:07 (ten years ago)

i would imagine the cavs get smoked by the warriors but i think the ECF is one of those eastern playoff series where you're like "lebron's team isn't very impressive but they have lebron and the other team doesn't"

J0rdan S., Monday, 18 May 2015 13:08 (ten years ago)

man fuck this season

micah, Monday, 18 May 2015 14:06 (ten years ago)

just too many injuries. what a joke.

micah, Monday, 18 May 2015 14:07 (ten years ago)

i didn't see the final two games of the clippers series, can someone explain to me what happened -- i know in game 6 josh smith turned into ray allen but that's about it

J0rdan S., Monday, 18 May 2015 14:16 (ten years ago)

clippers looked gassed more than anything, both pretty odd games/weird vibes, neither were yr typical comeback/blowout where the winning team played with xtreme energy and chemistry more like the clippers just shut down, the supporting cast particularly barnes and reddick cldnt hit a shot, kinda an alltime collapse

lag∞n, Monday, 18 May 2015 14:29 (ten years ago)

clippers just being the clippers tbh

(•̪●) (carne asada), Monday, 18 May 2015 14:34 (ten years ago)

u shd consider adopting them as the team u root for in the playoffs in the coming years imo

lag∞n, Monday, 18 May 2015 14:38 (ten years ago)

wish simmons wasn't dead

J0rdan S., Monday, 18 May 2015 14:43 (ten years ago)

i didn't see the final two games of the clippers series, can someone explain to me what happened -- i know in game 6 josh smith turned into ray allen but that's about it

― J0rdan S., Monday, May 18, 2015 10:16 AM (34 minutes ago)

man you really should just re-watch the second half of game 6, pretty historical moment

basically the clippers saw the light at the end of the tunnel and took their foot off the gas. and when things started swinging back the rockets way the clips got really tight and stopped running their sets. obviously the rockets needed a one in a million performance from brewer and smith to make it happen but still

k3vin k., Monday, 18 May 2015 14:53 (ten years ago)

Soon as jet blocked cp in game 6 I knew they were in trouble

check out this insane slothroprhymes yall (Spottie), Monday, 18 May 2015 15:11 (ten years ago)

ten more years of these guys.
http://www.si.com/more-sports/2015/05/17/charles-barkley-renews-contract-si-media-podcast-verne-lundquist

Barkley’s new deal includes access to appear on CNN for issues beyond sports including race, education and politics. Now here's something that might surprise you: Barkley will also be covering the Olympics for Bleacher Report. Or at least he has the option to do if he wants.

“audience participation” otherwise known as “touching” (forksclovetofu), Monday, 18 May 2015 15:34 (ten years ago)

It'd be cooler if any of these guys actually followed the NBA anymore

check out this insane slothroprhymes yall (Spottie), Monday, 18 May 2015 16:26 (ten years ago)

itd be cooler if shaq instead of being renewed was murdered

lag∞n, Monday, 18 May 2015 16:28 (ten years ago)

and that too

check out this insane slothroprhymes yall (Spottie), Monday, 18 May 2015 16:31 (ten years ago)

http://i.imgur.com/aLaW8f5.png

lag∞n, Monday, 18 May 2015 16:34 (ten years ago)

lol those ??? almost seem like they're taunting like 'gee i wonder what's going to happen'

balls, Monday, 18 May 2015 16:36 (ten years ago)

well just have to wait and find out ???

lag∞n, Monday, 18 May 2015 16:37 (ten years ago)

lol those are all Jordan Bulls teams right

Nhex, Monday, 18 May 2015 16:53 (ten years ago)

yup

lag∞n, Monday, 18 May 2015 16:54 (ten years ago)

"You've got to give (Paul) just some more support, you know?" Rivers told USA TODAY Sports. "I think bringing (his son) Austin (Rivers) here (in mid-January) helped us. We've got a 22-year-old (in Austin), and now to me we've got to get another guard who's in the middle age group. So now you're growing with Austin and CJ (Wilcox), and we need another defensive guy too."

Matt Armstrong, Monday, 18 May 2015 18:40 (ten years ago)

lol parenthetical zing

lag∞n, Monday, 18 May 2015 18:41 (ten years ago)

Rivers (who is an idiot btw) told USA TODAY Sports.

lag∞n, Monday, 18 May 2015 18:42 (ten years ago)

i think doc got into the pills again

slothroprhymes, Monday, 18 May 2015 18:54 (ten years ago)

shoulda got Paul more support than Matt Barnes like 2 years ago

panettone for the painfully alone (mayor jingleberries), Monday, 18 May 2015 18:54 (ten years ago)

Marc Stein ‏@ESPNSteinLine 9s10 seconds ago
Warriors center Andrew Bogut says he's got a case of hay fever but insists he'll be fine in Game 1 "as long as there's no pollen in Oracle"

lag∞n, Monday, 18 May 2015 19:36 (ten years ago)

OAKLAND - Clint Capela, rookie power forward for the Houston Rockets, was arrested and arraigned on charges of breaking and entering by local authorities after being caught and held by Oracle Arena security personnel at 4:45 a.m. Capela was found carrying a massive lawn trimmings bag full of pollen strands.

slothroprhymes, Monday, 18 May 2015 19:48 (ten years ago)

Definitely build your team around CJ Wilcox, good thinking.

polyphonic, Monday, 18 May 2015 19:50 (ten years ago)

Kerr's practice methods are interesting:

http://espn.go.com/blog/golden-state-warriors/post/_/id/602/run-and-fun-warriors-push-the-pace-not-their-players

polyphonic, Tuesday, 19 May 2015 18:32 (ten years ago)

Hannibal Buress ‏@hannibalburess 2m2 minutes ago
I have a few delusional Houston Rockets fans in my mentions. this dude just compared Harden to Jordan in earnest.

slothroprhymes, Tuesday, 19 May 2015 20:28 (ten years ago)

i love sage but is this crew really the best espn can do for pre and half entertainment? such a weak team.

Clay, Wednesday, 20 May 2015 00:58 (ten years ago)

like this network m/l owns american sports and they roll with jalen rose and doug collins dryly talking about strategy

Clay, Wednesday, 20 May 2015 00:59 (ten years ago)

yeah it's pretty bargain basement, feel like espn doesn't value nba studio shows at all

call all destroyer, Wednesday, 20 May 2015 01:00 (ten years ago)

like once magic left and simmons didn't work out they said fuck it

call all destroyer, Wednesday, 20 May 2015 01:01 (ten years ago)

Should've made monster offers to c-Webb and Gary Payton and put them with...uh who knows whoever really!

juice college (agent hibachi), Wednesday, 20 May 2015 01:10 (ten years ago)

But yeah I don't mind jalen and Collins tho both are better outside that format but ESPN def does not prioritize those shows, deliberately

juice college (agent hibachi), Wednesday, 20 May 2015 01:11 (ten years ago)

Ugh literally seconds after Clint Capela first scores and mjax busts out his obviously prepared a-Capella pun

He is the worst

juice college (agent hibachi), Wednesday, 20 May 2015 01:30 (ten years ago)

i really don't get why david lee is playing so much

k3vin k., Wednesday, 20 May 2015 01:38 (ten years ago)

there's literally no way the rockets hold this lead right

slothroprhymes, Wednesday, 20 May 2015 01:45 (ten years ago)

dubs looking v flat

lag∞n, Wednesday, 20 May 2015 01:50 (ten years ago)

didn't see this coming

Clay, Wednesday, 20 May 2015 01:53 (ten years ago)

god what if harden and dwight won the chip i would die

Clay, Wednesday, 20 May 2015 01:53 (ten years ago)

there's literally no way the rockets hold this lead right

― slothroprhymes, Tuesday, May 19, 2015 9:45 PM (7 minutes ago) Bookmark Flag Post Permalink

as a betting man w no knowledge of the sport of basketball i'm also v interested to know

qualx, Wednesday, 20 May 2015 01:54 (ten years ago)

if you're seriously gambling id say stick with the warriors for a series pick but if you made an individual game bet on the rockets I wouldn't be terrified about it, which is a shocking prospect

slothroprhymes, Wednesday, 20 May 2015 01:56 (ten years ago)

the line is still warriors -2.5 on bovada, lol

k3vin k., Wednesday, 20 May 2015 01:59 (ten years ago)

yep def didn't see this run coming

k3vin k., Wednesday, 20 May 2015 02:03 (ten years ago)

dubs disrespecting dwight w this small lineup

lag∞n, Wednesday, 20 May 2015 02:04 (ten years ago)

and still getting all he offensive boards

k3vin k., Wednesday, 20 May 2015 02:05 (ten years ago)

lollll yup

slothroprhymes, Wednesday, 20 May 2015 02:05 (ten years ago)

draymond fired up

slothroprhymes, Wednesday, 20 May 2015 02:05 (ten years ago)

klay taking it to the hole repeatedly agl

lag∞n, Wednesday, 20 May 2015 02:06 (ten years ago)

they're also not letting harden draw fouls a lot which is v important of course

slothroprhymes, Wednesday, 20 May 2015 02:07 (ten years ago)

steph my god

lag∞n, Wednesday, 20 May 2015 02:10 (ten years ago)

lol @ sea world having to run ads that are basically like "uh we are not terrifying animal abusers" that's not how you win a war heads up to yr pr dept

Clay, Wednesday, 20 May 2015 02:21 (ten years ago)

Fuck sea world forever.

not a garbageman, i am garbage, man (m bison), Wednesday, 20 May 2015 02:26 (ten years ago)

oh yeah they're the worst obv just like hilarious they don't get the basic political tenant of "don't run ads where you say that you don't beat your kids, you're just getting more people to acknowledge that you are capable of terrible things" it stinks of panicky desperation

Clay, Wednesday, 20 May 2015 02:33 (ten years ago)

scouting report consider guarding steph curry

lag∞n, Wednesday, 20 May 2015 02:38 (ten years ago)

seems reasonable

slothroprhymes, Wednesday, 20 May 2015 02:41 (ten years ago)

Risky strategy

not a garbageman, i am garbage, man (m bison), Wednesday, 20 May 2015 02:46 (ten years ago)

helping off curry on the break hm maybe not do that anymore

Clay, Wednesday, 20 May 2015 02:49 (ten years ago)

gentle reminder to espn broadcasting crew that the terrence jones guy you're praising for being a good guy and teammate was arrested for beating up homeless man for amusement

Clay, Wednesday, 20 May 2015 02:52 (ten years ago)

sometimes good people victimize societys most vulnerable for fun

lag∞n, Wednesday, 20 May 2015 03:01 (ten years ago)

brewer seems like he could be on the verge of one of those crazy brewer runs...

slothroprhymes, Wednesday, 20 May 2015 03:05 (ten years ago)

capela's gotta be morey's masterstroke pick up no?

J0rdan S., Wednesday, 20 May 2015 03:06 (ten years ago)

smith taking dwight out on an out of control play yet another chapter in the josh smith tragedy

lag∞n, Wednesday, 20 May 2015 03:11 (ten years ago)

james harden is absurdly good at basketball

J0rdan S., Wednesday, 20 May 2015 03:14 (ten years ago)

am I the only one that finds this janky ass rockets team likable? i am right?

J0rdan S., Wednesday, 20 May 2015 03:15 (ten years ago)

and then he does that

slothroprhymes, Wednesday, 20 May 2015 03:15 (ten years ago)

(xxp)

slothroprhymes, Wednesday, 20 May 2015 03:15 (ten years ago)

harden is having himself a game

Clay, Wednesday, 20 May 2015 03:15 (ten years ago)

flames shooting out hardens eyes

lag∞n, Wednesday, 20 May 2015 03:16 (ten years ago)

yeah j0rdan i think pretty much all of ilh views the rockets as the nba's biggest heels

Clay, Wednesday, 20 May 2015 03:16 (ten years ago)

i am not hating them as much as i used to during the regular season bc theyre not leaning on the crutches of their regular season tactics as much, and i like brewer i suppose

slothroprhymes, Wednesday, 20 May 2015 03:16 (ten years ago)

...that said, they are worlds away from being fun to watch and i don't see that happening anytime soon

slothroprhymes, Wednesday, 20 May 2015 03:17 (ten years ago)

basically impossible to play offensive basketball better than harden has the last like 8 possessions

J0rdan S., Wednesday, 20 May 2015 03:18 (ten years ago)

I loved the Rockets until they signed Josh Smith. But I'm a Pistons fan, so, a lot of sadness because of missed threes.

Allen (etaeoe), Wednesday, 20 May 2015 03:18 (ten years ago)

when it's not a harden foul fest they're kind of dope. brewer and josh smith are hilarious.

J0rdan S., Wednesday, 20 May 2015 03:19 (ten years ago)

i'm aactually surprised kerr didn't resort to hack-a-dwight during that harden run

Clay, Wednesday, 20 May 2015 03:19 (ten years ago)

lol josh smith nice move

Clay, Wednesday, 20 May 2015 03:19 (ten years ago)

dwight not playing

lag∞n, Wednesday, 20 May 2015 03:21 (ten years ago)

dray just pulled the dellevadova on ariza

slothroprhymes, Wednesday, 20 May 2015 03:21 (ten years ago)

dray almost took out ariza's knee

J0rdan S., Wednesday, 20 May 2015 03:22 (ten years ago)

@ESPNStatsInfo: James Harden: 11-19 from field, 28 points
Stephen Curry: 11-18 from field, 27

lag∞n, Wednesday, 20 May 2015 03:22 (ten years ago)

warriors d is fucking relentless

slothroprhymes, Wednesday, 20 May 2015 03:26 (ten years ago)

not that that's news lol but it's nuts how fast they made rockets go from on a run to crippled

slothroprhymes, Wednesday, 20 May 2015 03:27 (ten years ago)

and back again

J0rdan S., Wednesday, 20 May 2015 03:32 (ten years ago)

woa, i see you trevor ariza i see you just fine

slothroprhymes, Wednesday, 20 May 2015 03:34 (ten years ago)

man what a play

J0rdan S., Wednesday, 20 May 2015 03:34 (ten years ago)

god mark jackson is such a tool

Clay, Wednesday, 20 May 2015 03:35 (ten years ago)

that should just about do it but legit impressed by the rockets holding on

slothroprhymes, Wednesday, 20 May 2015 03:38 (ten years ago)

Clay
Posted: May 19, 2015 at 11:35:19 PM
god mark jackson is such a tool

just think abt how hes being forced to announce the team he got fired from for being a dick roll to a title lol

lag∞n, Wednesday, 20 May 2015 03:39 (ten years ago)

lol i forgot abt that, hope he works their championship clinching game

Clay, Wednesday, 20 May 2015 03:40 (ten years ago)

Feel like this is espn's way of trying to torment him, like yeah we'll give your old job back btw u r gonna call the games of your old team while they show how bad you were cool?

not a garbageman, i am garbage, man (m bison), Wednesday, 20 May 2015 03:41 (ten years ago)

gotta be even worse bc it's not even like he was a truly garbage coach - he did lay the foundation for their current goodness to some extent - but a garbage human and...he doesn't get it at all bc he's a jesus freak and those ppl are not known for self-awareness

slothroprhymes, Wednesday, 20 May 2015 03:44 (ten years ago)

"you don't suck at your job per se...we just hate yr fucking guts and u might be a sociopath"

slothroprhymes, Wednesday, 20 May 2015 03:46 (ten years ago)

nah, hes gotta be a little bit garbage as a coach for a rookie head coach to take over after you and turn em from a 6 seed to a 1 seed likely title winner.

not a garbageman, i am garbage, man (m bison), Wednesday, 20 May 2015 03:46 (ten years ago)

yeah he was at least kind of a garbage coach, at least on the offensive end

lag∞n, Wednesday, 20 May 2015 03:47 (ten years ago)

but he def wldve kept his job if he cld get along with his coworkers

lag∞n, Wednesday, 20 May 2015 03:47 (ten years ago)

i bet he could get another coaching job this offseason if he wanted it

J0rdan S., Wednesday, 20 May 2015 03:49 (ten years ago)

yeah someone will def give him another shot

lag∞n, Wednesday, 20 May 2015 03:51 (ten years ago)

i will let him coach my debate team, i got a lot on my plate, i just need someone else to go to meets

not a garbageman, i am garbage, man (m bison), Wednesday, 20 May 2015 03:51 (ten years ago)

lol

lag∞n, Wednesday, 20 May 2015 03:51 (ten years ago)

ESPN Stats & Info ‏@ESPNStatsInfo 2m2 minutes ago
Stephen Curry: 13-22 from field, 6-11 from 3-point range

Rest of team: 30-70 from field, 4-18 from 3-point range

lag∞n, Wednesday, 20 May 2015 03:52 (ten years ago)

mjax was definitely wrong for where the team needed to be, but he got them out of a purgatory period i suppose

but yea, hideous person, tried to play power games w people's heads that he wasnt even intellectual/ruthless enough to pull off, no sympathy for the motherfucker

...i can kinda see the bulls front office being shortsighted enough to hire him tbh

slothroprhymes, Wednesday, 20 May 2015 03:54 (ten years ago)

hideous person and god-botherer bigot idk maybe they like that in chicago

slothroprhymes, Wednesday, 20 May 2015 03:54 (ten years ago)

with bad antiquated ideas abt nba offense

lag∞n, Wednesday, 20 May 2015 03:55 (ten years ago)

tried to play power games w people's heads that he wasnt even intellectual/ruthless enough to pull off, no sympathy for the motherfucker

more cersei than littlefinger u r saying

Clay, Wednesday, 20 May 2015 03:56 (ten years ago)

precisely!

slothroprhymes, Wednesday, 20 May 2015 03:58 (ten years ago)

mark jackson shd go coach a private christian college team, he'd take them to the tourney all the time

not a garbageman, i am garbage, man (m bison), Wednesday, 20 May 2015 03:59 (ten years ago)

clay i'm legit wowed by that metaphor, it's perfect

slothroprhymes, Wednesday, 20 May 2015 04:00 (ten years ago)

xp he'd really make something of the king's college D3 squad

slothroprhymes, Wednesday, 20 May 2015 04:00 (ten years ago)

ty i am glad u enjoyed

who is the nba littlefinger tho, bonus points if you dont say phil jackson

Clay, Wednesday, 20 May 2015 04:03 (ten years ago)

help me write my grantland column

Clay, Wednesday, 20 May 2015 04:03 (ten years ago)

tho i will accept phil as an answer if it includes the phrase "which makes derek fisher his robert aryn" and you tell me that everyone calls coach fisher "sweetderek"

Clay, Wednesday, 20 May 2015 04:05 (ten years ago)

it's daryl morey duh

slothroprhymes, Wednesday, 20 May 2015 04:09 (ten years ago)

help me write my grantland column

― Clay, Wednesday, May 20, 2015 12:03 AM (5 minutes ago) Bookmark Flag Post Permalink

we could legit pitch this and split the freelance fee - although im p sure they did a similar piece some time ago, iirc it was the subject of some mockery on the simmons thread (in the past, before my ilx time)

slothroprhymes, Wednesday, 20 May 2015 04:11 (ten years ago)

Phil Jax is more Tywin than Littlefinger

tsrobodo, Wednesday, 20 May 2015 04:14 (ten years ago)

Danny Ainge?

Madison Dumbbarfer (Leee), Wednesday, 20 May 2015 04:14 (ten years ago)

danny ainge is tywin, phil jax is mace tyrell (had some past glories/has wealth, is now ineffectual and vain)

slothroprhymes, Wednesday, 20 May 2015 04:15 (ten years ago)

ha i would totally cowrite something like that just for kicks, preferably while drinking

Clay, Wednesday, 20 May 2015 04:15 (ten years ago)

I /do/ have a rinkydink wordpress blog, not sure how seriously I want to take it so have not previously mentioned it on ilx, but yea if you're at all serious, shit why not!

the genesis of most if not all posts is either drinking or extended downtimes at my office so the motivation would fit right in

slothroprhymes, Wednesday, 20 May 2015 04:22 (ten years ago)

https://pbs.twimg.com/media/CFbBoUBUgAAeela.png

lag∞n, Wednesday, 20 May 2015 04:30 (ten years ago)

i liked steph's man in black look tonight

Clay, Wednesday, 20 May 2015 04:40 (ten years ago)

What had Derrick Rose wrought.

Madison Dumbbarfer (Leee), Wednesday, 20 May 2015 04:44 (ten years ago)

harden 28-11-9-4stl

lag∞n, Wednesday, 20 May 2015 04:55 (ten years ago)

klay driving all game was so good to see but he missed a lot of easy ones. livingston was incredible

check out this insane slothroprhymes yall (Spottie), Wednesday, 20 May 2015 05:56 (ten years ago)

yeah livingston saved the game for them

lag∞n, Wednesday, 20 May 2015 14:04 (ten years ago)

https://pbs.twimg.com/media/CFcOvQ1WAAAKfEP.jpg

lag∞n, Wednesday, 20 May 2015 14:16 (ten years ago)

naww how human

micah, Wednesday, 20 May 2015 14:20 (ten years ago)

bogut getting cooked imo

micah, Wednesday, 20 May 2015 14:21 (ten years ago)

lol apparently sportswriters are complaining abt stephs cute child this morning! someone put them out of their misery

lag∞n, Wednesday, 20 May 2015 15:24 (ten years ago)

their inability to experience joy is almost impressive

call all destroyer, Wednesday, 20 May 2015 15:35 (ten years ago)

forget joy try just not being extremely irritable and judgemental abt one inconsequential thing

lag∞n, Wednesday, 20 May 2015 15:37 (ten years ago)

tho i guess that is their job

lag∞n, Wednesday, 20 May 2015 15:37 (ten years ago)

bogut getting cooked imo

― micah, Wednesday, May 20, 2015 7:21 AM (1 hour ago) Bookmark Flag Post Permalink

he had a pretty bad game for his standards but mostly due to dumb fouls. he isn't asked to do too much and he doesnt make sense to play if dwight is out in and he was out most of the game. he did set some good screens to get curry going tho. david lee is cooked tho.

check out this insane slothroprhymes yall (Spottie), Wednesday, 20 May 2015 16:13 (ten years ago)

lee lost and confused

lag∞n, Wednesday, 20 May 2015 16:19 (ten years ago)

and out of shape still

check out this insane slothroprhymes yall (Spottie), Wednesday, 20 May 2015 16:21 (ten years ago)

Adrian Wojnarowski ‏@WojYahooNBA 50s50 seconds ago
The NBA fined Golden State's Steph Curry $5,000 for flopping in Game 1 of the Western Conference Finals.

lag∞n, Wednesday, 20 May 2015 16:35 (ten years ago)

which play?

check out this insane slothroprhymes yall (Spottie), Wednesday, 20 May 2015 16:57 (ten years ago)

lol apparently sportswriters are complaining abt stephs cute child this morning! someone put them out of their misery

― lag∞n, Wednesday, May 20, 2015 11:24 AM (1 hour ago) Bookmark Flag Post Permalink

nonsurprise of the century that these were brian windbaghorst - who i just realized has to be played unflatteringly by jonah hill in the inevitable bron biopic - skip bayless, lakers reporter/delusional homer ramona shelbourne and some other asshole i've never heard of

slothroprhymes, Wednesday, 20 May 2015 17:17 (ten years ago)

PFTCommenter @PFTCommenter
well I woke up early and spendt all morning writing a take and brian windhorst allready plagerized me folks

slothroprhymes, Wednesday, 20 May 2015 17:20 (ten years ago)

yeah he was at least kind of a garbage coach, at least on the offensive end

perhaps he was but I feel like Kerr being brilliant makes him look garbagey in comparison when objectively he's prob a shade above "average" as a coach.
btw if he comes to Chicago I for real will not follow the team ugh don't talk like that guys.

A True White Kid that can Jump (Granny Dainger), Wednesday, 20 May 2015 17:29 (ten years ago)

seems like Bulls go out of their way to get players that won't make waves, can't imagine they'd hire a coach who has the rep as a wave-maker.

A True White Kid that can Jump (Granny Dainger), Wednesday, 20 May 2015 17:30 (ten years ago)

perhaps he was but I feel like Kerr being brilliant makes him look garbagey in comparison when objectively he's prob a shade above "average" as a coach.

― A True White Kid that can Jump (Granny Dainger), Wednesday, May 20, 2015 1:29 PM (50 seconds ago) Bookmark Flag Post Permalink

idk jackson dubs had the lowest assist rate in the league with three elite passers in the starting 5, he regularly rolled out bench lineups w/no starters heavily featuring barnes isos, etc, he was a legit bad offensive coach

main reason why i picked the dubs to win it all at the beginning of the season btw B-)

lag∞n, Wednesday, 20 May 2015 17:34 (ten years ago)

which play?

― check out this insane slothroprhymes yall (Spottie), Wednesday, May 20, 2015 12:57 PM (38 minutes ago) Bookmark Flag Post Permalink

guess it was on a made corner three where he fell over after, sounds vaguely familiar, think it was in the 4th

lag∞n, Wednesday, 20 May 2015 17:36 (ten years ago)

just hope he gets another coaching job next year and brings along reggie miller and shaq as assistants

A True White Kid that can Jump (Granny Dainger), Wednesday, 20 May 2015 17:36 (ten years ago)

otm

lag∞n, Wednesday, 20 May 2015 17:36 (ten years ago)

this has to be satire, right?
https://medium.com/the-cauldron/dunk-in-public-vol-1-0-5c48f6ce146f

check out this insane slothroprhymes yall (Spottie), Wednesday, 20 May 2015 17:44 (ten years ago)

lol yea its PFTcommenter! who i guess has diversified to the NBA

slothroprhymes, Wednesday, 20 May 2015 17:50 (ten years ago)

"intelligent sports storytelling" lmao rmde

A True White Kid that can Jump (Granny Dainger), Wednesday, 20 May 2015 17:52 (ten years ago)

not sure, author fucked up a/an and there/their at least three times in the first paragraph which made it impossible for me to traverse further

head clowning instructor (art), Wednesday, 20 May 2015 17:55 (ten years ago)

its deliberate, thats the PFT schtick

slothroprhymes, Wednesday, 20 May 2015 18:00 (ten years ago)

"intelligent sports storytelling" lmao rmde

It's just like IDM what's the fuss.

Madison Dumbbarfer (Leee), Wednesday, 20 May 2015 18:01 (ten years ago)

Steph Curry is 6 threes away from the record for most 3 pointers in one postseason, after game 1 of the conference finals.

Matt Armstrong, Wednesday, 20 May 2015 19:25 (ten years ago)

wow

lag∞n, Wednesday, 20 May 2015 19:27 (ten years ago)

saw a stat on twitter that he made 30/45 left corner 3's this season

, Wednesday, 20 May 2015 20:15 (ten years ago)

100% eFG ^

Clay, Wednesday, 20 May 2015 20:37 (ten years ago)

I loved Kerr going small in this game w draymond Barnes splash bros and Livingston as a quasi sf

juice college (agent hibachi), Wednesday, 20 May 2015 20:43 (ten years ago)

Mostly made possibly by Dwight being out but still Barnes was kinda great

juice college (agent hibachi), Wednesday, 20 May 2015 20:44 (ten years ago)

I realized what I hate the most about harden drives it's his head snapping back like a pez dispenser with no relation to any actual contact

juice college (agent hibachi), Wednesday, 20 May 2015 20:49 (ten years ago)

Barnes been ballsy all playoffs I think. xp

Madison Dumbbarfer (Leee), Wednesday, 20 May 2015 20:50 (ten years ago)

barnes sneaky good all playoffs yeah.

check out this insane slothroprhymes yall (Spottie), Wednesday, 20 May 2015 20:52 (ten years ago)

I realized what I hate the most about harden drives it's his head snapping back like a pez dispenser with no relation to any actual contact

― juice college (agent hibachi), Wednesday, May 20, 2015 4:49 PM (3 minutes ago) Bookmark Flag Post Permalink

there was a really good slowmo of him doing that on a jump shot in the game, he got hit on the wrist rose up and then snapped his head back as he released lol

lag∞n, Wednesday, 20 May 2015 20:54 (ten years ago)

I remember him doing the head snap and then composing himself to lob it to smith for a layup

Matt Armstrong, Wednesday, 20 May 2015 20:57 (ten years ago)

I still don't know what the hell to make of Harrison Barnes. There's a certain type of athletic swingman who seems like he should be a star but just never gets the usage or seems to even want it. There are definitely worse things than a really athletic dude who shoots 40% from 3 tho.

Matt Armstrong, Wednesday, 20 May 2015 21:02 (ten years ago)

He's turned into a versatile defender too.

check out this insane slothroprhymes yall (Spottie), Wednesday, 20 May 2015 21:05 (ten years ago)

There's a certain type of athletic swingman who seems like he should be a star but just never gets the usage or seems to even want it.

He wasn't shy about shooting the ball (and making it!) in the Memphis series when Klay and Steph were cold.

Madison Dumbbarfer (Leee), Wednesday, 20 May 2015 21:10 (ten years ago)

doesnt seem like barnes really has the creativity to be a big scorer but he certainly is thriving in his current role

lag∞n, Wednesday, 20 May 2015 21:11 (ten years ago)

he's sort of a Mickael Pietrus/Martell Webster type. Very clearly defined role and won't surprise you but valuable.

Matt Armstrong, Wednesday, 20 May 2015 21:14 (ten years ago)

ya

lag∞n, Wednesday, 20 May 2015 21:15 (ten years ago)

the problem with those guys is when they're on bad teams and their role becomes "scorer" they become Darius Miles

Clay, Wednesday, 20 May 2015 21:16 (ten years ago)

there's only one Darius Miles

Matt Armstrong, Wednesday, 20 May 2015 21:16 (ten years ago)

imo Barnes is really smart, unlike Darius Miles.

polyphonic, Wednesday, 20 May 2015 21:18 (ten years ago)

I still think about this game from time to time. Probably the greatest fantasy basketball performance of all time, considering how much of an outlier it was.

https://www.youtube.com/watch?v=W8yFXsyGafI

Matt Armstrong, Wednesday, 20 May 2015 21:19 (ten years ago)

I went to almost every home game that year, it was a dark time in my life

Clay, Wednesday, 20 May 2015 21:23 (ten years ago)

If Darius had good knees he probably would have had one or two great seasons in a long and frustrating NBA career

Matt Armstrong, Wednesday, 20 May 2015 21:27 (ten years ago)

Charles Barkley just described Kyle Korver as a "standing jumpshooter"

Matt Armstrong, Thursday, 21 May 2015 00:19 (ten years ago)

what teague and kyries dads played together at BU

lag∞n, Thursday, 21 May 2015 00:25 (ten years ago)

didn't know that, very cool

call all destroyer, Thursday, 21 May 2015 00:37 (ten years ago)

hawks looking a lot like the old hawks again :]

slothroprhymes, Thursday, 21 May 2015 00:41 (ten years ago)

he's sort of a Mickael Pietrus/Martell Webster type. Very clearly defined role and won't surprise you but valuable.

― Matt Armstrong, Wednesday, May 20, 2015 5:14 PM (3 hours ago) Bookmark Flag Post Permalink

Barnes kinda surprised me with a p authoritative dunk in the third or fourth last night but yeah generally, probably the smartest thing Kerr did to start the year was pop Barnes into the starting lineup where he can just hustle and shark out points instead of creating

The funny comparison right now is Trevor Ariza ha

juice college (agent hibachi), Thursday, 21 May 2015 00:41 (ten years ago)

This might be the first time I've ever seen Lebron with two fouls before halftime

juice college (agent hibachi), Thursday, 21 May 2015 00:51 (ten years ago)

the only thing that kept him from being invisible in this quarter

call all destroyer, Thursday, 21 May 2015 00:53 (ten years ago)

jr exploding

lag∞n, Thursday, 21 May 2015 01:10 (ten years ago)

teague looking extremely recovered

lag∞n, Thursday, 21 May 2015 01:16 (ten years ago)

glad he got the memo that he should dominate on offense

call all destroyer, Thursday, 21 May 2015 01:17 (ten years ago)

cavs cant stop the hawks penetration, hawks cant stop bron in the post

lag∞n, Thursday, 21 May 2015 01:26 (ten years ago)

Bron backed down demarre so long there I thought he was gonna get called for the Mark Jackson rule

juice college (agent hibachi), Thursday, 21 May 2015 01:29 (ten years ago)

I think I figured out why dellavedova bothers some of u its that he has a lot of unnecessary movement like pumping his arms a little too much when running or whipping his head back and forth a lot as a play develops

For some reason it sticks out a lot with him

juice college (agent hibachi), Thursday, 21 May 2015 01:31 (ten years ago)

Haha bazemore hitting the shot and running straight into the tunnel that guy is the best

juice college (agent hibachi), Thursday, 21 May 2015 01:33 (ten years ago)

cavs D is... not good lol

lag∞n, Thursday, 21 May 2015 01:35 (ten years ago)

i think i said or at least implied way upthread that if the hawks really have a shot in this series it's because the cavs d will break down and look v sorry and they'll just have all kinds of open shots

Clay, Thursday, 21 May 2015 01:38 (ten years ago)

teague is just getting completely all the way to the rim every time

lag∞n, Thursday, 21 May 2015 01:42 (ten years ago)

from what i gather from #futurelaker demarre carroll is lookin pretty good tonight

Clay, Thursday, 21 May 2015 01:44 (ten years ago)

lol

slothroprhymes, Thursday, 21 May 2015 01:57 (ten years ago)

bron just rolled his ankle on mayweather???

lag∞n, Thursday, 21 May 2015 01:58 (ten years ago)

bullshit calls there

slothroprhymes, Thursday, 21 May 2015 02:05 (ten years ago)

If Thompson can continue to be this effective I rate the cavs chances

tsrobodo, Thursday, 21 May 2015 02:07 (ten years ago)

yeah he's really working misap

Heez, Thursday, 21 May 2015 02:08 (ten years ago)

seems unlikely to be sustained

lag∞n, Thursday, 21 May 2015 02:10 (ten years ago)

sap's playing one of his worst games of the yr

Heez, Thursday, 21 May 2015 02:19 (ten years ago)

yeah, looks v tentative

call all destroyer, Thursday, 21 May 2015 02:20 (ten years ago)

kover still shook too

lag∞n, Thursday, 21 May 2015 02:20 (ten years ago)

definitely

balls, Thursday, 21 May 2015 02:22 (ten years ago)

lol i am fond of 'sap as a nickname

Clay, Thursday, 21 May 2015 02:26 (ten years ago)

fucking jr smith jesus

balls, Thursday, 21 May 2015 02:28 (ten years ago)

ok this is a fuckin joke officially ATL

slothroprhymes, Thursday, 21 May 2015 02:28 (ten years ago)

jr smith hm

Clay, Thursday, 21 May 2015 02:28 (ten years ago)

God I love JR

tsrobodo, Thursday, 21 May 2015 02:28 (ten years ago)

how do we still have korver on him

balls, Thursday, 21 May 2015 02:29 (ten years ago)

HEY NEW YORK THANKS FOR SHUMP AND J.R. SWISH!!!!

Mr. Snrub, Thursday, 21 May 2015 02:29 (ten years ago)

i am sorry boston friends that not only did that ball thing happen to your patritos but even worse yet tom brady is in this fucking ted movie

Clay, Thursday, 21 May 2015 02:30 (ten years ago)

jr takes the same shots hes taking tonight every game and the cavs r toast

lag∞n, Thursday, 21 May 2015 02:30 (ten years ago)

entourage movie, ted 2. helluva summer for douchebags.

balls, Thursday, 21 May 2015 02:32 (ten years ago)

this game over

lag∞n, Thursday, 21 May 2015 02:32 (ten years ago)

xps brady gets the world he deserves and by that i mean cameos in ted 2 and entourage

slothroprhymes, Thursday, 21 May 2015 02:33 (ten years ago)

ryan cameron firing them up

balls, Thursday, 21 May 2015 02:34 (ten years ago)

(i vacillate between being actively annoyed by and ~shrug~ about the patritos)

plz heat up hawks do that sexy comeback thing again

slothroprhymes, Thursday, 21 May 2015 02:34 (ten years ago)

is T.I. available to perform the intro track from KING at courtside

slothroprhymes, Thursday, 21 May 2015 02:35 (ten years ago)

so fucking sick of watching iso bron like the 2007 ECF

slothroprhymes, Thursday, 21 May 2015 02:39 (ten years ago)

(yes im ignoring the 8 JR 3s but iso bron is their bedrock and howwww the fuck is it not wearing thin given the team's other holes)

slothroprhymes, Thursday, 21 May 2015 02:39 (ten years ago)

Its a great way of stopping Atlanta from generating pace

tsrobodo, Thursday, 21 May 2015 02:40 (ten years ago)

switching carroll onto jr is dumb hes hitting bad shots let him keep going now bron is killing milsap

lag∞n, Thursday, 21 May 2015 02:40 (ten years ago)

oh fuckkfuckfuckfuckfuckfuckfuckfuck

slothroprhymes, Thursday, 21 May 2015 02:42 (ten years ago)

o god plz no

balls, Thursday, 21 May 2015 02:42 (ten years ago)

Aww come on pls no bullshit

tsrobodo, Thursday, 21 May 2015 02:42 (ten years ago)

welp

Heez, Thursday, 21 May 2015 02:43 (ten years ago)

rip

lag∞n, Thursday, 21 May 2015 02:43 (ten years ago)

cavs in 4 dubs in 4 lets get to it

Clay, Thursday, 21 May 2015 02:44 (ten years ago)

oh no i didn't think demarre was hurt that bad :(

Clay, Thursday, 21 May 2015 02:46 (ten years ago)

this super sucks

slothroprhymes, Thursday, 21 May 2015 02:47 (ten years ago)

o look hackatristan. FUCK.

slothroprhymes, Thursday, 21 May 2015 02:48 (ten years ago)

lol milsap whatre u doin

lag∞n, Thursday, 21 May 2015 02:52 (ten years ago)

#bazemore

slothroprhymes, Thursday, 21 May 2015 02:53 (ten years ago)

my ballot fwiw

1 brow
2 kent bazemore
3 kent bazemore
4 kent bazemore
5 kent bazemore
6 kent bazemore
7 kent bazemore
8 kent bazemore
9 kent bazemore
10 kent bazemore

― lag∞n, Monday, January 26, 2015 3:07 PM (3 months ago) Bookmark Flag Post Permalink

slothroprhymes, Thursday, 21 May 2015 02:55 (ten years ago)

bazemore like syrio saying 'not today' #grantland

balls, Thursday, 21 May 2015 02:55 (ten years ago)

haha what was i voting on

lag∞n, Thursday, 21 May 2015 02:56 (ten years ago)

lol

omg is sir foster playing trap queen?!!

slothroprhymes, Thursday, 21 May 2015 02:56 (ten years ago)

goon it was "top players of right now" in like late january

slothroprhymes, Thursday, 21 May 2015 02:58 (ten years ago)

omg bazemore

slothroprhymes, Thursday, 21 May 2015 03:01 (ten years ago)

hating the nypd a lot right now

balls, Thursday, 21 May 2015 03:10 (ten years ago)

otm

slothroprhymes, Thursday, 21 May 2015 03:12 (ten years ago)

if it werent for the demarre injury that wldnt have been the worst loss for the hawks, when jr smith burns u chucking up contested threes u just have to move on and look forward to the 3-15 hell put up next game, but that injury if its as bad as it looked cld tilt the series

lag∞n, Thursday, 21 May 2015 03:38 (ten years ago)

lebron was very impressive there when he recognized that he could get into the lane against demarre and beat the hawk bigs with a little hook shot.

Heez, Thursday, 21 May 2015 04:52 (ten years ago)

he was big on the one-legged Dirk pushoff fadeaway tonight

Nhex, Thursday, 21 May 2015 05:09 (ten years ago)

Looked like a hyperextension maybe?

check out this insane slothroprhymes yall (Spottie), Thursday, 21 May 2015 05:34 (ten years ago)

Cavs are just not fun to watch. Lebron ISOball was brutal.

check out this insane slothroprhymes yall (Spottie), Thursday, 21 May 2015 05:35 (ten years ago)

Wife's boss going to GS game tomorrow w/ business connection and dude does not even care about hoops ;_;

Mr. Murphy in the wine bar. (Sufjan Grafton), Thursday, 21 May 2015 05:40 (ten years ago)

Business based sports attendance should be outlawed

Mr. Murphy in the wine bar. (Sufjan Grafton), Thursday, 21 May 2015 05:42 (ten years ago)

Sad

check out this insane slothroprhymes yall (Spottie), Thursday, 21 May 2015 05:47 (ten years ago)

probably lower bowl too

Clay, Thursday, 21 May 2015 06:17 (ten years ago)

bastard

micah, Thursday, 21 May 2015 10:47 (ten years ago)

bet u that fool will be touring the arena when the second half starts smh

not a garbageman, i am garbage, man (m bison), Thursday, 21 May 2015 13:36 (ten years ago)

does anyone think the hawks even take this six?

J0rdan S., Thursday, 21 May 2015 13:43 (ten years ago)

is jr going to keep shooting 66% on threes?

call all destroyer, Thursday, 21 May 2015 13:58 (ten years ago)

if carroll is out, no. if he's back to 100% they can still win the series

props to hibachi for the ariza comp for barnes, that's pretty otm

k3vin k., Thursday, 21 May 2015 13:59 (ten years ago)

if carroll is out, JR will shoot worse?

Nhex, Thursday, 21 May 2015 14:11 (ten years ago)

i mean JR hit tough shots but he's also been shooting well ever since he got to cleveland, it's not like it was james jones making 8 threes

also kyrie scored 10 points

J0rdan S., Thursday, 21 May 2015 14:12 (ten years ago)

he went 8-12 from 3 and had 28 pts cmon

lag∞n, Thursday, 21 May 2015 14:15 (ten years ago)

on the other hand kyrie scoring 10 cld easily just be where kyries at

lag∞n, Thursday, 21 May 2015 14:16 (ten years ago)

yeah i'm not betting on a huge uptick from kyrie

call all destroyer, Thursday, 21 May 2015 14:16 (ten years ago)

it seems like it was a pretty close game so idg why it would cause us to question whether the hawks can get to game 6

call all destroyer, Thursday, 21 May 2015 14:17 (ten years ago)

i guess mostly i feel less like something is going to happen to the cavs and more like people are expecting the hawks of january to suddenly reappear out of nowhere when there's no signs that's happening

J0rdan S., Thursday, 21 May 2015 14:17 (ten years ago)

it was still a close game tho

lag∞n, Thursday, 21 May 2015 14:18 (ten years ago)

i mean if the hawks of january do reappear the cavs are toast

lag∞n, Thursday, 21 May 2015 14:18 (ten years ago)

seems like the hawks need to sag on bron make him hit a jump shot then double as soon as he get in post position

lag∞n, Thursday, 21 May 2015 14:19 (ten years ago)

the cavs have lost 2 games total in the playoffs by a combined 7 points vs much better teams, the hawks very well could have lost a series to a team coached by randy wittman

J0rdan S., Thursday, 21 May 2015 14:20 (ten years ago)

if the hawks even made double the threes they actually made (8 instead of 4), and the makes were during that final Q4 drive they prob wouldve won the game

slothroprhymes, Thursday, 21 May 2015 14:21 (ten years ago)

yeah the hawks missed all sorts of makable shots

lag∞n, Thursday, 21 May 2015 14:22 (ten years ago)

carroll being out is obvs huge tho

lag∞n, Thursday, 21 May 2015 14:22 (ten years ago)

the reliance on bron isos nearly killed the cavs, like the hawks got good opportunities of misses in Q4 and blew them but they shouldnt really have had them in the first place all things being equal

slothroprhymes, Thursday, 21 May 2015 14:22 (ten years ago)

*off

xp yeah its not like bazemore and mike scott are gonna reliably fill that spot in like a platoon

slothroprhymes, Thursday, 21 May 2015 14:23 (ten years ago)

the hawks just aren't the same team

korver took 5 shots

J0rdan S., Thursday, 21 May 2015 14:26 (ten years ago)

korver shd def take mroe than 5 shots

lag∞n, Thursday, 21 May 2015 14:27 (ten years ago)

i mean on the one hand the hawks did not look great but on the other cleveland is also bad

lag∞n, Thursday, 21 May 2015 14:27 (ten years ago)

how are the hawks not bad

J0rdan S., Thursday, 21 May 2015 14:36 (ten years ago)

i just said theyre bad!

lag∞n, Thursday, 21 May 2015 14:42 (ten years ago)

no you said they "did not look great"

J0rdan S., Thursday, 21 May 2015 14:44 (ten years ago)

but this is how they've looked for the last two months

J0rdan S., Thursday, 21 May 2015 14:45 (ten years ago)

i agree we are prob not going to see peak hawks in this series but that doesnt mean theyre not good enough to beat the cavs, however having fallen behind a game at home and lost a key starter i certainly wldnt bet on them

lag∞n, Thursday, 21 May 2015 14:47 (ten years ago)

no you said they "did not look great"

― J0rdan S., Thursday, May 21, 2015 10:44 AM (5 minutes ago) Bookmark Flag Post Permalink

and fwiw in that post there are multiple indications that "did not look great" and "bad" are roughly equivalent cmon!

lag∞n, Thursday, 21 May 2015 14:51 (ten years ago)

btw no official word but internet sources are saying carroll has a knee sprain no structural damage, obvs if its bad enough that wld be enough to keep him out of the series anyway, but great news for him if true

lag∞n, Thursday, 21 May 2015 14:56 (ten years ago)

yeah more important he doesn't cost himself $30 million

J0rdan S., Thursday, 21 May 2015 15:04 (ten years ago)

"did not look great" implies room for improvement and "bad" does not. i think there is room, korver could play better, millsap could def play better, german rondo could play better.

call all destroyer, Thursday, 21 May 2015 15:04 (ten years ago)

i don't think the Hawks have a prayer without carroll. he's their leading scorer in the postseason and the only player they have with a prayer of checking bron

k3vin k., Thursday, 21 May 2015 15:06 (ten years ago)

korver also had 5 points taken away on offensive fouls, scott foster was going pretty ham in the first half

k3vin k., Thursday, 21 May 2015 15:08 (ten years ago)

the fact that the hawks badly need the presence of demarre carroll might be broadly illustrative whether he's playing or not

J0rdan S., Thursday, 21 May 2015 15:08 (ten years ago)

also haberstroh has been writing some recently about how korver and german rondo can't figure out how to play together https://twitter.com/tomhaberstroh/status/601349612587393025

mostly i feel like the hawks were a well oiled machine earlier in the season but now bud is kinda throwing things at the wall rotationwise and it just doesn't seem like it's working

J0rdan S., Thursday, 21 May 2015 15:10 (ten years ago)

"did not look great" implies room for improvement and "bad" does not.

― call all destroyer, Thursday, May 21, 2015 11:04 AM (15 minutes ago) Bookmark Flag Post Permalink

smh both u guys taking my words out of context, disrepectful

lag∞n, Thursday, 21 May 2015 15:21 (ten years ago)

the fact that the hawks badly need the presence of demarre carroll might be broadly illustrative whether he's playing or not

― J0rdan S., Thursday, May 21, 2015 11:08 AM (13 minutes ago) Bookmark Flag Post Permalink

u cld say the same abt the cavs and jr smith! only carroll is a much better player than smith

lag∞n, Thursday, 21 May 2015 15:22 (ten years ago)

german rondo looked totally lost and confused

lag∞n, Thursday, 21 May 2015 15:23 (ten years ago)

Jeff Zillgitt ‏@JeffZillgitt 2m2 minutes ago
Good news on DeMarre Carroll: MRI reveals no structural damage, will be treated around the clock, per source. Should be listed as day to day

slothroprhymes, Thursday, 21 May 2015 15:24 (ten years ago)

wow

lag∞n, Thursday, 21 May 2015 15:25 (ten years ago)

korver also had 5 points taken away on offensive fouls, scott foster was going pretty ham in the first half

― k3vin k., Thursday, May 21, 2015 11:08 AM (46 minutes ago) Bookmark Flag Post Permalink

Heh foster really did have himself a game I wonder if Joey Crawford hit him with a congratulatory phone call afterward

juice college (agent hibachi), Thursday, 21 May 2015 15:58 (ten years ago)

Whoever the poor trainer is who will be hanging out working demarre''s knee ligaments at three in the morning, do not envy

juice college (agent hibachi), Thursday, 21 May 2015 16:00 (ten years ago)

mostly i feel like the hawks were a well oiled machine earlier in the season but now bud is kinda throwing things at the wall rotationwise and it just doesn't seem like it's working

― J0rdan S., Thursday, May 21, 2015 11:10 AM (50 minutes ago) Bookmark Flag Post Permalink

Buds does feel a little bit rookie coach-ish this time, bet he will be much more confident next year, though the game where he yanked his starters and let the bench get them back in it last round was fairly ballsy and astute, I mean he's def not like Monty Williams level in over his head but the reps will def be good for him

juice college (agent hibachi), Thursday, 21 May 2015 16:03 (ten years ago)

feel like the hawks late season/playoff collapse is instructive as to how difficult playing spurs style starless ball movement offense really is, you have to totally commit to it for the entire shot clock everyone has to know what the next action is a move seamlessly, the hawks offense is breaking down into isos way too much late in the shot clock which almost never happens to the spurs

lag∞n, Thursday, 21 May 2015 16:06 (ten years ago)

also have to push the ball every possession to get into yr offense as fast as possible

lag∞n, Thursday, 21 May 2015 16:07 (ten years ago)

i mean the hawks shd be slicing up the cavs defense!

lag∞n, Thursday, 21 May 2015 16:10 (ten years ago)

that's what was confusing to me, like how is korver not getting shots against the cavs

call all destroyer, Thursday, 21 May 2015 16:12 (ten years ago)

btw i don't think bud is necessarily doing a bad job or anything ... injuries haven't helped of course and just generally it seems like they're not running smoothly, idk whose fault it is

J0rdan S., Thursday, 21 May 2015 16:17 (ten years ago)

feel like the hawks late season/playoff collapse is instructive as to how difficult playing spurs style starless ball movement offense really is

i made this point when we were talking once about why teams just don't snap their fingers and implement a "spurs style offense" and several people jumped down my throat so i would like to say that you're otm

J0rdan S., Thursday, 21 May 2015 16:20 (ten years ago)

that mustve been very difficult for u

lag∞n, Thursday, 21 May 2015 16:30 (ten years ago)

i pride myself on being the bigger man

J0rdan S., Thursday, 21 May 2015 16:32 (ten years ago)

Only one way of confirming that.

Madison Dumbbarfer (Leee), Thursday, 21 May 2015 16:32 (ten years ago)

i'm not counting the hawks out just yet, demarre needs to be back by game 3 tho even if its just off the bench

slothroprhymes, Thursday, 21 May 2015 16:34 (ten years ago)

and i don't know how possible that is, if at all

slothroprhymes, Thursday, 21 May 2015 16:36 (ten years ago)

unless kent bazemore is really the hero we've been waiting for all along

slothroprhymes, Thursday, 21 May 2015 16:36 (ten years ago)

For being considered among the NBA’s top 10 defenders, Bogut, who earned $12.97 million in salary, will pick up a 15 percent bonus, about $1.9 million.
thats a lot of money!

check out this insane slothroprhymes yall (Spottie), Thursday, 21 May 2015 16:39 (ten years ago)

if bogut isn't one of the top 10 defenders in the nba he should have to forfeit $2 million in salary

J0rdan S., Thursday, 21 May 2015 16:42 (ten years ago)

thats rough to have yr salary tied to the voting habits of ignorant sportswriters

lag∞n, Thursday, 21 May 2015 16:43 (ten years ago)

i mean hes doin ok regardless but still

lag∞n, Thursday, 21 May 2015 16:43 (ten years ago)

its a bonus tho, not his salary

check out this insane slothroprhymes yall (Spottie), Thursday, 21 May 2015 16:44 (ten years ago)

w/e "his $$$"

lag∞n, Thursday, 21 May 2015 16:45 (ten years ago)

i like incentive based bonuses but yeah at the hands of voters is shaky business. something like play xx amount of games or xx amount of blocks is prob better.

check out this insane slothroprhymes yall (Spottie), Thursday, 21 May 2015 16:47 (ten years ago)

yeah literally anything is better than leaving it up to an award, the crazy thing is certain award bonuses are baked right into the CBA

lag∞n, Thursday, 21 May 2015 16:49 (ten years ago)

like if u get the mvp u are eligible for a bigger max contract (the rose rule [highly ironic nickname])

lag∞n, Thursday, 21 May 2015 16:51 (ten years ago)

im pretty sure the nba doesn't allow for statistical performance bonuses which is why all bonuses have to be tied to awards

J0rdan S., Thursday, 21 May 2015 17:03 (ten years ago)

Wisdom of crowds! Emergent consensus! Uhh, 10,000 hour rule!

Madison Dumbbarfer (Leee), Thursday, 21 May 2015 17:12 (ten years ago)

statistical bonuses cld obvs have some pretty dire perverse incentives

lag∞n, Thursday, 21 May 2015 17:13 (ten years ago)

they def allow weight bonuses tho lol

lag∞n, Thursday, 21 May 2015 17:14 (ten years ago)

scale don't lie

call all destroyer, Thursday, 21 May 2015 17:14 (ten years ago)

for gaining it or losing it?

slothroprhymes, Thursday, 21 May 2015 17:18 (ten years ago)

for gaining it or losing it?

Madison Dumbbarfer (Leee), Thursday, 21 May 2015 18:12 (ten years ago)

saw some interesting numbers about how there isn't much difference this year in the number of open 3 point looks in the playoffs vs. the regular season, but Korver is a notable exception and has gotten very few wide open looks.

Matt Armstrong, Thursday, 21 May 2015 23:35 (ten years ago)

Hawks are 5-1 or 6-1 dogs to win this series, I would bet that if I still had money on bovada or its ilk

Matt Armstrong, Friday, 22 May 2015 00:20 (ten years ago)

GS offensive plan is clearly shoot 3 or go straight at Dwight Howard and see if he can cope

juice college (agent hibachi), Friday, 22 May 2015 01:19 (ten years ago)

Ha the second I post that Doris's report on Dwight ends with saying golden state will go right at him, then bogut and green work him for a dunk

juice college (agent hibachi), Friday, 22 May 2015 01:21 (ten years ago)

rox not laying down and dying exactly but not defending well either

slothroprhymes, Friday, 22 May 2015 01:35 (ten years ago)

lotta dubs turnovers tho

slothroprhymes, Friday, 22 May 2015 01:36 (ten years ago)

have we discussed how dumb the dubs playoff slogan is, I mean it's no bone goal but still

slothroprhymes, Friday, 22 May 2015 01:37 (ten years ago)

What is it power in numbers or something, I like to think its about analytics and Morey is just steaming going that's my thing guys dammit

juice college (agent hibachi), Friday, 22 May 2015 01:39 (ten years ago)

strength in numbers yea

slothroprhymes, Friday, 22 May 2015 01:40 (ten years ago)

bogut redeeming himself nicely so far tonight

call all destroyer, Friday, 22 May 2015 01:44 (ten years ago)

holy shit that iguodala dunk

slothroprhymes, Friday, 22 May 2015 01:44 (ten years ago)

This might get ugly fast

juice college (agent hibachi), Friday, 22 May 2015 01:50 (ten years ago)

Hawks are 5-1 or 6-1 dogs to win this series, I would bet that if I still had money on bovada or its ilk

― Matt Armstrong, Thursday, May 21, 2015 8:20 PM (1 hour ago) Bookmark Flag Post Permalink

they're just +375 on bovada rn, and without knowing carroll's status i don't think that's a good bet

k3vin k., Friday, 22 May 2015 02:00 (ten years ago)

harden: activate

slothroprhymes, Friday, 22 May 2015 02:06 (ten years ago)

I always objectively "got" harden but I'm starting to actively enjoy his play in the past two playoff rounds

slothroprhymes, Friday, 22 May 2015 02:07 (ten years ago)

wtf does "step daddy" mean

Clay, Friday, 22 May 2015 02:08 (ten years ago)

http://national.suntimes.com/national-sports/nba/7/72/974325/dwight-howard-james-harden-nickname-step-daddy/

ok no wonder i reacted badly to this

Clay, Friday, 22 May 2015 02:09 (ten years ago)

damn this is a MJAX-ass lineup out here right now

k3vin k., Friday, 22 May 2015 02:55 (ten years ago)

bogut could have dunked on some 6'3" guy and instead he threw it into the 8th row

Clay, Friday, 22 May 2015 02:58 (ten years ago)

harden 10/16 26pts 9reb 8 ast 3 stil 1 blk 2TO +9
curry 10/17 27-3-4-0-0 5TO -4

k3vin k., Friday, 22 May 2015 03:05 (ten years ago)

Hawks are 5-1 or 6-1 dogs to win this series, I would bet that if I still had money on bovada or its ilk

― Matt Armstrong, Thursday, May 21, 2015 8:20 PM (1 hour ago) Bookmark Flag Post Permalink

they're just +375 on bovada rn, and without knowing carroll's status i don't think that's a good bet

― k3vin k., Friday, May 22, 2015 2:00 AM (1 hour ago) Bookmark Flag Post Permalink

man bovada sucks

http://www.oddschecker.com/basketball/nba/eastern-conference/winner

Matt Armstrong, Friday, 22 May 2015 03:06 (ten years ago)

+375 looks like about average odds?

btw i picked a good spot early in the 3Q to put a nice bet on the GSW moneyline at -190, let's do this

k3vin k., Friday, 22 May 2015 03:11 (ten years ago)

the warriors never fail to score off a dead ball, it's crazy

k3vin k., Friday, 22 May 2015 03:12 (ten years ago)

wow klay what a play

k3vin k., Friday, 22 May 2015 03:13 (ten years ago)

that was really beautiful d by klay

Clay, Friday, 22 May 2015 03:14 (ten years ago)

http://media.baselineresearch.com/images/151013/151013_full.jpg

balls, Friday, 22 May 2015 03:14 (ten years ago)

golden state locked in on offense is really the best thing

call all destroyer, Friday, 22 May 2015 03:15 (ten years ago)

yup

k3vin k., Friday, 22 May 2015 03:16 (ten years ago)

yikes, don't call a timeout there mchale

k3vin k., Friday, 22 May 2015 03:24 (ten years ago)

jeez curry had about a centimeter of air between the ball and terrence jones' hand

k3vin k., Friday, 22 May 2015 03:25 (ten years ago)

this was a really special performance from josh smith tonight

Matt Armstrong, Friday, 22 May 2015 03:26 (ten years ago)

WAU STEPH.

Madison Dumbbarfer (Leee), Friday, 22 May 2015 03:26 (ten years ago)

agree with JVG

k3vin k., Friday, 22 May 2015 03:27 (ten years ago)

that's a moving screen on dray btw

Matt Armstrong, Friday, 22 May 2015 03:29 (ten years ago)

it seemed like corey brewer decided to take the foul mid collision tho

Matt Armstrong, Friday, 22 May 2015 03:30 (ten years ago)

nawwwwww xp

k3vin k., Friday, 22 May 2015 03:30 (ten years ago)

wow the warriors did not have a plan there

call all destroyer, Friday, 22 May 2015 03:33 (ten years ago)

WOWWWWWWWWWWWW

Matt Armstrong, Friday, 22 May 2015 03:33 (ten years ago)

holy shit

k3vin k., Friday, 22 May 2015 03:33 (ten years ago)

how did dubs not call timeout in the backcourt there

k3vin k., Friday, 22 May 2015 03:33 (ten years ago)

the rockets have this weird calm that really serves them well sometimes

call all destroyer, Friday, 22 May 2015 03:34 (ten years ago)

harden flopped on the alley-oop pass. dude is playing a different game

k3vin k., Friday, 22 May 2015 03:35 (ten years ago)

remember when okc traded harden for kevin martin, jeremy lamb, and some shitty draft picks.

Clay, Friday, 22 May 2015 03:36 (ten years ago)

omg

call all destroyer, Friday, 22 May 2015 03:36 (ten years ago)

wowowowowow

k3vin k., Friday, 22 May 2015 03:36 (ten years ago)

oh james

Matt Armstrong, Friday, 22 May 2015 03:36 (ten years ago)

just a half second too long

call all destroyer, Friday, 22 May 2015 03:36 (ten years ago)

jesus how does houston not get a shot up to end the game even

Clay, Friday, 22 May 2015 03:36 (ten years ago)

remember when okc traded harden for kevin martin, jeremy lamb, and some shitty draft picks.

― Clay, Friday, May 22, 2015 3:36 AM (43 seconds ago) Bookmark Flag Post Permalink

a lotto pick!

Matt Armstrong, Friday, 22 May 2015 03:37 (ten years ago)

why did harden pass the ball there, that was bizarre

k3vin k., Friday, 22 May 2015 03:37 (ten years ago)

yeah fatal error

call all destroyer, Friday, 22 May 2015 03:38 (ten years ago)

My tream. :(

Madison Dumbbarfer (Leee), Friday, 22 May 2015 03:38 (ten years ago)

it's like he thought dwight was patrick ewing for a second

Matt Armstrong, Friday, 22 May 2015 03:38 (ten years ago)

it was a really weird pass, seemed like a brain fart moment? xps

Clay, Friday, 22 May 2015 03:38 (ten years ago)

Wha happened.

Madison Dumbbarfer (Leee), Friday, 22 May 2015 03:38 (ten years ago)

it's like he thought he could reset the play with like 16 seconds to work with

call all destroyer, Friday, 22 May 2015 03:38 (ten years ago)

harden's internal monologue on that last play was pretty plainly "uh uhhh uh uh uh uhhh uh uh uh hm uh"

Clay, Friday, 22 May 2015 03:39 (ten years ago)

Jalen Rose just completely ignoring a question about that Harden pass

Matt Armstrong, Friday, 22 May 2015 03:44 (ten years ago)

it is kind of a comment on Dwight's game that his only option there was to pass it right back, with no one within 10 feet of him. Surely a drive and dish would be there for most centers of his caliber.

Matt Armstrong, Friday, 22 May 2015 03:46 (ten years ago)

LOL Jalen Rose on boxing scoring

Matt Armstrong, Friday, 22 May 2015 03:49 (ten years ago)

"Houston is healthier than we saw them in the regular season." --Steve Kerr

Matt Armstrong, Friday, 22 May 2015 03:50 (ten years ago)

harden's internal monologue on that last play was pretty plainly "uh uhhh uh uh uh uhhh uh uh uh hm uh"
--Clay

yea def when was the last major collapse in a recent NBA game on a play like that that was as abrupt and final

slothroprhymes, Friday, 22 May 2015 04:01 (ten years ago)

harden failing to cover lillard last year?

polyphonic, Friday, 22 May 2015 04:08 (ten years ago)

Crazy game. Warriors should probably stop throwing the ball away.

Bogut played game 1 w a bad flu btw, he looked great tonight.

check out this insane slothroprhymes yall (Spottie), Friday, 22 May 2015 04:21 (ten years ago)

the end of that game was nuts

lag∞n, Friday, 22 May 2015 05:17 (ten years ago)

weird how both teams have blown substantial leads in like 5 minutes. warriors should have been up by 30 but they kept throwing the ball away.

I don't think harden can play any better than he has these first two games.

check out this insane slothroprhymes yall (Spottie), Friday, 22 May 2015 05:25 (ten years ago)

i mean besides not getting a shot up that final possession.

check out this insane slothroprhymes yall (Spottie), Friday, 22 May 2015 05:26 (ten years ago)

i'm rooting for the Warriors but really want to see the Rockets crush 'em at home in Game 3

Nhex, Friday, 22 May 2015 05:42 (ten years ago)

The warriors really haven't put it together for four quarters yet in the playoffs.

Spottie, Friday, 22 May 2015 06:52 (ten years ago)

kyrie going for another mri

call all destroyer, Friday, 22 May 2015 14:47 (ten years ago)

jeez

lag∞n, Friday, 22 May 2015 14:53 (ten years ago)

this is a funny series, it's shaping up to be basically the ultimate philosophical debate -- the best player in the world singlehandedly trying to beat a team of good players who just play well together

J0rdan S., Friday, 22 May 2015 15:28 (ten years ago)

if only atlanta played well together

lag∞n, Friday, 22 May 2015 15:40 (ten years ago)

(and if only james was the best player in the world haha burn)

lag∞n, Friday, 22 May 2015 15:40 (ten years ago)

subplot JR Smith vs common sense

Synergy Sports Tech @SynergySST
JR Smith is making 29% of his open spot up jump shots in the playoffs, but 48% of his contested spot up jumpers.
2:13 AM - 21 May 2015

tsrobodo, Friday, 22 May 2015 15:40 (ten years ago)

jr smiths ongoing war v common sense

lag∞n, Friday, 22 May 2015 15:42 (ten years ago)

both of those numbers will regress

J0rdan S., Friday, 22 May 2015 15:50 (ten years ago)

this is a funny series, it's shaping up to be basically the ultimate philosophical debate -- the best player in the world singlehandedly trying to beat a team of good players who just play well together

― J0rdan S., Friday, May 22, 2015 11:28 AM (32 minutes ago) Bookmark Flag Post Permalink

we already had that in the last 2 finals. this version of the hawks isn't really the same thing

k3vin k., Friday, 22 May 2015 16:03 (ten years ago)

tru

lag∞n, Friday, 22 May 2015 16:06 (ten years ago)

the spurs had vastly more individual talent than the hawks

J0rdan S., Friday, 22 May 2015 16:18 (ten years ago)

no superstars

lag∞n, Friday, 22 May 2015 16:21 (ten years ago)

if anything this is even more boiled down. bron literally without the two other superstars because they actually can't play vs a team that whose talent to togetherness ratio is even more out of wack than the spurs

J0rdan S., Friday, 22 May 2015 16:25 (ten years ago)

lol @ the idea that the hawks aren't "a team of good players who just play well together" -- what else could they be?

J0rdan S., Friday, 22 May 2015 16:25 (ten years ago)

im just sayin theyre not playing that well together recently

lag∞n, Friday, 22 May 2015 16:26 (ten years ago)

well sure, but that's still their thing

J0rdan S., Friday, 22 May 2015 16:31 (ten years ago)

but they're a shell of their former selves

the hawks were basically the 2012 nuggets with the benefit of an eastern conference schedule

k3vin k., Friday, 22 May 2015 17:07 (ten years ago)

even before the injuries, i mean

k3vin k., Friday, 22 May 2015 17:07 (ten years ago)

and obv i meant the 2013 nuggets

k3vin k., Friday, 22 May 2015 17:23 (ten years ago)

I did not realize that lil b had warned harden for stealing his dance moves prior to harden's collapse yesterday, lil b spooks me out

Clay, Friday, 22 May 2015 21:52 (ten years ago)

I believe in lil b

not a garbageman, i am garbage, man (m bison), Friday, 22 May 2015 22:45 (ten years ago)

Kyrie out Carroll in

Spottie, Saturday, 23 May 2015 00:16 (ten years ago)

hawks have no excuse

call all destroyer, Saturday, 23 May 2015 00:42 (ten years ago)

remember during game 1 when the broadcasters were saying that kyrie was finally pain-free?

call all destroyer, Saturday, 23 May 2015 00:47 (ten years ago)

Teague's playing all tentative again

Heez, Saturday, 23 May 2015 01:22 (ten years ago)

I love bazedmores short shorts

Spottie, Saturday, 23 May 2015 01:28 (ten years ago)

K3v has the ugliest shot I've ever seen

, Saturday, 23 May 2015 01:59 (ten years ago)

God what happened to u Hawks

Heez, Saturday, 23 May 2015 02:07 (ten years ago)

Horford and korver both injured??

, Saturday, 23 May 2015 02:25 (ten years ago)

Hawks so washed

not a garbageman, i am garbage, man (m bison), Saturday, 23 May 2015 02:35 (ten years ago)

Bud's playing dudes who literally haven't seen the floor in over a month

Heez, Saturday, 23 May 2015 02:41 (ten years ago)

lol cut to cavs huddle and lebron is coaching & blatt nowhere to be seen

Clay, Saturday, 23 May 2015 02:50 (ten years ago)

Hawks regressing to the mean so hard rn

not a garbageman, i am garbage, man (m bison), Saturday, 23 May 2015 02:52 (ten years ago)

atl 6-26 from 3 tonight :(

Clay, Saturday, 23 May 2015 02:53 (ten years ago)

Yo usher just gave LeBron some dap I fucking love atlanta

not a garbageman, i am garbage, man (m bison), Saturday, 23 May 2015 02:53 (ten years ago)

Atlanta could become like a non-bullshit celeb sighting venue

not a garbageman, i am garbage, man (m bison), Saturday, 23 May 2015 02:54 (ten years ago)

once JR's shooting regresses the hawks will be fine

J0rdan S., Saturday, 23 May 2015 03:15 (ten years ago)

*waits*

not a garbageman, i am garbage, man (m bison), Saturday, 23 May 2015 03:16 (ten years ago)

fuuuuuuu

slothroprhymes, Saturday, 23 May 2015 03:17 (ten years ago)

that game has one weird, ugly box score

Matt Armstrong, Saturday, 23 May 2015 05:12 (ten years ago)

Pero Antic was +15, Schroder plays 12 minutes, Carroll plays 33 minutes despite looking like a corpse on defense

Matt Armstrong, Saturday, 23 May 2015 05:16 (ten years ago)

yeahhh that was an ugly game to watch. what the hell happened to the Hawks?

Nhex, Saturday, 23 May 2015 05:32 (ten years ago)

Injuries and regression. Lebro should just do the player coach thing

Spottie, Saturday, 23 May 2015 06:04 (ten years ago)

http://streamable.com/d8ko all 11 lebron assists last night @ atl

crazy stuff

moullet, Saturday, 23 May 2015 11:56 (ten years ago)

didn't watch this one, checking up on highlights and such and based on how ppl discussed it I'm really surprised to see it was actually p close at one point (late 2nd early 3rd)

this could be a more likely sweep than dubs-rockets o_O

slothroprhymes, Saturday, 23 May 2015 13:02 (ten years ago)

that said this cavs team has 2007 written all the fuck over it provided it reaches the finals (which it almost definitely will)

slothroprhymes, Saturday, 23 May 2015 13:05 (ten years ago)

this could be a more likely sweep than dubs-rockets o_O

― slothroprhymes, Saturday, May 23, 2015 9:02 AM (5 hours ago) Bookmark Flag Post Permalink

Yeah i finished it on the dvr this morning and the life really seemed to just go out of the hawks halfway thru the third then the korver ankle thing and Lebron just magic johnsoned all around the joint, it was kinda gnarly, I kept thinking ok right a series doesn't really start until game 3 when someone can lose on their home floor and then...remembered that Cleveland just took the first two games on the road

Doesn't bode well

juice college (agent hibachi), Saturday, 23 May 2015 18:48 (ten years ago)

And as I hit submit the league app notification that korver is out for the rest of the offs popped up

Rip Hawks u were a good team caw caw

juice college (agent hibachi), Saturday, 23 May 2015 18:49 (ten years ago)

I did not realize that lil b had warned harden for stealing his dance moves prior to harden's collapse yesterday, lil b spooks me out

― Clay, Friday, May 22, 2015 5:52 PM (Yesterday) Bookmark Flag Post Permalink

This shit is freaky lil b might be a sorcerer

juice college (agent hibachi), Saturday, 23 May 2015 18:51 (ten years ago)

I thought the Cavs were morons for constantly running under screens and letting Teague shoot wide open Js but it's totally working.

Matt Armstrong, Saturday, 23 May 2015 19:54 (ten years ago)

oh my god Korver, that really sucks

Matt Armstrong, Saturday, 23 May 2015 19:55 (ten years ago)

how is the team with Andrew Bogut on its roster the only fully healthy one

Matt Armstrong, Saturday, 23 May 2015 19:56 (ten years ago)

Don't jinx it!

Spottie, Saturday, 23 May 2015 21:34 (ten years ago)

shush all youse

not a garbageman, i am garbage, man (m bison), Saturday, 23 May 2015 21:35 (ten years ago)

Although speights is hurt

Spottie, Saturday, 23 May 2015 21:35 (ten years ago)

@ESPNStatsInfo: when @StephenCurry30 plays off ball and is guarded by @JasonTerry31 or @PPrigioni9, 78% of his shots are uncontested.

Clay, Saturday, 23 May 2015 23:01 (ten years ago)

and that folks is the biggest example of what it means to lose patrick beverly

slothroprhymes, Saturday, 23 May 2015 23:09 (ten years ago)

50 ways to leave ur pat bev

slothroprhymes, Saturday, 23 May 2015 23:14 (ten years ago)

thats a crazy ass stat

lag∞n, Sunday, 24 May 2015 00:02 (ten years ago)

Steph just straight ran away from terry one play last game and I actually felt bad for poor old jet having to chase that wiry lil dude around

juice college (agent hibachi), Sunday, 24 May 2015 00:45 (ten years ago)

I am in some kinda web chat with Comcast support trying to get my cable back box fixed so I can watch this dang ol game

Clay, Sunday, 24 May 2015 00:53 (ten years ago)

yikes :[ good luck buddy

slothroprhymes, Sunday, 24 May 2015 01:06 (ten years ago)

props to Kristoffer from comcast support i am currently looking at jeff van gundy's beautiful mug

Clay, Sunday, 24 May 2015 01:09 (ten years ago)

i nominate Kristoffer from Comcastsupport.com for ilh official co-branded technical support specialist

Clay, Sunday, 24 May 2015 01:11 (ten years ago)

dwight is playing really well and I'm enjoying it what the fuck is wrong with me

slothroprhymes, Sunday, 24 May 2015 01:16 (ten years ago)

That was a nice dunk... We can all agree

, Sunday, 24 May 2015 01:17 (ten years ago)

obvs doesn't change my opinion of his loathsome personality but I usually don't even compliment his skills

slothroprhymes, Sunday, 24 May 2015 01:18 (ten years ago)

then immediately after he takes bogut's bait and charges, allowing a turnover so yea he still dwight

slothroprhymes, Sunday, 24 May 2015 01:19 (ten years ago)

sometimes dwight really turns on the jets and has a really beautiful game and looks like the most physically strong guy in the league and i think that's okay to appreciate

Clay, Sunday, 24 May 2015 01:20 (ten years ago)

damn kristoffer things were going so well and then you start trying to sell shit to me, i know it's your job kris but damnit man i must rescind my nomination

Clay, Sunday, 24 May 2015 01:23 (ten years ago)

steph boxing out dwight XD

Clay, Sunday, 24 May 2015 01:58 (ten years ago)

I was yelling

, Sunday, 24 May 2015 02:01 (ten years ago)

cavs in 4 dubs in 4 lets get to it

― Clay, Wednesday, May 20, 2015 7:44 PM (3 days ago) Bookmark Flag Post Permalink

Clay, Sunday, 24 May 2015 02:06 (ten years ago)

https://vine.co/v/eqwJQjeeDwM

Clay, Sunday, 24 May 2015 02:09 (ten years ago)

steph is everywhere jesus

lag∞n, Sunday, 24 May 2015 02:10 (ten years ago)

I slept through about half a quarter and this game got out of control

juice college (agent hibachi), Sunday, 24 May 2015 02:13 (ten years ago)

compared to these two series...were the first and second rounds actually that bad?

slothroprhymes, Sunday, 24 May 2015 02:31 (ten years ago)

omg josh smith just had one of the worst flubbed layups i've seen in awhile, coming directly off a clanked 3

Clay, Sunday, 24 May 2015 02:40 (ten years ago)

mark jackson's new thing seems to be crediting the warriors as being so good because of their "habits" i assume meaning read: things he instilled in them over the years

Clay, Sunday, 24 May 2015 02:41 (ten years ago)

his Steph praise/enthusiasm seems genuine but otherwise yea I think he's tryna low key pat himself on the back

slothroprhymes, Sunday, 24 May 2015 02:44 (ten years ago)

steph curry apotheosis game

Clay, Sunday, 24 May 2015 02:49 (ten years ago)

MVP wasn't enough apotheothis for you?

Aimless, Sunday, 24 May 2015 02:51 (ten years ago)

Oh my gawd Steph just mugging to the crowd after that 3, I've got so much respect for this man, bet all these oil money suckers wanna find him after the game

not a garbageman, i am garbage, man (m bison), Sunday, 24 May 2015 02:51 (ten years ago)

mvp was recognition, this is ascension

Clay, Sunday, 24 May 2015 02:57 (ten years ago)

https://vine.co/v/eqwJQjeeDwM

So cuet.

Madison Dumbbarfer (Leee), Sunday, 24 May 2015 03:01 (ten years ago)

Tream died, think I'm going to take a much needed shower.

Madison Dumbbarfer (Leee), Sunday, 24 May 2015 03:02 (ten years ago)

holy bejesus steph

slothroprhymes, Sunday, 24 May 2015 03:03 (ten years ago)

like i think yall mighta missed it but check the replay, theres a part after he hits that list three where he reaches into a fan's chest and throws his heart in dude's face and dude's wife can just stare and say "fuck he even made that shot"

not a garbageman, i am garbage, man (m bison), Sunday, 24 May 2015 03:05 (ten years ago)

i get the feeling he could hit 50% 3pt for a season

gifted aphorist (rip van wanko), Sunday, 24 May 2015 03:07 (ten years ago)

i gotta feeling he's going to harris county lockup after this game bc houston is not going to allow him to leave the building a free man

not a garbageman, i am garbage, man (m bison), Sunday, 24 May 2015 03:07 (ten years ago)

that last turnover was a lost verse from "what if god was one of us"

Clay, Sunday, 24 May 2015 03:08 (ten years ago)

https://pbs.twimg.com/media/CFvTzWuUIAAz02J.jpg:large

not a garbageman, i am garbage, man (m bison), Sunday, 24 May 2015 03:15 (ten years ago)

gifted aphorist (rip van wanko)
Posted: May 23, 2015 at 11:07:12 PM
i get the feeling he could hit 50% 3pt for a season

he cld easily if he took easier shots but thats not gonna happen

lag∞n, Sunday, 24 May 2015 03:25 (ten years ago)

what'd I miss, why aren't the scrubs in yet.

Madison Dumbbarfer (Leee), Sunday, 24 May 2015 03:25 (ten years ago)

https://pbs.twimg.com/media/CFvZXlYWAAAeAWo.jpg:large

not a garbageman, i am garbage, man (m bison), Sunday, 24 May 2015 03:27 (ten years ago)

lol @ jvg on curry's contract

Clay, Sunday, 24 May 2015 03:29 (ten years ago)

so if both series are sweeps there will be a 9 day layoff why

lag∞n, Sunday, 24 May 2015 03:32 (ten years ago)

Prez
‏@PrezidentYoung
James harden was in v-live last night with drake for #haw nah no excuses this ass whopping just being given to him

tsrobodo, Sunday, 24 May 2015 03:33 (ten years ago)

I don't think the Cavs will sweep but the idea of 3 more games between now and then is depressing

tsrobodo, Sunday, 24 May 2015 03:34 (ten years ago)

clips would've at least won a game or two, shame on Houston for winning that series and depriving us of a draymond / barnes brawl

Clay, Sunday, 24 May 2015 03:40 (ten years ago)

spurs woulda made this a series, bet

not a garbageman, i am garbage, man (m bison), Sunday, 24 May 2015 03:42 (ten years ago)

#criesmore

not a garbageman, i am garbage, man (m bison), Sunday, 24 May 2015 03:43 (ten years ago)

hope dubs sweep bron

Clay, Sunday, 24 May 2015 03:44 (ten years ago)

you ain't alone

balls, Sunday, 24 May 2015 03:44 (ten years ago)

warriors sweeping rest of the way to the chip would put them as a top 3 team of all time, right? 96 bulls, 72 lakers, 15 warriors

not a garbageman, i am garbage, man (m bison), Sunday, 24 May 2015 03:45 (ten years ago)

i don't know if any of y'all talked about that huge 538 thing but by their calculations these warriors are one of the greatest teams of all time and i concur

balls, Sunday, 24 May 2015 03:46 (ten years ago)

they had that second 3-peat bulls as better than the first but i always thought that first 3-peat bulls team was actually a little better, there just wasn't as much of a gap between them and everybody else as w/ the later team. 548 has these warriors 4th all time behind 96 bulls, 97 bulls, and 86 celtics. having 86 celtics only third felt kinda like a back stabbing move against simmons imo.

balls, Sunday, 24 May 2015 03:49 (ten years ago)

like at this point ive gotta think...who's gonna knock gsw off the next few years? like we thought the west was competitive....its not rly that competitive! gsw shittin on everyone, and a lot of crowding at 2-6

not a garbageman, i am garbage, man (m bison), Sunday, 24 May 2015 03:51 (ten years ago)

they also had this crazy break down game by game thru franchise history so eg the best the atlanta hawks have ever been was at the end of january this year but the best they've ever been in terms of a season or whatever was the 87 hawks iirc

balls, Sunday, 24 May 2015 03:51 (ten years ago)

Alex Kennedy ‏@AlexKennedyNBA 3h3 hours ago

Stephen Curry has hit five or more three-pointers in five consecutive playoffs games. No other player in NBA history has done that.

Matt Armstrong, Sunday, 24 May 2015 06:08 (ten years ago)

it looks like Curry will be the greatest 3 point shooter of all time.

― Matt Armstrong, Thursday, January 24, 2013 8:22 PM (45 minutes ago) Bookmark

lol at this by the way

― d'eejban (J0rdan S.), Friday, January 25, 2013 2:08 AM (2 years ago) Bookmark Flag Post Permalink

Matt Armstrong, Sunday, 24 May 2015 06:11 (ten years ago)

Hey cool they put it together for four quarters! Klay still can't shoot for some reason.

Spottie, Sunday, 24 May 2015 06:28 (ten years ago)

So good.

Spottie, Sunday, 24 May 2015 06:33 (ten years ago)

shoulda dropped that in 100 basketball photos thread actually

Clay, Sunday, 24 May 2015 06:55 (ten years ago)

The little three hand in the bottom left corner

Spottie, Sunday, 24 May 2015 07:35 (ten years ago)

That bald guy up front kept yelling MOVE! MOVE! at Steph who just laid in repose after his kill.

Bet this was last night...
Bald dude wife: why didn't he move
Bald dude: I'm a vice president of fracking ops at Halliburton. I've literally stabbed employees when they don't day good morning to me
Bdw: why didn't he move, Stanley??
Bald dude: you think the price of admission still means something these days but not with this generation. It's almost like you fork over your football gambling money for Courtside so YOU can entertain THEM
Bdw: I still don't understand--
Bd: SHUT THE FUCK UP PHYLLIS

not a garbageman, i am garbage, man (m bison), Sunday, 24 May 2015 12:00 (ten years ago)

so if both series are sweeps there will be a 9 day layoff why

― lag∞n, Saturday, May 23, 2015 11:32 PM (Yesterday) Bookmark

i think bc the finals are nat'l tv and they want that schedule locked further in advance so its set for possible game 7s, also way more media inc international attends the finals so they have to plan further out

juice college (agent hibachi), Sunday, 24 May 2015 14:21 (ten years ago)

like at this point ive gotta think...who's gonna knock gsw off the next few years? like we thought the west was competitive....its not rly that competitive! gsw shittin on everyone, and a lot of crowding at 2-6

― not a garbageman, i am garbage, man (m bison), Saturday, May 23, 2015 11:51 PM (Yesterday) Bookmark

i mean i dont see anyone bumping them off the presumptive top spot in the west rn but remember shit changes fast remember we all thought the spurs would gently tumble down the standings then they went to the finals twice more, the 09-10 lakers looked like a lock to be in the mix a few more years then imploded, sometimes teams randomly get better, who knows

i wouldnt bet against a good couple year run for gsw tho, my pick to compete would be new orleans if they could make a few trades except they have zero assets whoops

juice college (agent hibachi), Sunday, 24 May 2015 14:23 (ten years ago)

yea not without a real solid new coach and some additional depth, and idk how much they could add

slothroprhymes, Sunday, 24 May 2015 16:27 (ten years ago)

if the grizz figure out that more than three people on the team need to be able to shoot threes they could become more than just a perennial playoff team and enter finals contention imo

slothroprhymes, Sunday, 24 May 2015 16:28 (ten years ago)

the wild card is the salary cap jump

lag∞n, Sunday, 24 May 2015 16:29 (ten years ago)

as far as the dubs future boguts health is always looming too

lag∞n, Sunday, 24 May 2015 16:30 (ten years ago)

theres a chance they cld win w/o him but they become much more ordinary def

lag∞n, Sunday, 24 May 2015 16:31 (ten years ago)

yea true if he has some early season-ending injury, which is always possible given his history, do you use ezeli as a starting center or try to start every game w the small-ball lineup that puts draymond at 5? they sure as hell don't win 67 games like that but more importantly you don't win 16 playoff games like that most likely

slothroprhymes, Sunday, 24 May 2015 16:43 (ten years ago)

guys the thunder are gonna be really good next year too

k3vin k., Sunday, 24 May 2015 16:46 (ten years ago)

clippers, cavs, thunder, blazers, Spurs, grizzlies should all be elite teams next year, barring major roster shake-ups. the dubs ARE an all-time great team but they did get a little lucky with injuries to the competition, let's not forget

k3vin k., Sunday, 24 May 2015 16:48 (ten years ago)

I feel like Memphis could just as easily become Dallas (8th seed that wld probably be a top 3 east team) as become a real title contender unless they really get clever in revamping that team around Conley and Gasol

juice college (agent hibachi), Sunday, 24 May 2015 17:21 (ten years ago)

I would swap the rockets in for the blazers there if only bc of the aldridge uncertainty and the wes injury issue

slothroprhymes, Sunday, 24 May 2015 17:22 (ten years ago)

the wild card is the salary cap jump

― lag∞n, Sunday, May 24, 2015 12:29 PM (52 minutes ago) Bookmark Flag Post Permalink

Yeah I was thinking about this and someone, not sure who, is gonna play all their cards perfectly and go from fringe to superpower or basement to competitive in one summer

juice college (agent hibachi), Sunday, 24 May 2015 17:24 (ten years ago)

grizz-wise I think they don't have a choice but to do what you're suggesting, hibachi, bc randolph ain't gettin any younger and idk how sustainable that style is with him at 34 and 35 (he's 33 now)

slothroprhymes, Sunday, 24 May 2015 17:26 (ten years ago)

I sort of get what people are driving at in that there's seemingly a window here with the spurs declining (?) and Durant dealing with foot issues, but the Warriors themselves aren't some unstoppable juggernaut and teams could definitely catch up. They've got an amazing superstar, a great second banana and great role players. It's a recipe for winning titles but if, for example, Bogut got injured it would make a huge difference.

Matt Armstrong, Sunday, 24 May 2015 18:59 (ten years ago)

hawks look like the hawks

for now

slothroprhymes, Monday, 25 May 2015 00:41 (ten years ago)

bron is 0/10 from the field - hasn't shot this poorly since a 2007 cavs finals game

slothroprhymes, Monday, 25 May 2015 01:13 (ten years ago)

(in the playoffs at least)

slothroprhymes, Monday, 25 May 2015 01:14 (ten years ago)

dellevadova stay baiting ppl into rage moves

slothroprhymes, Monday, 25 May 2015 01:32 (ten years ago)

This is a super good series.

Allen (etaeoe), Monday, 25 May 2015 01:40 (ten years ago)

And by super good I mean it's totally balls.

Allen (etaeoe), Monday, 25 May 2015 01:40 (ten years ago)

my whole thing going in has been avoid humiliation, use this to evaluate what moves need to be made to get us to the next stage, maybe score a token victory or two dare to dream

balls, Monday, 25 May 2015 01:43 (ten years ago)

it was an ok series in the first game trash in the 2nd good in this first Q then ass terrible in the 2nd

slothroprhymes, Monday, 25 May 2015 01:46 (ten years ago)

fair summary

Allen (etaeoe), Monday, 25 May 2015 01:50 (ten years ago)

dellavedova is super dirty. can't believe this is even a debate.

Allen (etaeoe), Monday, 25 May 2015 01:51 (ten years ago)

yeah I mean if I'm him and I know that's my primary skill set - baiting people into aggression plays - I'm gonna use it but I don't think he has that much self awareness and is just completely a little shit

slothroprhymes, Monday, 25 May 2015 01:53 (ten years ago)

if dellavedova knew that i was judging the entire australian people based on his actions maybe he wouldn't be so quick to be a piece of dogshit

Clay, Monday, 25 May 2015 01:55 (ten years ago)

pretty fair with calling it a trash nation that has produced a few cool things/people like nick cave and andrew bogut

slothroprhymes, Monday, 25 May 2015 02:06 (ten years ago)

*pretty cool

oh and I guess guy pearce too? lol

slothroprhymes, Monday, 25 May 2015 02:06 (ten years ago)

did you know andrew gaze won a ring w/ the spurs?

balls, Monday, 25 May 2015 02:08 (ten years ago)

patty mills is a good australian

Clay, Monday, 25 May 2015 02:12 (ten years ago)

delly's wiki page has already been edited to name him "matthew 'EATS ASS' dellevadova

slothroprhymes, Monday, 25 May 2015 02:13 (ten years ago)

he's an aborigine so not guilty imo

slothroprhymes, Monday, 25 May 2015 02:13 (ten years ago)

(xp)

slothroprhymes, Monday, 25 May 2015 02:13 (ten years ago)

i swear dellevadova must be the most normal white dude looking bro to play in the nba. like even w/ stockton you could tell their was a vicious gymrat baller in there, dude looked like a coach minimum.

balls, Monday, 25 May 2015 02:17 (ten years ago)

Allen (etaeoe)
Posted: May 24, 2015 at 9:51:30 PM
dellavedova is super dirty. can't believe this is even a debate.

srsly what a piece of shit, being dirty as in getting away w cheap fouls is one thing but dangerous plays is another, ban and deport him imo

lag∞n, Monday, 25 May 2015 02:29 (ten years ago)

wait what did he do

call all destroyer, Monday, 25 May 2015 02:33 (ten years ago)

i mean i'm all for deportation just want some context

call all destroyer, Monday, 25 May 2015 02:33 (ten years ago)

went at horfords knees third time hes done that this playoffs

lag∞n, Monday, 25 May 2015 02:34 (ten years ago)

terrible

call all destroyer, Monday, 25 May 2015 02:35 (ten years ago)

and horford got ejected

balls, Monday, 25 May 2015 02:35 (ten years ago)

dude is gonna tear off a dude's testicle one day and just stand there like "how'd this get here?"

Clay, Monday, 25 May 2015 02:36 (ten years ago)

I had no idea dellavedova was an Aussie until I heard him on ESPN radio a little while ago

juice college (agent hibachi), Monday, 25 May 2015 02:38 (ten years ago)

We can deport him right after d Wade tho

juice college (agent hibachi), Monday, 25 May 2015 02:38 (ten years ago)

he shd be suspended for the rest of the playoffs the nba has a whole replay center to carefully parse the difference between a flagrant and a normal foul but a guy has a pattern of dangerous play a what do they do

lag∞n, Monday, 25 May 2015 02:38 (ten years ago)

It's unbelievable that Lebron started 0 for 10 and has a triple double

juice college (agent hibachi), Monday, 25 May 2015 02:39 (ten years ago)

yeah i found vines of horford's elbow but can't find any of delladova going at his knees, either way horford seems like a reasonable person in general so i trust his retaliation was appropriate

call all destroyer, Monday, 25 May 2015 02:39 (ten years ago)

if I was one to give credence to conspiracy bullshit id wonder about home cooking etc but I don't really believe that stuff

slothroprhymes, Monday, 25 May 2015 02:40 (ten years ago)

just a bad call and delly's shit was just subtle enough to make al's reaction look sliiiightly worse

slothroprhymes, Monday, 25 May 2015 02:42 (ten years ago)

from what i saw giving horford a flagrant 2 would be reasonable in isolation but clearly there was some provocation that should have been handled before we got to that point

call all destroyer, Monday, 25 May 2015 02:44 (ten years ago)

i hope the warriors embarrass the cavs worse than the spurs did the heat last year.

balls, Monday, 25 May 2015 02:45 (ten years ago)

hearing the announcers realizing what dladova did after seeing the replay a few time but not wanting to say it was pretty funny IIM NOT SAYING HES DIRTY HES DEF NOT DIRTY BUT U CAN SEE HOW HORFORD MIGHT HAVE GOTTEN UM KIND OF OFFENDED cut to video of him knocking kover out of the series last game

lag∞n, Monday, 25 May 2015 02:46 (ten years ago)

marv and webber were calling him dirty in all but the literal word, reggie was all equivocating tho

slothroprhymes, Monday, 25 May 2015 02:52 (ten years ago)

oh ffs it's happening again!

slothroprhymes, Monday, 25 May 2015 02:53 (ten years ago)

(almost)

slothroprhymes, Monday, 25 May 2015 02:54 (ten years ago)

luvin bazemore

Clay, Monday, 25 May 2015 02:56 (ten years ago)

luvin teague

Clay, Monday, 25 May 2015 03:02 (ten years ago)

same

lag∞n, Monday, 25 May 2015 03:03 (ten years ago)

just now watching delladova intentionally roll into korver's ankle, pretty bad

call all destroyer, Monday, 25 May 2015 03:05 (ten years ago)

i swear dellevadova must be the most normal white dude looking bro to play in the nba. like even w/ stockton you could tell their was a vicious gymrat baller in there, dude looked like a coach minimum.

― balls, Sunday, May 24, 2015 10:17 PM (45 minutes ago)

brian cardinal a few years back has this title on lock i think

k3vin k., Monday, 25 May 2015 03:06 (ten years ago)

OMG what were the hawks doing there

k3vin k., Monday, 25 May 2015 03:07 (ten years ago)

hold for the last shot whyyyyyyy

k3vin k., Monday, 25 May 2015 03:07 (ten years ago)

shump got 2 hit that one

Clay, Monday, 25 May 2015 03:08 (ten years ago)

if the hawks piss this away I swear to god

slothroprhymes, Monday, 25 May 2015 03:09 (ten years ago)

omg cavs crowd fuck you and your fucking white stripes chant that chant makes me so irrationally angry (I know a lot of teams do it)

slothroprhymes, Monday, 25 May 2015 03:10 (ten years ago)

I guess forcing overtime ain't the worst but agh

slothroprhymes, Monday, 25 May 2015 03:11 (ten years ago)

i remember when heat fans did it, is this like a bron teams thing? wasnt that a soccer chant first? so many questions also that song is ok but fuck the white stripes overall

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:13 (ten years ago)

wow lebron cramping again?

k3vin k., Monday, 25 May 2015 03:15 (ten years ago)

juicy juice

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:16 (ten years ago)

looked like he rolled his ankle

lag∞n, Monday, 25 May 2015 03:16 (ten years ago)

i dont think i even knew that was a white stripes thing

Clay, Monday, 25 May 2015 03:16 (ten years ago)

btw im impressed by tristan thompson's ability to finish at the rim 2nite with bodies on him

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:16 (ten years ago)

guess i win the "cool via ignorance" achievement xp

Clay, Monday, 25 May 2015 03:17 (ten years ago)

need a vine of that foul shot asap

Allen (etaeoe), Monday, 25 May 2015 03:17 (ten years ago)

everytime jr smith hits a 3 it makes me chuckle

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:17 (ten years ago)

mike scott is not a shy man

Clay, Monday, 25 May 2015 03:18 (ten years ago)

also plzed with iman's play overall, he's a glue guy

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:18 (ten years ago)

i first heard it at red wings match

Allen (etaeoe), Monday, 25 May 2015 03:18 (ten years ago)

this nba store commercial is so weird, where did they find this middle school where everyone wears nba team clothes and they are all different teams, posers

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:20 (ten years ago)

it was a soccer chant in italy first then i think it came to football via the ravens and now it's everywhere. i don't mind it so much but it reminds me too much of the tomahawk chant.

balls, Monday, 25 May 2015 03:20 (ten years ago)

some heavy dub step going on

Allen (etaeoe), Monday, 25 May 2015 03:20 (ten years ago)

xp if it supplants the tomahawk chant, i will be 10000% ok with it, lesser of two evils, bout it

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:21 (ten years ago)

Luc is a cool aussie

Mr. Murphy in the wine bar. (Sufjan Grafton), Monday, 25 May 2015 03:24 (ten years ago)

dang bron

slothroprhymes, Monday, 25 May 2015 03:24 (ten years ago)

hey bron hit a shot and it was a three

lag∞n, Monday, 25 May 2015 03:25 (ten years ago)

bron's body at age 36 is gonna be like mickey rourke in the wrestler right

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:25 (ten years ago)

yo scott got to pick that ball up

lag∞n, Monday, 25 May 2015 03:27 (ten years ago)

teague's layup never had a chance

call all destroyer, Monday, 25 May 2015 03:27 (ten years ago)

god mike scott

k3vin k., Monday, 25 May 2015 03:27 (ten years ago)

what are they looking at

k3vin k., Monday, 25 May 2015 03:28 (ten years ago)

prolly some rowdy porn on another monitor cos theyre bored

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:30 (ten years ago)

RIP hawks...

slothroprhymes, Monday, 25 May 2015 03:30 (ten years ago)

jesus christ

slothroprhymes, Monday, 25 May 2015 03:32 (ten years ago)

omg bron u drama queen

lag∞n, Monday, 25 May 2015 03:32 (ten years ago)

what is even the point of this, the 2nd, 3rd, 4th, and 6th best players in the series weren't playing

call all destroyer, Monday, 25 May 2015 03:33 (ten years ago)

omg bron u drama queen

Said these exact same words

Heez, Monday, 25 May 2015 03:33 (ten years ago)

wow lebron leaning on the table here ha

Clay, Monday, 25 May 2015 03:34 (ten years ago)

Never a doubt!!

Mr. Snrub, Monday, 25 May 2015 03:34 (ten years ago)

lol shut up lebron

k3vin k., Monday, 25 May 2015 03:34 (ten years ago)

omg bron doing meta-narrative "as a leader" interview while solemnly shaking his head, i just can't support this in any capacity

call all destroyer, Monday, 25 May 2015 03:34 (ten years ago)

37-18-13 for lebron, started out 0 for 10.. Are you fucking kidding me?

Mr. Snrub, Monday, 25 May 2015 03:35 (ten years ago)

lebron is going to be absolutely insufferable as he ages huh

Clay, Monday, 25 May 2015 03:35 (ten years ago)

i believe in lebron, sorry hawks fans

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:35 (ten years ago)

...on 37 shots

lag∞n, Monday, 25 May 2015 03:36 (ten years ago)

he does realize how much of his team's internal organs will be splattered all over oracle arena right

slothroprhymes, Monday, 25 May 2015 03:36 (ten years ago)

i hope bron at least gets to like bought a monkey & always wears sunglasses indoors level of weirdness

Clay, Monday, 25 May 2015 03:36 (ten years ago)

to quote that movie the counselor, "the slaughter will be beyond our imagining"

slothroprhymes, Monday, 25 May 2015 03:37 (ten years ago)

lebron is going to be absolutely insufferable as he ages huh

― Clay, Sunday, May 24, 2015 11:35 PM (1 minute ago) Bookmark Flag Post Permalink

he's pretty much there, i supported and enjoyed how he handled the signing with cleveland but everything since then has been painful

call all destroyer, Monday, 25 May 2015 03:38 (ten years ago)

just keep matthew dellavedova away from the warriors knees!

lag∞n, Monday, 25 May 2015 03:38 (ten years ago)

what a sick commercial, this fucking dj making me want to drink all kinds of coors lights

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:38 (ten years ago)

the drop

call all destroyer, Monday, 25 May 2015 03:39 (ten years ago)

at the club like "WHAT SONG IS THIS? DO YOU THINK THE BAR HAS FLAX MILK?"

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:39 (ten years ago)

love to have the role of the drop explained to me

lag∞n, Monday, 25 May 2015 03:39 (ten years ago)

yeah i was psyched to root for the cleve this year but lebron has made it impossible, idrk how he become just so utterly unlikable xps

Clay, Monday, 25 May 2015 03:39 (ten years ago)

i hope bron at least gets to like bought a monkey & always wears sunglasses indoors level of weirdness
--Clay

I support him being the howard hughes of the NBA

slothroprhymes, Monday, 25 May 2015 03:40 (ten years ago)

dude like watched a kobe ted talk on the fundamentals of bloodthirsty leadership this summer and now he can't interact with other people normally

Clay, Monday, 25 May 2015 03:40 (ten years ago)

bron having a slowmo panic attack all season and trying to paper over it with leadership cliches

lag∞n, Monday, 25 May 2015 03:42 (ten years ago)

turning 30 really messes w/ some ppl

Clay, Monday, 25 May 2015 03:43 (ten years ago)

xp lebron as don draper everything coming full circle, this is his coke game

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:45 (ten years ago)

lebron's version of leadership is like listening to someone narrate a ken burns documentary about basketball tho, at least w/kobe you can say it's a means to an end

call all destroyer, Monday, 25 May 2015 03:47 (ten years ago)

maybe last summer he read How to Win Games and Manipulate Teammates

Clay, Monday, 25 May 2015 03:51 (ten years ago)

why are we comparing lebron to kobe in terms of douchiness to me there is no comparison

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 03:54 (ten years ago)

kobe is the yardstick by which you measure all other levels of douchieness

lag∞n, Monday, 25 May 2015 03:54 (ten years ago)

i didn't mean to make a direct comparison and was wrong even alluding to kobe, both just seem like guys who had to learn a certain kind of leadership that isn't necessarily natural to them and so it comes off as a bit stiff when they roll out the glossary of cliches

Clay, Monday, 25 May 2015 03:56 (ten years ago)

bron always just wanted to be one of the guys its kinda sad to see him end up like this

lag∞n, Monday, 25 May 2015 03:59 (ten years ago)

#selfiewithasailor what world is this that we live in

Clay, Monday, 25 May 2015 03:59 (ten years ago)

kobe is worse of course but i at least understand what he's doing most of the time.

call all destroyer, Monday, 25 May 2015 03:59 (ten years ago)

just seems like a general sports dude problem tho

not a garbageman, i am garbage, man (m bison), Monday, 25 May 2015 04:00 (ten years ago)

Lebron gonna be spending a long night in the Star Wars bacta tank

Nhex, Monday, 25 May 2015 04:29 (ten years ago)

curry gonna need to stay tf away from dellavedorka

Spottie, Monday, 25 May 2015 04:31 (ten years ago)

are we gonna get a windhorst article about lebrons "couple weeks off" juicefest or what

Spottie, Monday, 25 May 2015 04:31 (ten years ago)

this lebron & delly presser. delly straight jacked my depression look from 2004.

Clay, Monday, 25 May 2015 05:04 (ten years ago)

also bronhat might be becoming a thing

Clay, Monday, 25 May 2015 05:05 (ten years ago)

brons outfit rn esp next to delly in a parka hoodie is insane as hell

johnny crunch, Monday, 25 May 2015 05:08 (ten years ago)

whats thom yorke doing at this press conf

johnny crunch, Monday, 25 May 2015 05:09 (ten years ago)

https://pbs.twimg.com/media/CF08MUCVIAAAmAg.jpg

for anyone who didn't see jesse and heisenberg tonight

Clay, Monday, 25 May 2015 05:33 (ten years ago)

lmao such contrast

Spottie, Monday, 25 May 2015 05:37 (ten years ago)

Not hating on what ended up being a great performance but...

"You give me 37 shots in a game, I'll have 60, 70," James said. "I had 40 tonight on 18 shots. If I get 37 shots in a game, I'm going to put up 60. Easy."

tsrobodo, Monday, 25 May 2015 06:50 (ten years ago)

Bronhats.

Madison Dumbbarfer (Leee), Monday, 25 May 2015 07:18 (ten years ago)

are we gonna get a windhorst article about lebrons "couple weeks off" juicefest or what

― Spottie, Monday, May 25, 2015 12:31 AM (7 hours ago) Bookmark Flag Post Permalink

What no windhorst is bought and paid for, when he sighed deeply and said "something happened" on the Simmons pod that's as much Lebron realness as we will ever get from that guy

Also did any of you hear him go on zach lowes pod and spend FIFTEEN MINUTES defending his anti Riley curry stance, my god his main thing was its not professional and gets in the way of him doing his job, how about this let's embrace the one cool little flair of personality the NBA lets the players get away with at this point and maybe your job should be a way to figure out how to get good good answers with oh no a toddler in the room and if you can't hack that good thing you weren't a war correspondent or court reporter or something

juice college (agent hibachi), Monday, 25 May 2015 12:42 (ten years ago)

he should think about covering baseball, a sport where fun is institutionally discouraged

call all destroyer, Monday, 25 May 2015 13:03 (ten years ago)

I listened to the Lowe/windbaghorst pod against my better judgment while subwaying to the grocery store yday - it wasn't bad once they started talking about actual games; even windhorst had to admit "yea this cavs team will get washed by gsw if they don't make adjustments" but yea the sanctity of basketball pressers is not a vested interest of most basketball writers even he gots to chill

slothroprhymes, Monday, 25 May 2015 13:29 (ten years ago)

lol fuckin delly's face in those presser photos, the epitome of a dude with just enough rudimentary intelligence to understand it will never, ever be this good again

slothroprhymes, Monday, 25 May 2015 13:33 (ten years ago)

ESPN Stats & Info ‏@ESPNStatsInfo 5m5 minutes ago
This is the first time both NBA Conference Finals series have been 3-0, under the best-of-7 format

lag∞n, Monday, 25 May 2015 15:05 (ten years ago)

just keep matthew dellavedova away from the warriors knees!

― lag∞n, Sunday, May 24, 2015 11:38 PM (Yesterday) Bookmark

Legit having panic attacks over thinking abt dellavedova and steph

, Monday, 25 May 2015 15:11 (ten years ago)

hawks shd prob preemptively take him out in game four to preserve the sanctity of the league

lag∞n, Monday, 25 May 2015 15:17 (ten years ago)

Nightmares for me last night xp

Spottie, Monday, 25 May 2015 15:23 (ten years ago)

if i wanted to worry about this bullshit i would watch hockey.

call all destroyer, Monday, 25 May 2015 15:38 (ten years ago)

I hope he takes Steph out

Mr. Murphy in the wine bar. (Sufjan Grafton), Monday, 25 May 2015 15:51 (ten years ago)

for Burmese food. There's a good spot by the SF airport

Mr. Murphy in the wine bar. (Sufjan Grafton), Monday, 25 May 2015 15:52 (ten years ago)

What's Burmese food like? I might check that place out.

Madison Dumbbarfer (Leee), Monday, 25 May 2015 17:09 (ten years ago)

xp I would worry he was gonna poison him tbh

slothroprhymes, Monday, 25 May 2015 17:10 (ten years ago)

his anti Riley curry stance, my god his main thing was its not professional and gets in the way of him doing his job

Grown man getting owned by a toddler, good look.

Madison Dumbbarfer (Leee), Monday, 25 May 2015 17:11 (ten years ago)

i haven't been to that place but my favorite burmese thing is tea leaf salad

polyphonic, Monday, 25 May 2015 17:35 (ten years ago)

burmese food is sooo good

anyway i too woud love to read a tell-all about lebron's last 12 months or so, i really hope someone has the access and impartiality to do something like that. i can't remne her doing a 180 on an athlete like I have with bron

k3vin k., Monday, 25 May 2015 17:38 (ten years ago)

He's so insufferable now

Spottie, Monday, 25 May 2015 17:40 (ten years ago)

Christ this game starts at 9pm tonight? ugh

brownie, Monday, 25 May 2015 17:49 (ten years ago)

i haven't been to that place but my favorite burmese thing is tea leaf salad

― polyphonic, Monday, May 25, 2015 1:35 PM (2 minutes ago) Bookmark Flag Post Permalink

laphet is no joke the best food in the world. my gf and I have it once a week

k3vin k., Monday, 25 May 2015 18:05 (ten years ago)

when i lived over in that part of the world i'd eat the leaves and nuts with cabbage, like a salad, but my girlfriend's always eaten it with rice and laphet with brown rice and chillies is just sublime

k3vin k., Monday, 25 May 2015 18:13 (ten years ago)

k3v otm. place I'm talking about is in Burlingame btw. Burmese food should be everywhere, but it can be hard to find.

Mr. Murphy in the wine bar. (Sufjan Grafton), Monday, 25 May 2015 18:26 (ten years ago)

This place? If so, I just passed it yesterday.

Madison Dumbbarfer (Leee), Monday, 25 May 2015 18:38 (ten years ago)

yep, that's the one!

Mr. Murphy in the wine bar. (Sufjan Grafton), Monday, 25 May 2015 18:54 (ten years ago)

Awesome! Going to see if I can corral people to try with me next week.

Madison Dumbbarfer (Leee), Monday, 25 May 2015 18:56 (ten years ago)

oh man that place looks banging

k3vin k., Monday, 25 May 2015 19:18 (ten years ago)

I don't even know what to think about Lebron anymore but this might be the most otm thing I've read about him all year:

bron having a slowmo panic attack all season and trying to paper over it with leadership cliches

― lag∞n, Sunday, May 24, 2015 11:42 PM (Yesterday) Bookmark Flag Post Permalink

juice college (agent hibachi), Tuesday, 26 May 2015 00:45 (ten years ago)

Btw I can't load the enough of the thread to find it without iPad bursting into flames but from last night- CLAY how did you miss the white stripes seven nation army thing all this time? Were u frozen in carbonite during the 2000s or something

juice college (agent hibachi), Tuesday, 26 May 2015 00:46 (ten years ago)

Well turns out Houston is a good offensive team when you stop defending entirely

juice college (agent hibachi), Tuesday, 26 May 2015 01:20 (ten years ago)

and an entertaining basketball squad

Allen (etaeoe), Tuesday, 26 May 2015 01:29 (ten years ago)

ban defense

Allen (etaeoe), Tuesday, 26 May 2015 01:29 (ten years ago)

well I just checked the score of this game

Clay, Tuesday, 26 May 2015 01:40 (ten years ago)

re: white stripes I guess I just never put that song with that band, it was just like a misc sports song to me? White stripes stuff always went in one ear and out the other to me. And the chant just never registered as "oh that's that sports song they're chanting huh"

Clay, Tuesday, 26 May 2015 01:42 (ten years ago)

Steph :-(

, Tuesday, 26 May 2015 01:55 (ten years ago)

oh god

slothroprhymes, Tuesday, 26 May 2015 02:04 (ten years ago)

that was a serious spill hope he's ok

head clowning instructor (art), Tuesday, 26 May 2015 02:05 (ten years ago)

missed the steph thing. Hit his head bad?

Clay, Tuesday, 26 May 2015 02:07 (ten years ago)

went up and over somebody and came down on back/shoulder/neck

head clowning instructor (art), Tuesday, 26 May 2015 02:10 (ten years ago)

I'm only just tuning in but it seems like he walked off of his own ability, I'm guessing they just want to do all the concussion protocols

slothroprhymes, Tuesday, 26 May 2015 02:10 (ten years ago)

yeah broadcasts just updated. head contusion, questionable to return. sounds like he's fine just understandably shaken up.

Clay, Tuesday, 26 May 2015 02:12 (ten years ago)

honestly if I'm the dubs i let this one go then take the series at home

slothroprhymes, Tuesday, 26 May 2015 02:16 (ten years ago)

yeah it's not like there's much diff b/w 9 and 7 days rest. houston's gonna win one out of pride so let 'em.

Clay, Tuesday, 26 May 2015 02:19 (ten years ago)

yeah maybe let them win a couple more too yanno

A True White Kid that can Jump (Granny Dainger), Tuesday, 26 May 2015 02:22 (ten years ago)

how the hell does that 85 footer not count on good faith

slothroprhymes, Tuesday, 26 May 2015 02:23 (ten years ago)

josh smith is shooting 100 percent

slothroprhymes, Tuesday, 26 May 2015 02:33 (ten years ago)

Dwight Howard would like to remind everyone that his emotional age is ~13 years old

Clay, Tuesday, 26 May 2015 02:39 (ten years ago)

lol at dwight getting just a flagrant one for that when horford got a 2 for a m/l unavoidable elbow drop

slothroprhymes, Tuesday, 26 May 2015 02:39 (ten years ago)

gotta throw dwight out for that smh

call all destroyer, Tuesday, 26 May 2015 02:41 (ten years ago)

props to the rox audience for giving steph claps when he left court and now when he's coming back

slothroprhymes, Tuesday, 26 May 2015 02:44 (ten years ago)

it seems small and like basic but honestly a decent amount of crowds don't do that

slothroprhymes, Tuesday, 26 May 2015 02:45 (ten years ago)

okay pull steph it's not worth it

Clay, Tuesday, 26 May 2015 02:50 (ten years ago)

hope we don't have a Rookie of the Year situation with that fall

Mr. Murphy in the wine bar. (Sufjan Grafton), Tuesday, 26 May 2015 02:52 (ten years ago)

yeah they need to punt here xp

call all destroyer, Tuesday, 26 May 2015 02:52 (ten years ago)

lol yes please suspend Dwight for an elimination game I beg of you

Clay, Tuesday, 26 May 2015 02:54 (ten years ago)

let steph chill, steve, it's better in the long run

slothroprhymes, Tuesday, 26 May 2015 02:58 (ten years ago)

he looks walleyed and tired

slothroprhymes, Tuesday, 26 May 2015 02:59 (ten years ago)

hope we don't have a Rookie of the Year situation with that fall

Hate you for even suggesting this

, Tuesday, 26 May 2015 02:59 (ten years ago)

this game is quietly featuring some really A+ jvg nitpickery

Clay, Tuesday, 26 May 2015 03:01 (ten years ago)

lol yea he's in rare form

are they under bron/rich paul payola to talk this positively about tristan thompson

slothroprhymes, Tuesday, 26 May 2015 03:02 (ten years ago)

well remember what kind of teams jvg liked to put on the floor

A True White Kid that can Jump (Granny Dainger), Tuesday, 26 May 2015 03:05 (ten years ago)

wait is harden not doing the cool gesture tonight ... bc lil b warned him abt it??

Clay, Tuesday, 26 May 2015 03:21 (ten years ago)

*cook

Clay, Tuesday, 26 May 2015 03:21 (ten years ago)

lol I hadn't even noticed

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 26 May 2015 03:35 (ten years ago)

at least he's giving the fans *something* to be happy about; too bad he can't seem to take over games that actually matter

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 26 May 2015 03:40 (ten years ago)

xxp nah he totes did it at least a few times

slothroprhymes, Tuesday, 26 May 2015 03:45 (ten years ago)

I naturally support this bc lil b sucks and should not affect the NBA

slothroprhymes, Tuesday, 26 May 2015 03:45 (ten years ago)

at least he's giving the fans *something* to be happy about; too bad he can't seem to take over games that actually matter

― Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, May 26, 2015 3:40 AM (10 minutes ago) Bookmark Flag Post Permalink

wut

Matt Armstrong, Tuesday, 26 May 2015 03:51 (ten years ago)

I hate Harden but come on

Matt Armstrong, Tuesday, 26 May 2015 03:53 (ten years ago)

he's been really great like three games in a row

Clay, Tuesday, 26 May 2015 03:57 (ten years ago)

mostly what I've learned from this year's playoffs is that everyone who goes to the movies this summer should be executed

Clay, Tuesday, 26 May 2015 04:00 (ten years ago)

Not gonna win when j smoov basically shoots 100% and you give up 45 points in the 1st. Best thing obv curry not too hurt and also klay kinda coming alive.

Spottie, Tuesday, 26 May 2015 04:13 (ten years ago)

Harden has been amazing this series minus last game.

Spottie, Tuesday, 26 May 2015 04:13 (ten years ago)

lol yes please suspend Dwight for an elimination game I beg of you

― Clay, Monday, May 25, 2015 10:54 PM (Yesterday) Bookmark Flag Post Permalink

if he had connected with that elbow like he intended he wldve been but he missed

lag∞n, Tuesday, 26 May 2015 04:46 (ten years ago)

I naturally support this bc lil b sucks and should not affect the NBA

― slothroprhymes, Monday, May 25, 2015 11:45 PM (Yesterday) Bookmark Flag Post Permalink

based good >>>>> sloth p

lag∞n, Tuesday, 26 May 2015 04:47 (ten years ago)

mostly what I've learned from this year's playoffs is that everyone who goes to the movies this summer should be executed

― Clay, Tuesday, May 26, 2015 12:00 AM (48 minutes ago) Bookmark Flag Post Permalink

mad max and ex machina r both classic btw recommended

lag∞n, Tuesday, 26 May 2015 04:49 (ten years ago)

ex machina looks like weird science without the laughs

Matt Armstrong, Tuesday, 26 May 2015 04:56 (ten years ago)

Would much rather the dubs beat the rockets w dawight playing so I can see his smirky face squirm

Spottie, Tuesday, 26 May 2015 04:57 (ten years ago)

its one of those movies thats just really perfect concise story telling, its like not revelatory or epochal or anything but theres not a hair out of place xp

lag∞n, Tuesday, 26 May 2015 04:58 (ten years ago)

lag∞n
Posted: May 25, 2015 at 9:49:40 PM

mad max and ex machina r both classic btw recommended

yeah these look okay to good and obv v positive reviews, using the they technically opened in spring exception

Clay, Tuesday, 26 May 2015 05:00 (ten years ago)

what is the spring tho u know

lag∞n, Tuesday, 26 May 2015 05:01 (ten years ago)

mad max btw def go see it in the theater btw wow u will not regret

lag∞n, Tuesday, 26 May 2015 05:01 (ten years ago)

For sure gonna go see it at a second run where I can drink beer and eat pizza

Clay, Tuesday, 26 May 2015 05:02 (ten years ago)

reasonable

lag∞n, Tuesday, 26 May 2015 05:04 (ten years ago)

vmic

https://www.youtube.com/watch?v=7SH7zds-aGc

Matt Armstrong, Tuesday, 26 May 2015 05:36 (ten years ago)

Oracle Arena @OracleArena · 2h 2 hours ago
.@LILBTHEBASEDGOD will be gracing Oracle Arena with his presence on Wednesday. #TYBG #DubNation

Spottie, Tuesday, 26 May 2015 06:33 (ten years ago)

Ex mach was str8 ass

rip van wanko, Tuesday, 26 May 2015 07:10 (ten years ago)

ex machina looks like weird science without the laughs
― Matt Armstrong, Monday, May 25, 2015 11:56 PM (Yesterday) Bookmark Flag Post Permalink

wait weird science had laughs? That movie is repulsive and horrifying

not a garbageman, i am garbage, man (m bison), Tuesday, 26 May 2015 10:38 (ten years ago)

at least he's giving the fans *something* to be happy about; too bad he can't seem to take over games that actually matter

― Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, May 26, 2015 3:40 AM (10 minutes ago) Bookmark Flag Post Permalink

wut

― Matt Armstrong, Tuesday, May 26, 2015 3:51 AM (7 hours ago) Bookmark Flag Post Permalink

I hate Harden but come on

― Matt Armstrong, Tuesday, May 26, 2015 3:53 AM (7 hours ago) Bookmark Flag Post Permalink

sorry, basically all I've been able to catch of this series is the second half of the games, & this was the first time he seemed to be playing well when I switched on the TV... I shoulda just kept my mouth shut

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 26 May 2015 11:18 (ten years ago)

I think my younger self woulda been more excited to see a dude score 45 down 3-0 in a series, these days it just makes me sad

Heroic melancholy continues to have a forceful grip on (bernard snowy), Tuesday, 26 May 2015 11:20 (ten years ago)

harden is having a very classic series, just playing against a better team

lag∞n, Tuesday, 26 May 2015 13:46 (ten years ago)

Kevin Pelton ‏@kpelton 5m5 minutes ago
Josh Smith playoff 3-point shooting update:
Atlanta 15-87 (17.2%)
Houston 25-64 (39.1%)

lag∞n, Tuesday, 26 May 2015 15:55 (ten years ago)

love how the warriors basically just turn there back on him when he gets the ball out there.

Spottie, Tuesday, 26 May 2015 16:02 (ten years ago)

reasonable bet

lag∞n, Tuesday, 26 May 2015 16:08 (ten years ago)

"When Harvard called, that's all they saw," he said. "Vanderbilt was the best of both worlds -- great school and great athletics. It was the only way I could justify to my parents not going to Harvard."

With his mother pushing for a career in medicine, Ezeli began work in a difficult biology major. After his sophomore season, when it began to look like he could play basketball beyond college, he changed his major to economics.

http://www.mercurynews.com/warriors/ci_28183085/festus-ezeli-and-long-strange-trip-nba

Madison Dumbbarfer (Leee), Tuesday, 26 May 2015 17:26 (ten years ago)

aw i'm a festus fan now, he should totally go to med school after the NBA

k3vin k., Tuesday, 26 May 2015 17:36 (ten years ago)

He graduated from high school in his Nigerian hometown of Benin City when he was just 14 years old -- skipping kindergarten, then jumping from fourth to seventh grade.

Education is first with his parents -- Festus Ezeli Sr., a businessman, and Patricia, who is an attorney and owns a school in Nigeria.

hmm

lag∞n, Tuesday, 26 May 2015 17:39 (ten years ago)

https://pbs.twimg.com/media/CF8xB41WYAAsClS.png

bron stay playing off

lag∞n, Tuesday, 26 May 2015 17:54 (ten years ago)

Uh oh I uh wouldn't totally want to be on that list

juice college (agent hibachi), Tuesday, 26 May 2015 21:07 (ten years ago)

I mean the OFFS are the whole point but yikes that's some wear

juice college (agent hibachi), Tuesday, 26 May 2015 21:08 (ten years ago)

Lagoon, that's pretty common in Nigeria even amongst people whose parents don't own schools.

tsrobodo, Tuesday, 26 May 2015 21:35 (ten years ago)

bazemore preventing the hawks from being straight-up blown out

slothroprhymes, Wednesday, 27 May 2015 00:42 (ten years ago)

AND TURTLE IS ON THE SCENE

Allen (etaeoe), Wednesday, 27 May 2015 01:17 (ten years ago)

Hawks looking good.

brownie, Wednesday, 27 May 2015 01:20 (ten years ago)

bazemore preventing the hawks from being straight-up blown out
--slothroprhymes

smh liam you were dead wrong about this

slothroprhymes, Wednesday, 27 May 2015 01:20 (ten years ago)

hahaha

Allen (etaeoe), Wednesday, 27 May 2015 01:47 (ten years ago)

"I think the peer pressure may be coming from himself" --Reggie Miller

Matt Armstrong, Wednesday, 27 May 2015 01:54 (ten years ago)

Lol sloth

juice college (agent hibachi), Wednesday, 27 May 2015 01:55 (ten years ago)

This is a p boring game other than Lebron going nuts early, Hawks seem ready to go fishin'

juice college (agent hibachi), Wednesday, 27 May 2015 01:56 (ten years ago)

marv should use the rest of the game to rank his favorite entourage episodes

Allen (etaeoe), Wednesday, 27 May 2015 01:59 (ten years ago)

al horford with 2 points, 2 rebounds

5 assists tho

moullet, Wednesday, 27 May 2015 02:10 (ten years ago)

pretty pathetic effort from everyone on the hawks this whole series

k3vin k., Wednesday, 27 May 2015 02:12 (ten years ago)

marv as entourage fan is the most hilarious albeit vaguely disturbing development

slothroprhymes, Wednesday, 27 May 2015 02:13 (ten years ago)

"I think the peer pressure may be coming from himself" --Reggie Miller

― Matt Armstrong, Tuesday, May 26, 2015 9:54 PM (28 minutes ago) Bookmark Flag Post Permalink

/nods/

lag∞n, Wednesday, 27 May 2015 02:23 (ten years ago)

lebron (and james jones lol) become first players to make 5 straight finals since the 60s celtics

k3vin k., Wednesday, 27 May 2015 02:30 (ten years ago)

jame jones

lag∞n, Wednesday, 27 May 2015 02:32 (ten years ago)

keep him close

lag∞n, Wednesday, 27 May 2015 02:32 (ten years ago)

at this rate I just wan someone to break dellevadova's nose, nothing that impacts his livelihood per se (long break til the finals) but a good sock in the bridge of the nose

slothroprhymes, Wednesday, 27 May 2015 02:35 (ten years ago)

reasonable

lag∞n, Wednesday, 27 May 2015 02:36 (ten years ago)

tbf this does once again illuminate how australia is the descendants of murderers thieves rapists and traitors

slothroprhymes, Wednesday, 27 May 2015 02:38 (ten years ago)

why won't we learn not to trust them except for some of their actors and musicians

slothroprhymes, Wednesday, 27 May 2015 02:39 (ten years ago)

NBA on ESPN ‏@ESPNNBA 5m5 minutes ago
J.R. Smith has posted a double-double in back-to-back games...he had none previously this season.

nba playoffs r p cool tbqh

lag∞n, Wednesday, 27 May 2015 02:46 (ten years ago)

Jr is p cool, I'm glad he and shump found a good team

not a garbageman, i am garbage, man (m bison), Wednesday, 27 May 2015 02:49 (ten years ago)

Lagoon, that's pretty common in Nigeria even amongst people whose parents don't own schools.

― tsrobodo, Tuesday, May 26, 2015 5:35 PM (5 hours ago) Bookmark Flag Post Permalink

whats the deal tell me more

lag∞n, Wednesday, 27 May 2015 02:50 (ten years ago)

jr is maybe the stupidest player in the nba no offense

lag∞n, Wednesday, 27 May 2015 02:51 (ten years ago)

I don't doubt this, I just don't think intelligence is a prerequisite for being a cool or decent person or baller

not a garbageman, i am garbage, man (m bison), Wednesday, 27 May 2015 02:52 (ten years ago)

fair

lag∞n, Wednesday, 27 May 2015 02:53 (ten years ago)

goddamnit rachel nichols I've always trusted you how you gonna give dellevadova the postgame interview

slothroprhymes, Wednesday, 27 May 2015 02:56 (ten years ago)

JR is a cool/decent person now?

k3vin k., Wednesday, 27 May 2015 03:01 (ten years ago)

Wos ‏@BigWos 1m1 minute ago
Dan Gilbert should say nothing but “Thank you, LeBron. You are a great dad."

lag∞n, Wednesday, 27 May 2015 03:02 (ten years ago)

Cool and decent baller, but my pt extend beyond ballers, IDK of Jr's character

not a garbageman, i am garbage, man (m bison), Wednesday, 27 May 2015 03:02 (ten years ago)

Bron so stoked to cover his hairline right now

not a garbageman, i am garbage, man (m bison), Wednesday, 27 May 2015 03:03 (ten years ago)

jr is terribe

call all destroyer, Wednesday, 27 May 2015 03:05 (ten years ago)

terrible, also

call all destroyer, Wednesday, 27 May 2015 03:06 (ten years ago)

Y'all don't appreciate complicated ppl like I do

not a garbageman, i am garbage, man (m bison), Wednesday, 27 May 2015 03:06 (ten years ago)

he's just a gunner, there's nothing interesting about him

call all destroyer, Wednesday, 27 May 2015 03:06 (ten years ago)

JR is the pits questioning bisons character rn

Spottie, Wednesday, 27 May 2015 03:07 (ten years ago)

@DanWolken: Tristan Thompson refuses to eat seafood because 'fish eat their poos'

Matt Armstrong, Wednesday, 27 May 2015 03:09 (ten years ago)

WE'RE IN THE NBA FINALS!! AND WE HAVE AN OUTSIDE CHANCE TO WIN IT!!!!!

Mr. Snrub, Wednesday, 27 May 2015 03:09 (ten years ago)

grats snrub

lag∞n, Wednesday, 27 May 2015 03:10 (ten years ago)

tristan is wrong about seafood but i'm on board with his stances re: leftovers and cold cuts

call all destroyer, Wednesday, 27 May 2015 03:10 (ten years ago)

seafood is good i had seafood for dinner but was not aware re they eat their poop need to retreat for a period of silent reflection

lag∞n, Wednesday, 27 May 2015 03:12 (ten years ago)

rip heez and other ilh hawks fans

Spottie, Wednesday, 27 May 2015 03:17 (ten years ago)

it was a good run / hope for the future

lag∞n, Wednesday, 27 May 2015 03:18 (ten years ago)

still u wld prefer not to get brutally swept by a shallow team missing two of their three best players

lag∞n, Wednesday, 27 May 2015 03:18 (ten years ago)

thabo was obv the mvp we had it wrong all along

Spottie, Wednesday, 27 May 2015 03:19 (ten years ago)

ugh after tomorrow the only sports I can watch till next thursday barring an improbable rockets comeback and more games after tomorrow will be the red sox

slothroprhymes, Wednesday, 27 May 2015 03:19 (ten years ago)

fuck the police

lag∞n, Wednesday, 27 May 2015 03:19 (ten years ago)

otm

slothroprhymes, Wednesday, 27 May 2015 03:19 (ten years ago)

chuck literally arguing that basketball concusions are somehow different than football concussions rip inside c u next year you lousy shitheads

Clay, Wednesday, 27 May 2015 03:27 (ten years ago)

ugh after tomorrow the only sports I can watch till next thursday barring an improbable rockets comeback and more games after tomorrow will be the red sox

― slothroprhymes, Tuesday, May 26, 2015 8:19 PM (7 minutes ago) Bookmark Flag Post Permalink

time for me to strengthen my marriage and relationship w my kids is how i look at it

Spottie, Wednesday, 27 May 2015 03:27 (ten years ago)

whats the deal tell me more

― lag∞n, Wednesday, May 27, 2015 2:50 AM (14 minutes ago) Bookmark Flag Post Permalink

I've never heard of a school in southern Nigeria where you can't skip grades by acing the required exams. The culture there can be crazy obsessive and given the scholarships he was offered I'm not shocked that he passed the SSCE at 14.

tsrobodo, Wednesday, 27 May 2015 03:40 (ten years ago)

Feel like y'all are missing the joy of Jr's terrible shot selection, like it is legit hilarious an now he's gonna do that in the finals cmon

not a garbageman, i am garbage, man (m bison), Wednesday, 27 May 2015 03:44 (ten years ago)

i don't like things that are bad

call all destroyer, Wednesday, 27 May 2015 03:46 (ten years ago)

i like some things that r bad tbh

lag∞n, Wednesday, 27 May 2015 03:48 (ten years ago)

I've never heard of a school in southern Nigeria where you can't skip grades by acing the required exams. The culture there can be crazy obsessive and given the scholarships he was offered I'm not shocked that he passed the SSCE at 14.

― tsrobodo, Tuesday, May 26, 2015 11:40 PM (8 minutes ago) Bookmark Flag Post Permalink

cool thx, whats ur relationship to nigeria if u dont mind me inquiring

lag∞n, Wednesday, 27 May 2015 03:49 (ten years ago)

tbh i probably do too but i view that as a personal failing that should be resolved. i certainly don't like bad shots in basketball.

call all destroyer, Wednesday, 27 May 2015 03:50 (ten years ago)

xp

call all destroyer, Wednesday, 27 May 2015 03:50 (ten years ago)

yeah im not into bad shots, jr is p entertaining in his own way tho, he wld drive me crazy too root for

lag∞n, Wednesday, 27 May 2015 03:52 (ten years ago)

Just let go and embrace the funk of contested 28 footers with 16 on the shot clock when LeBron is open on the block

not a garbageman, i am garbage, man (m bison), Wednesday, 27 May 2015 03:52 (ten years ago)

Embrace game 3 when he hits 6 3s and embrace the ultimately arbitrary nature of life

not a garbageman, i am garbage, man (m bison), Wednesday, 27 May 2015 03:53 (ten years ago)

this is evidently the spurs fan equivalent of hanging out in a creepy alley or browsing craiglist casual encounters eh

call all destroyer, Wednesday, 27 May 2015 03:54 (ten years ago)

"You know Ernie the problem we have is there is no inconsistency sometimes"

Shaq on dwight not getting a flagrant 2

Spottie, Wednesday, 27 May 2015 05:20 (ten years ago)

cool thx, whats ur relationship to nigeria if u dont mind me inquiring

― lag∞n, Wednesday, May 27, 2015 3:49 AM (59 minutes ago) Bookmark Flag Post Permalink

My mother and my second passport

tsrobodo, Wednesday, 27 May 2015 05:22 (ten years ago)

Has any other play done that side step jumper thing harden does?
https://www.youtube.com/watch?v=NSZG-1ySVZY
like he does here at 2:40, 3:53 and 5:58

Spottie, Wednesday, 27 May 2015 06:34 (ten years ago)

i feel like i have seen that but cant say who

micah, Wednesday, 27 May 2015 13:03 (ten years ago)

pierce does it tho his is more of a step where hardens is a hop

lag∞n, Wednesday, 27 May 2015 13:19 (ten years ago)

I thought of pierce as well

, Wednesday, 27 May 2015 13:23 (ten years ago)

Harden's shimmy seems to work well when defenders forget that they're guarding a left handed player (like Klay did for much of the first 2 games)

tsrobodo, Wednesday, 27 May 2015 13:39 (ten years ago)

manu (but it’s usually way sloppier)

the replay at 3:53 is slick

Allen (etaeoe), Wednesday, 27 May 2015 13:52 (ten years ago)

harden's is a travel half the time /justsayin

k3vin k., Wednesday, 27 May 2015 13:59 (ten years ago)

0:50 especially

k3vin k., Wednesday, 27 May 2015 14:00 (ten years ago)

yup lol

Nhex, Wednesday, 27 May 2015 14:09 (ten years ago)

ad 5:58

k3vin k., Wednesday, 27 May 2015 14:13 (ten years ago)

http://media.zenfs.com/en-US/video/video.snl.com/SNL_1350_09_Debbie_Downer.png

k3vin k., Wednesday, 27 May 2015 14:14 (ten years ago)

yeah def a travel but if he can get away w it then w/e i guess

Spottie, Wednesday, 27 May 2015 14:26 (ten years ago)

pierce good call

Spottie, Wednesday, 27 May 2015 14:26 (ten years ago)

western conf >>>

https://pbs.twimg.com/media/CGBtm33W8AE4Lwg.png

lag∞n, Wednesday, 27 May 2015 16:47 (ten years ago)

He's played the Spurs three times too, only other opponents Dallas and OKC. I don't remember OKC doing a particular number on him but Dallas did well obv I think they threw Marion at him a lot

juice college (agent hibachi), Wednesday, 27 May 2015 20:52 (ten years ago)

Lebron is a very bad man

https://sports.vice.com/en_us/article/the-cias-last-detainee-hates-lebron-james-and-other-letters-from-guantanamo-bay

polyphonic, Wednesday, 27 May 2015 21:03 (ten years ago)

lol

lag∞n, Wednesday, 27 May 2015 21:06 (ten years ago)

lawyer should have asked him if he thinks lebron is the juiceman

Mr. Murphy in the wine bar. (Sufjan Grafton), Wednesday, 27 May 2015 21:15 (ten years ago)

wow. that story is really depressing, i'm amazed at that guy's will, tbh

Nhex, Wednesday, 27 May 2015 21:55 (ten years ago)

Steph has a sleeve on what's up

, Thursday, 28 May 2015 01:15 (ten years ago)

apparently bruised in the fall

call all destroyer, Thursday, 28 May 2015 01:19 (ten years ago)

Why is Houston turning this into an ugly game let gsw run please roll over and die rockets

, Thursday, 28 May 2015 01:28 (ten years ago)

I think James harden should be studied for the advancement of science, apparently he has a nerve in his forearm that when lightly tugged by iguodala causes him to shoot, throw his head back, and flail his legs in the air

juice college (agent hibachi), Thursday, 28 May 2015 01:29 (ten years ago)

dwight is balling out

call all destroyer, Thursday, 28 May 2015 01:30 (ten years ago)

i have no idea what the warriors are doing on offense

call all destroyer, Thursday, 28 May 2015 01:34 (ten years ago)

or defense

Allen (etaeoe), Thursday, 28 May 2015 01:35 (ten years ago)

terrible special teams too

Allen (etaeoe), Thursday, 28 May 2015 01:36 (ten years ago)

woof

Allen (etaeoe), Thursday, 28 May 2015 01:38 (ten years ago)

starting to talk myself into the cavs beating the warriors, talk me down guys

Allen (etaeoe), Thursday, 28 May 2015 01:39 (ten years ago)

the cavs are from the eastern conference

Clay, Thursday, 28 May 2015 01:42 (ten years ago)

Cavs won't be able to defend both klay and curry

juice college (agent hibachi), Thursday, 28 May 2015 01:52 (ten years ago)

cavs wont be able to defend... anyone

lag∞n, Thursday, 28 May 2015 01:54 (ten years ago)

They've played good d thus far

tsrobodo, Thursday, 28 May 2015 01:57 (ten years ago)

They're far from a disaster on that end

tsrobodo, Thursday, 28 May 2015 01:58 (ten years ago)

it's extremely weird when mark jackson says "if i was steve kerr"

you were and they fired you!

J0rdan S., Thursday, 28 May 2015 01:58 (ten years ago)

lol

lag∞n, Thursday, 28 May 2015 01:59 (ten years ago)

They're far from a disaster on that end

― tsrobodo, Wednesday, May 27, 2015 9:58 PM (57 seconds ago) Bookmark Flag Post Permalink

not that far from a disaster imho, just havent faced anyone who cn make them pay

lag∞n, Thursday, 28 May 2015 01:59 (ten years ago)

Wow Steph

juice college (agent hibachi), Thursday, 28 May 2015 02:05 (ten years ago)

it's extremely weird when mark jackson says "if i was steve kerr"

you were and they fired you!

― J0rdan S., Wednesday, May 27, 2015 9:58 PM (6 minutes ago) Bookmark Flag Post Permalink

lol man down

juice college (agent hibachi), Thursday, 28 May 2015 02:05 (ten years ago)

"hand down, man down" is honestly an amazing catchphrase

i've always harbored this opinion

J0rdan S., Thursday, 28 May 2015 02:06 (ten years ago)

They've numerically been the best defensive team in the playoffs and yes its the east but that's nothing like disaster

tsrobodo, Thursday, 28 May 2015 02:06 (ten years ago)

Mark Jackson is basically the distilled form of all my dad's vices.

tsrobodo, Thursday, 28 May 2015 02:08 (ten years ago)

I love my dad but I despise Jackson more than I can say

tsrobodo, Thursday, 28 May 2015 02:09 (ten years ago)

They've numerically been the best defensive team in the playoffs and yes its the east but that's nothing like disaster

― tsrobodo, Wednesday, May 27, 2015 10:06 PM (2 minutes ago) Bookmark Flag Post Permalink

numerically?

lag∞n, Thursday, 28 May 2015 02:11 (ten years ago)

it's extremely weird when mark jackson says "if i was steve kerr"

you were and they fired you!

― J0rdan S., Wednesday, May 27, 2015 9:58 PM (10 minutes ago)

lol

k3vin k., Thursday, 28 May 2015 02:11 (ten years ago)

read statistically, points allowed etc.

tsrobodo, Thursday, 28 May 2015 02:12 (ten years ago)

points allowed is not meaningful

lag∞n, Thursday, 28 May 2015 02:13 (ten years ago)

Not by itself no but
The Cavaliers lead the playoffs in:

Points allowed per 100 possessions (98.1)
Points allowed at 91.4 per game.
Blocked shots at seven per game.
Three-point shooting field goal percentage allowed (28.6%).
Field-goal percentage allowed (41.2%), among the four remaining teams.

Plus they've looked good

tsrobodo, Thursday, 28 May 2015 02:14 (ten years ago)

heres the list of playoff defensive efficiency, either the east is like super good at defense or something else might be going on

http://i.imgur.com/SdXs1I6.png

lag∞n, Thursday, 28 May 2015 02:15 (ten years ago)

clue

FIRST TEAM
F: LeBron James
F: Anthony Davis
C: Marc Gasol
G: Stephen Curry
G: James Harden

SECOND TEAM
F: LaMarcus Aldridge
F: DeMarcus Cousins
C: Pau Gasol
G: Russell Westbrook
G: Chris Paul

THIRD TEAM
F: Blake Griffin
F: Tim Duncan
C: DeAndre Jordan
G: Klay Thompson
G: Kyrie Irving

lag∞n, Thursday, 28 May 2015 02:18 (ten years ago)

Well look at it this way, most of the top 7 teams played notably good D in the regular season besides Cleveland so their presence in the upper portion of that list suggests at least some measure of improvement on their part

tsrobodo, Thursday, 28 May 2015 02:18 (ten years ago)

or they cld just be playing shitty teams

lag∞n, Thursday, 28 May 2015 02:21 (ten years ago)

i mean replacing kevin love had to help but they havent played an offense that cn exploit their pretty obvious weaknesses

lag∞n, Thursday, 28 May 2015 02:22 (ten years ago)

does using a depressed australian scrub to take out opposing players kness count as good D

lag∞n, Thursday, 28 May 2015 02:23 (ten years ago)

harden has 8 turnovers in the game btw

lag∞n, Thursday, 28 May 2015 02:26 (ten years ago)

Matchups have been favourable.

If they weren't shutting those shitty teams down that might give good cause to seriously doubt their defense but as it stands...

does using a depressed australian scrub to take out opposing players kness count as good D

― lag∞n, Thursday, May 28, 2015 2:23 AM (1 minute ago) Bookmark Flag Post Permalink

Yesterday I woke up sucking a lemon

tsrobodo, Thursday, 28 May 2015 02:26 (ten years ago)

j0rdan's mark jackson post was amazing

Clay, Thursday, 28 May 2015 02:27 (ten years ago)

cavs are not suddenly good at d let's get real here

call all destroyer, Thursday, 28 May 2015 02:34 (ten years ago)

yeah i mean mostly just consider their personal and the potential matchups w/ the warriors and it's pretty much gonna be bad

Clay, Thursday, 28 May 2015 02:35 (ten years ago)

klay just made a three jumping sideways with his torso rotated 45 degrees like nbd

lag∞n, Thursday, 28 May 2015 02:39 (ten years ago)

it looked normal

lag∞n, Thursday, 28 May 2015 02:39 (ten years ago)

all the cavs starters recently have been either good or very good defenders, no surprise theyre playing well on that end

micah, Thursday, 28 May 2015 02:39 (ten years ago)

thompson w/ 5 fouls that's bad

Clay, Thursday, 28 May 2015 02:40 (ten years ago)

hey

http://i.imgur.com/czVEJ70.png

lag∞n, Thursday, 28 May 2015 02:40 (ten years ago)

klay you dummy

call all destroyer, Thursday, 28 May 2015 02:40 (ten years ago)

jesus what's happening here!

Clay, Thursday, 28 May 2015 02:41 (ten years ago)

lol klay whatre u doin these are terrible fouls!

lag∞n, Thursday, 28 May 2015 02:41 (ten years ago)

my mind is blown by how dumb Klay Thompson appears to be

Matt Armstrong, Thursday, 28 May 2015 02:41 (ten years ago)

Klay's brain just shut off on those two dumb reach-ins

juice college (agent hibachi), Thursday, 28 May 2015 02:42 (ten years ago)

kyrie has basically never been anything but a very bad defender

J0rdan S., Thursday, 28 May 2015 02:42 (ten years ago)

good argument for pulling a player w foul trouble is to at least give them a min to think abt what theyve done

lag∞n, Thursday, 28 May 2015 02:43 (ten years ago)

fucking klay

polyphonic, Thursday, 28 May 2015 02:43 (ten years ago)

kyrie is one of the worst defenders in the nba tbf

lag∞n, Thursday, 28 May 2015 02:43 (ten years ago)

rockets will not go gentle into that good night, rage rage against the dying of the light

slothroprhymes, Thursday, 28 May 2015 02:44 (ten years ago)

what was wrong with the old mustard

polyphonic, Thursday, 28 May 2015 02:45 (ten years ago)

bogut hangnail, that could keep him out a while

Matt Armstrong, Thursday, 28 May 2015 02:47 (ten years ago)

harden should be fined every time he kicks out to josh smith

J0rdan S., Thursday, 28 May 2015 02:49 (ten years ago)

dying at that howard outlet

call all destroyer, Thursday, 28 May 2015 02:51 (ten years ago)

god i love watching dray green play, he does so many little things right

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 02:52 (ten years ago)

and then he shot some garbage but oh welllll

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 02:52 (ten years ago)

draymond shooting as if the rec league took the winter off

call all destroyer, Thursday, 28 May 2015 02:53 (ten years ago)

that was an incredible air ball

lag∞n, Thursday, 28 May 2015 02:54 (ten years ago)

This game is painful to watch

, Thursday, 28 May 2015 02:54 (ten years ago)

shit i cursd dray, taking it back

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 02:56 (ten years ago)

harden my lord so bad and dumb sometimes

Clay, Thursday, 28 May 2015 02:57 (ten years ago)

draymond the only player in the league who can pick harden's pocket and guard dwight straight up in the same game?

J0rdan S., Thursday, 28 May 2015 02:57 (ten years ago)

HARDEN HAS 10 TURNOVERS !!!!!!!!!

lag∞n, Thursday, 28 May 2015 02:57 (ten years ago)

brow obvs xp

lag∞n, Thursday, 28 May 2015 02:58 (ten years ago)

Marc gasol maybe?

Clay, Thursday, 28 May 2015 02:59 (ten years ago)

jet terry having a throwback game rn

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 02:59 (ten years ago)

i'm still pissed about how bad jet was the year he played in boston.

call all destroyer, Thursday, 28 May 2015 03:03 (ten years ago)

we all are, CAD. we all are.

slothroprhymes, Thursday, 28 May 2015 03:05 (ten years ago)

most tos in a playoff game is a v fitting record for harden to tie

call all destroyer, Thursday, 28 May 2015 03:06 (ten years ago)

HARDEN HAS 11 TURNOVERS !!!!!!!!!

lag∞n, Thursday, 28 May 2015 03:06 (ten years ago)

shump and delly have been starting iirc

micah, Thursday, 28 May 2015 03:09 (ten years ago)

deledova started what two games

lag∞n, Thursday, 28 May 2015 03:12 (ten years ago)

what are they chanting

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:17 (ten years ago)

are they chanting warriors, thats kinda cool

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:17 (ten years ago)

ouch

call all destroyer, Thursday, 28 May 2015 03:18 (ten years ago)

warriors have the best concussed backcourt in NBA history

J0rdan S., Thursday, 28 May 2015 03:18 (ten years ago)

they chant warriors, yeah

polyphonic, Thursday, 28 May 2015 03:18 (ten years ago)

https://vine.co/v/ebrHjQhAbDt

lag∞n, Thursday, 28 May 2015 03:18 (ten years ago)

yeah the Warriors chant has been around all playoffs

getting your temple smashed like that hurts SO BAD

Clay, Thursday, 28 May 2015 03:19 (ten years ago)

all season, and last season too

polyphonic, Thursday, 28 May 2015 03:20 (ten years ago)

Ariza gonna take out both curry and klay

, Thursday, 28 May 2015 03:20 (ten years ago)

klay got kneed very hard in his head

lag∞n, Thursday, 28 May 2015 03:20 (ten years ago)

dubs got this

Clay, Thursday, 28 May 2015 03:21 (ten years ago)

barnes is so good now

polyphonic, Thursday, 28 May 2015 03:21 (ten years ago)

did mike breen just yell GOTTI! respect.

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:21 (ten years ago)

if barnes never gets paid to be anything more than this he'll be the most perfect player in the league

J0rdan S., Thursday, 28 May 2015 03:23 (ten years ago)

rockets are gonna lose this series but they should be pretty damn proud of this season

k3vin k., Thursday, 28 May 2015 03:23 (ten years ago)

yeah this is a perfect situation for barnes

k3vin k., Thursday, 28 May 2015 03:23 (ten years ago)

as proud as a team that has dwight howard on it, yes

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:23 (ten years ago)

rockets are gonna lose this series but they should be pretty damn proud of this season

― k3vin k., Wednesday, May 27, 2015 11:23 PM (50 seconds ago) Bookmark Flag Post Permalink

yeah i was not a believer after they got beat by portland in round 1 last year but this was a good run, who knows where they'd be if harden didn't have an actively harmful game tonight

call all destroyer, Thursday, 28 May 2015 03:25 (ten years ago)

proud of james harden and his 5000 turnovers

Clay, Thursday, 28 May 2015 03:26 (ten years ago)

need one more tonight!

lag∞n, Thursday, 28 May 2015 03:26 (ten years ago)

waryers taste blood

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:26 (ten years ago)

YESSSSS

lag∞n, Thursday, 28 May 2015 03:26 (ten years ago)

HARDEN HAS 12 TURNOVERS !!!!!!!!!

lag∞n, Thursday, 28 May 2015 03:27 (ten years ago)

there's a trivia question i will always know the answer to

call all destroyer, Thursday, 28 May 2015 03:27 (ten years ago)

baked up a dozen

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:28 (ten years ago)

lol bise

Clay, Thursday, 28 May 2015 03:28 (ten years ago)

Klay is bleeding from his ear gross

, Thursday, 28 May 2015 03:30 (ten years ago)

blood pouring out klays ear

lag∞n, Thursday, 28 May 2015 03:31 (ten years ago)

h-town trying their patented "OH SHIT ITS MIDTERMS AND I HAVENT READ ANYTHING" *buys 4 copies of text, opens to 4 different locations in books and reads a little bit from each page* technique

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:31 (ten years ago)

the rockets season was totally confounding considering how wacky & random their rotation ended up being, i still don't really understand it but it feels like they're one more really good player away from being one of the best teams in the league

J0rdan S., Thursday, 28 May 2015 03:32 (ten years ago)

agreed

lag∞n, Thursday, 28 May 2015 03:33 (ten years ago)

https://pbs.twimg.com/media/CGEA5xVW8AAcXcy.jpg:large
he, he

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:33 (ten years ago)

xxp yeah definitely

slothroprhymes, Thursday, 28 May 2015 03:33 (ten years ago)

Dwight is so idk lmao

, Thursday, 28 May 2015 03:36 (ten years ago)

the version of the rockets were chris bosh is playing stretch 4 looking at 5 wide open 3s per game instead of josh smith continues to fascinate me

J0rdan S., Thursday, 28 May 2015 03:37 (ten years ago)

goddamn i hope the w's have a team to take to the finals

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:38 (ten years ago)

d-12 should get tossed imo

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:38 (ten years ago)

eject dwight

call all destroyer, Thursday, 28 May 2015 03:38 (ten years ago)

also kill him

call all destroyer, Thursday, 28 May 2015 03:38 (ten years ago)

no, the death penalty is morally wrong, but eject him from the game and force him to pay damages

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:39 (ten years ago)

that was a bit much

J0rdan S., Thursday, 28 May 2015 03:39 (ten years ago)

the version of the rockets were chris bosh is playing stretch 4 looking at 5 wide open 3s per game instead of josh smith continues to fascinate me

― J0rdan S., Wednesday, May 27, 2015 11:37 PM (10 seconds ago) Bookmark Flag Post Permalink

yeah bosh was just all whatever im gonna stay here

lag∞n, Thursday, 28 May 2015 03:39 (ten years ago)

got that "player is out (bleeding ear)" phone notification i've been waiting on all these years

Clay, Thursday, 28 May 2015 03:39 (ten years ago)

loll

lag∞n, Thursday, 28 May 2015 03:40 (ten years ago)

i am not proposing the state-sponsored death penalty i am proposing we collectively and violently rise up in the name of decent competitive basketball.

call all destroyer, Thursday, 28 May 2015 03:40 (ten years ago)

Dwight Howard would like to remind everyone that his emotional age is ~13 years old

― Clay, Monday, May 25, 2015 7:39 PM (2 days ago) Bookmark Flag Post Permalink

Clay, Thursday, 28 May 2015 03:41 (ten years ago)

sure am glad they didn't suspend Dwight for this one

frogbs, Thursday, 28 May 2015 03:41 (ten years ago)

xxp thats...not acceptable

(i am casting aspersions at anybody who wanted to kill shaq, too, yall are violent)

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:42 (ten years ago)

dwight staying in this game is some hokey garbage fuck that he's a menace and a baby

Clay, Thursday, 28 May 2015 03:42 (ten years ago)

sry it's time for some killing

call all destroyer, Thursday, 28 May 2015 03:43 (ten years ago)

sometimes killing people is necessary im not gonna pretend to like it but if called upon i will murder

lag∞n, Thursday, 28 May 2015 03:43 (ten years ago)

it would have been really funny if howard ended 2 seasons in a 3 year span being ejected

k3vin k., Thursday, 28 May 2015 03:43 (ten years ago)

it's weird that this game was close for as long as it was given how many rockets are playing badly

call all destroyer, Thursday, 28 May 2015 03:44 (ten years ago)

it's still unclear to me how the rockets win any games

J0rdan S., Thursday, 28 May 2015 03:44 (ten years ago)

turnovers & flops & bricks oh my

rip van wanko, Thursday, 28 May 2015 03:44 (ten years ago)

the version of the rockets were chris bosh is playing stretch 4 looking at 5 wide open 3s per game instead of josh smith continues to fascinate me

― J0rdan S., Wednesday, May 27, 2015 11:37 PM (10 seconds ago) Bookmark Flag Post Permalink

yeah bosh was just all whatever im gonna stay here

― lag∞n, Wednesday, May 27, 2015 11:39 PM (2 minutes ago

ultimately i don't begrudge bosh for taking all that money and staying in miami where his wife was gonna be happy, but i bet it affects his legacy somewhat

k3vin k., Thursday, 28 May 2015 03:45 (ten years ago)

http://sportsgif.com/wp-content/uploads/2013/04/Dwight-Howard-Trash-Talks-Mitch-Kupchak.gif

never forget

Clay, Thursday, 28 May 2015 03:45 (ten years ago)

it's still unclear to me how the rockets win any games

― J0rdan S., Wednesday, May 27, 2015 11:44 PM (32 seconds ago)

corey brewer

k3vin k., Thursday, 28 May 2015 03:45 (ten years ago)

xxp well it starts with james harden not breaking single-game turnover records

call all destroyer, Thursday, 28 May 2015 03:45 (ten years ago)

putting together a wing rotation of ariza, brewer and terry playing major minutes on a conference finals team is the most legit thing morey has ever done

J0rdan S., Thursday, 28 May 2015 03:45 (ten years ago)

the version of the rockets were chris bosh is playing stretch 4 looking at 5 wide open 3s per game instead of josh smith continues to fascinate me
--J0rdan S.

this would be amazing imo particularly because the heat would suck even more

slothroprhymes, Thursday, 28 May 2015 03:46 (ten years ago)

jason terry not getting back on defense to complain to the refs that they didn't call a foul on a hideous flop with his team down 11 w/ 1:40 to go... that was sublime

Clay, Thursday, 28 May 2015 03:46 (ten years ago)

putting together a wing rotation of ariza, brewer and terry playing major minutes on a conference finals team is the most legit thing morey has ever done

― J0rdan S., Wednesday, May 27, 2015 11:45 PM (47 seconds ago) Bookmark Flag Post Permalink

when you put it that way it truly sounds like some "even a blind chicken finds a kernal of corn" type of shit

call all destroyer, Thursday, 28 May 2015 03:48 (ten years ago)

ultimately i don't begrudge bosh for taking all that money and staying in miami where his wife was gonna be happy, but i bet it affects his legacy somewhat

― k3vin k., Wednesday, May 27, 2015 11:45 PM (1 minute ago) Bookmark Flag Post Permalink

im glad he did it because i dont like the rockets

lag∞n, Thursday, 28 May 2015 03:48 (ten years ago)

ariza is p good, tho brewer being decent is a shock and terry has a lot more in the tank than i reckoned.

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:49 (ten years ago)

right with those three guys there were higher odds of two of them being bad than of all three being good

call all destroyer, Thursday, 28 May 2015 03:50 (ten years ago)

bosh also took an extra $20 million

J0rdan S., Thursday, 28 May 2015 03:50 (ten years ago)

thank god this series is over

call all destroyer, Thursday, 28 May 2015 03:51 (ten years ago)

not an insignificant amount of money xp

lag∞n, Thursday, 28 May 2015 03:51 (ten years ago)

harden airing that 3 was just...exquisite. lil b looking at him like...im waiting for your apology

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:51 (ten years ago)

terry not only contributing, he is the go-to guy in the clutch, rox got flaws

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:52 (ten years ago)

mchlae bout to chew his finger off

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:52 (ten years ago)

harden had three incredible games this series and two epic stinkers

lag∞n, Thursday, 28 May 2015 03:52 (ten years ago)

wouldn't be the case if pat bev was healthy xp

call all destroyer, Thursday, 28 May 2015 03:52 (ten years ago)

yessss

polyphonic, Thursday, 28 May 2015 03:52 (ten years ago)

baker's dozen

polyphonic, Thursday, 28 May 2015 03:53 (ten years ago)

morey prob gota little lucky finding rotation players on the scrap heap is a pretty strong indicator of good GMing imo

J0rdan S., Thursday, 28 May 2015 03:53 (ten years ago)

rockets should do the right thing an '91 pistons their way to the locker room with time still on the clock

Clay, Thursday, 28 May 2015 03:53 (ten years ago)

hoops god up there like 'you're welcome'

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:54 (ten years ago)

HARDEN HAS 13 TURNOVERS !!!!!!!!!

lag∞n, Thursday, 28 May 2015 03:54 (ten years ago)

i don't think jet and brewer were really the scrap heap per se, those were established nba players who may/may not have been cooked

call all destroyer, Thursday, 28 May 2015 03:54 (ten years ago)

well we all got the cavs/dubs finals we wanted

k3vin k., Thursday, 28 May 2015 03:54 (ten years ago)

also final lol at mark jackson having to broadcast this

call all destroyer, Thursday, 28 May 2015 03:55 (ten years ago)

@JoshDubowAP: Harden 1st player with 13+ turnovers in any game since Jason Kidd had 14 11/17/2000

polyphonic, Thursday, 28 May 2015 03:55 (ten years ago)

someone start the finals thread it is time

Clay, Thursday, 28 May 2015 03:55 (ten years ago)

Warriors in 6

, Thursday, 28 May 2015 03:56 (ten years ago)

nice harden/curry hug there.

such nice young men.

call all destroyer, Thursday, 28 May 2015 03:56 (ten years ago)

dubs in 4

lag∞n, Thursday, 28 May 2015 03:56 (ten years ago)

Ty to j0rd for pointing out marks 'if I'm Steve Kerr' tic lmao

, Thursday, 28 May 2015 03:56 (ten years ago)

mjax gonna deeply resent kerr for the rest of his life for this for sure

Clay, Thursday, 28 May 2015 03:57 (ten years ago)

one nice thing about this schedule is these guys can rage tonight with no ill effects

call all destroyer, Thursday, 28 May 2015 03:58 (ten years ago)

not sure ive ever seen a series quite like this

http://i.imgur.com/pkDDQji.png

lag∞n, Thursday, 28 May 2015 03:58 (ten years ago)

2015 nba finals: golden state warriors of oakland versus the cleveland cavaliers of cleveland

not a garbageman, i am garbage, man (m bison), Thursday, 28 May 2015 03:58 (ten years ago)

i feel for harden, it's really hard to be that good night in night out

call all destroyer, Thursday, 28 May 2015 03:59 (ten years ago)

steve kerr seems so cool, i wish he were my friend

call all destroyer, Thursday, 28 May 2015 04:02 (ten years ago)

steve kerr's story is pretty incredible. key player on championship teams, helped put together a team that permanently altered the game, became one of the best broadcasters in the nba and then became a coach and made the finals in his first year

J0rdan S., Thursday, 28 May 2015 04:04 (ten years ago)

naw he came in at the end of the suns run

lag∞n, Thursday, 28 May 2015 04:05 (ten years ago)

kerr was dope in college also

polyphonic, Thursday, 28 May 2015 04:06 (ten years ago)

he was the official GM at the end but he helped out the front office before im pretty sure

regardless

J0rdan S., Thursday, 28 May 2015 04:06 (ten years ago)

kerr was generally panned as a gm iirc

Clay, Thursday, 28 May 2015 04:08 (ten years ago)

like i think he's pretty much admitted he was bad at it

Clay, Thursday, 28 May 2015 04:08 (ten years ago)

http://hoopshype.com/general_managers/steve_kerr.htm

looks decent to me

polyphonic, Thursday, 28 May 2015 04:12 (ten years ago)

https://vine.co/v/ebrVu91Qplu

lag∞n, Thursday, 28 May 2015 04:14 (ten years ago)

the shaq thing was just so huge it's v hard to judge appropriately

call all destroyer, Thursday, 28 May 2015 04:14 (ten years ago)

riley curry is a star

Clay, Thursday, 28 May 2015 04:18 (ten years ago)

Kerr had to do some horrible things under financial pressure from Sarver.

David Griffin and D'Antoni probably deserve the most credit for building the Suns.

Matt Armstrong, Thursday, 28 May 2015 04:50 (ten years ago)

NBA on ESPN ‏@ESPNNBA 1m1 minute ago
Steph Curry will become 1st player NBA history to face each of other 4 members of 1st-team All-NBA in same playoffs.

this is totally crazy to me btw

Clay, Thursday, 28 May 2015 04:51 (ten years ago)

not that it's the first time but that it could plausibly even happen and it did

Clay, Thursday, 28 May 2015 04:51 (ten years ago)

its cool cause hes the mvp too

lag∞n, Thursday, 28 May 2015 04:52 (ten years ago)

also each of them are on a diff team

lag∞n, Thursday, 28 May 2015 04:53 (ten years ago)

its like some street fighting tournament

https://pbs.twimg.com/media/CGEPBUYUEAI0IbL.jpg

lag∞n, Thursday, 28 May 2015 04:54 (ten years ago)

hmm

Scott Howard-Cooper
‏@SHowardCooper
#Warriors say Klay Thompson began to show concussion-like symptoms after the game, after not showing any when originally hit in the head.

lag∞n, Thursday, 28 May 2015 05:16 (ten years ago)

Got popped in the jaw and said he was dizzy. I bet he's concussed. Lucky there's like 2 months til the next game

Spottie, Thursday, 28 May 2015 05:17 (ten years ago)

going to be sweet to see the two best players in the game (curry & dellavedova) playing each other

Cavs in three (Warriors say No Más before game four)

brownie, Thursday, 28 May 2015 13:04 (ten years ago)

lol

johnny crunch, Thursday, 28 May 2015 13:12 (ten years ago)

The Cursed of the Based God is real. :o

Madison Dumbbarfer (Leee), Thursday, 28 May 2015 17:39 (ten years ago)

you might say it was cooked up

Nhex, Thursday, 28 May 2015 18:05 (ten years ago)

mjax gonna deeply resent kerr for the rest of his life for this for sure

― Clay, Wednesday, May 27, 2015 11:57 PM (Yesterday) Bookmark Flag Post Permalink

Sometime after klay got rocked by Ariza's knee, mjax mixed it up and said something like "you wouldn't know this from outside but after green, curry and Thompson are the toughest guys on the team"

Like he was ready to grab a sandwich board with I USED TO COACH THIS TEAM REMEMBER written on it and parade around oracle

juice college (agent hibachi), Thursday, 28 May 2015 19:18 (ten years ago)

NBA on ESPN ‏@ESPNNBA 1m1 minute ago
Steph Curry will become 1st player NBA history to face each of other 4 members of 1st-team All-NBA in same playoffs.

this is totally crazy to me btw

― Clay, Thursday, May 28, 2015 12:51 AM (14 hours ago) Bookmark Flag Post Permalink

This is the wildest thing also because it requires exactly one (1) player from the opposite conference to be on the first team, then also make the finals

juice college (agent hibachi), Thursday, 28 May 2015 19:20 (ten years ago)

nah all 4 could be on the team he plays in the first round

k3vin k., Thursday, 28 May 2015 19:39 (ten years ago)

I was thinking Bird would have done this, but it looks Bernard King screwed it up for him in '85.

One bad call from barely losing to (Alex in SF), Thursday, 28 May 2015 19:51 (ten years ago)

Also fact that they lost championship that year probably didn't help.

One bad call from barely losing to (Alex in SF), Thursday, 28 May 2015 20:01 (ten years ago)

given how much a team's performance is tied to superstar players, I'm surprised it hasn't happened before - though the fact that Curry is getting exactly one per round and (most likely) beating them all really is something cool

frogbs, Thursday, 28 May 2015 20:03 (ten years ago)

Leandro Barbosa ‏@TheBlurBarbosa 3m3 minutes ago
It has been a long journey coach! #WeWantMore #CongratsToAllStaff 🏆#TeamWork #SatisfyingMoment #WarriorsFamily

slothroprhymes, Thursday, 28 May 2015 20:22 (ten years ago)

followed by this photo https://instagram.com/p/3PRVDOHnrt/

slothroprhymes, Thursday, 28 May 2015 20:24 (ten years ago)

nah all 4 could be on the team he plays in the first round

― k3vin k., Thursday, May 28, 2015 3:39 PM (1 hour ago) Bookmark Flag Post Permalink

Oh yeah whoops, I somehow read into it the thing that is also happening where he is facing one per round mortal kombat style

juice college (agent hibachi), Thursday, 28 May 2015 20:47 (ten years ago)


You must be logged in to post. Please either login here, or if you are not registered, you may register here.